ID: 954108711

View in Genome Browser
Species Human (GRCh38)
Location 3:48422630-48422652
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 6, 3: 30, 4: 237}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954108711_954108715 -2 Left 954108711 3:48422630-48422652 CCAGTCCTGGGGAGAGGAGCTCA 0: 1
1: 0
2: 6
3: 30
4: 237
Right 954108715 3:48422651-48422673 CAGGTCATCTCTCCTGGCCCAGG 0: 1
1: 1
2: 2
3: 42
4: 255
954108711_954108714 -8 Left 954108711 3:48422630-48422652 CCAGTCCTGGGGAGAGGAGCTCA 0: 1
1: 0
2: 6
3: 30
4: 237
Right 954108714 3:48422645-48422667 GGAGCTCAGGTCATCTCTCCTGG 0: 1
1: 0
2: 1
3: 16
4: 184
954108711_954108718 7 Left 954108711 3:48422630-48422652 CCAGTCCTGGGGAGAGGAGCTCA 0: 1
1: 0
2: 6
3: 30
4: 237
Right 954108718 3:48422660-48422682 TCTCCTGGCCCAGGGGTCACAGG 0: 1
1: 0
2: 5
3: 38
4: 282
954108711_954108723 23 Left 954108711 3:48422630-48422652 CCAGTCCTGGGGAGAGGAGCTCA 0: 1
1: 0
2: 6
3: 30
4: 237
Right 954108723 3:48422676-48422698 TCACAGGGATAGCTTAAACCAGG 0: 1
1: 0
2: 0
3: 30
4: 408
954108711_954108724 27 Left 954108711 3:48422630-48422652 CCAGTCCTGGGGAGAGGAGCTCA 0: 1
1: 0
2: 6
3: 30
4: 237
Right 954108724 3:48422680-48422702 AGGGATAGCTTAAACCAGGCTGG 0: 1
1: 0
2: 0
3: 8
4: 290
954108711_954108719 8 Left 954108711 3:48422630-48422652 CCAGTCCTGGGGAGAGGAGCTCA 0: 1
1: 0
2: 6
3: 30
4: 237
Right 954108719 3:48422661-48422683 CTCCTGGCCCAGGGGTCACAGGG 0: 1
1: 0
2: 2
3: 34
4: 346
954108711_954108717 0 Left 954108711 3:48422630-48422652 CCAGTCCTGGGGAGAGGAGCTCA 0: 1
1: 0
2: 6
3: 30
4: 237
Right 954108717 3:48422653-48422675 GGTCATCTCTCCTGGCCCAGGGG 0: 1
1: 0
2: 1
3: 21
4: 230
954108711_954108725 28 Left 954108711 3:48422630-48422652 CCAGTCCTGGGGAGAGGAGCTCA 0: 1
1: 0
2: 6
3: 30
4: 237
Right 954108725 3:48422681-48422703 GGGATAGCTTAAACCAGGCTGGG 0: 1
1: 0
2: 0
3: 6
4: 87
954108711_954108716 -1 Left 954108711 3:48422630-48422652 CCAGTCCTGGGGAGAGGAGCTCA 0: 1
1: 0
2: 6
3: 30
4: 237
Right 954108716 3:48422652-48422674 AGGTCATCTCTCCTGGCCCAGGG 0: 1
1: 1
2: 0
3: 17
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954108711 Original CRISPR TGAGCTCCTCTCCCCAGGAC TGG (reversed) Intronic