ID: 954108709

View in Genome Browser
Species Human (GRCh38)
Location 3:48422626-48422648
Sequence CTCCTCTCCCCAGGACTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 722
Summary {0: 1, 1: 0, 2: 0, 3: 55, 4: 666}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954108709_954108716 3 Left 954108709 3:48422626-48422648 CCACCCAGTCCTGGGGAGAGGAG 0: 1
1: 0
2: 0
3: 55
4: 666
Right 954108716 3:48422652-48422674 AGGTCATCTCTCCTGGCCCAGGG 0: 1
1: 1
2: 0
3: 17
4: 199
954108709_954108719 12 Left 954108709 3:48422626-48422648 CCACCCAGTCCTGGGGAGAGGAG 0: 1
1: 0
2: 0
3: 55
4: 666
Right 954108719 3:48422661-48422683 CTCCTGGCCCAGGGGTCACAGGG 0: 1
1: 0
2: 2
3: 34
4: 346
954108709_954108717 4 Left 954108709 3:48422626-48422648 CCACCCAGTCCTGGGGAGAGGAG 0: 1
1: 0
2: 0
3: 55
4: 666
Right 954108717 3:48422653-48422675 GGTCATCTCTCCTGGCCCAGGGG 0: 1
1: 0
2: 1
3: 21
4: 230
954108709_954108718 11 Left 954108709 3:48422626-48422648 CCACCCAGTCCTGGGGAGAGGAG 0: 1
1: 0
2: 0
3: 55
4: 666
Right 954108718 3:48422660-48422682 TCTCCTGGCCCAGGGGTCACAGG 0: 1
1: 0
2: 5
3: 38
4: 282
954108709_954108714 -4 Left 954108709 3:48422626-48422648 CCACCCAGTCCTGGGGAGAGGAG 0: 1
1: 0
2: 0
3: 55
4: 666
Right 954108714 3:48422645-48422667 GGAGCTCAGGTCATCTCTCCTGG 0: 1
1: 0
2: 1
3: 16
4: 184
954108709_954108723 27 Left 954108709 3:48422626-48422648 CCACCCAGTCCTGGGGAGAGGAG 0: 1
1: 0
2: 0
3: 55
4: 666
Right 954108723 3:48422676-48422698 TCACAGGGATAGCTTAAACCAGG 0: 1
1: 0
2: 0
3: 30
4: 408
954108709_954108715 2 Left 954108709 3:48422626-48422648 CCACCCAGTCCTGGGGAGAGGAG 0: 1
1: 0
2: 0
3: 55
4: 666
Right 954108715 3:48422651-48422673 CAGGTCATCTCTCCTGGCCCAGG 0: 1
1: 1
2: 2
3: 42
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954108709 Original CRISPR CTCCTCTCCCCAGGACTGGG TGG (reversed) Intronic