ID: 954108703

View in Genome Browser
Species Human (GRCh38)
Location 3:48422592-48422614
Sequence GACTTTCCTCCATCCCCGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 105}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954108703_954108706 3 Left 954108703 3:48422592-48422614 CCTAGCGGGGATGGAGGAAAGTC 0: 1
1: 0
2: 0
3: 9
4: 105
Right 954108706 3:48422618-48422640 GGTAAACACCACCCAGTCCTGGG 0: 1
1: 0
2: 0
3: 8
4: 108
954108703_954108708 9 Left 954108703 3:48422592-48422614 CCTAGCGGGGATGGAGGAAAGTC 0: 1
1: 0
2: 0
3: 9
4: 105
Right 954108708 3:48422624-48422646 CACCACCCAGTCCTGGGGAGAGG 0: 1
1: 0
2: 7
3: 37
4: 327
954108703_954108714 30 Left 954108703 3:48422592-48422614 CCTAGCGGGGATGGAGGAAAGTC 0: 1
1: 0
2: 0
3: 9
4: 105
Right 954108714 3:48422645-48422667 GGAGCTCAGGTCATCTCTCCTGG 0: 1
1: 0
2: 1
3: 16
4: 184
954108703_954108705 2 Left 954108703 3:48422592-48422614 CCTAGCGGGGATGGAGGAAAGTC 0: 1
1: 0
2: 0
3: 9
4: 105
Right 954108705 3:48422617-48422639 AGGTAAACACCACCCAGTCCTGG 0: 1
1: 0
2: 0
3: 15
4: 140
954108703_954108712 17 Left 954108703 3:48422592-48422614 CCTAGCGGGGATGGAGGAAAGTC 0: 1
1: 0
2: 0
3: 9
4: 105
Right 954108712 3:48422632-48422654 AGTCCTGGGGAGAGGAGCTCAGG 0: 1
1: 0
2: 1
3: 44
4: 442
954108703_954108707 4 Left 954108703 3:48422592-48422614 CCTAGCGGGGATGGAGGAAAGTC 0: 1
1: 0
2: 0
3: 9
4: 105
Right 954108707 3:48422619-48422641 GTAAACACCACCCAGTCCTGGGG 0: 1
1: 0
2: 0
3: 6
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954108703 Original CRISPR GACTTTCCTCCATCCCCGCT AGG (reversed) Intronic