ID: 954108317

View in Genome Browser
Species Human (GRCh38)
Location 3:48420806-48420828
Sequence CCCAGGCCTGGGCTTCCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 817
Summary {0: 1, 1: 0, 2: 7, 3: 108, 4: 701}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954108317_954108327 8 Left 954108317 3:48420806-48420828 CCACAGGGAAGCCCAGGCCTGGG 0: 1
1: 0
2: 7
3: 108
4: 701
Right 954108327 3:48420837-48420859 GAGGAACTCACTGCGCAGATGGG 0: 1
1: 0
2: 2
3: 13
4: 134
954108317_954108328 11 Left 954108317 3:48420806-48420828 CCACAGGGAAGCCCAGGCCTGGG 0: 1
1: 0
2: 7
3: 108
4: 701
Right 954108328 3:48420840-48420862 GAACTCACTGCGCAGATGGGCGG 0: 1
1: 0
2: 0
3: 10
4: 93
954108317_954108326 7 Left 954108317 3:48420806-48420828 CCACAGGGAAGCCCAGGCCTGGG 0: 1
1: 0
2: 7
3: 108
4: 701
Right 954108326 3:48420836-48420858 CGAGGAACTCACTGCGCAGATGG 0: 1
1: 0
2: 0
3: 18
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954108317 Original CRISPR CCCAGGCCTGGGCTTCCCTG TGG (reversed) Intronic