ID: 954108714

View in Genome Browser
Species Human (GRCh38)
Location 3:48422645-48422667
Sequence GGAGCTCAGGTCATCTCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 184}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954108711_954108714 -8 Left 954108711 3:48422630-48422652 CCAGTCCTGGGGAGAGGAGCTCA 0: 1
1: 0
2: 6
3: 30
4: 237
Right 954108714 3:48422645-48422667 GGAGCTCAGGTCATCTCTCCTGG 0: 1
1: 0
2: 1
3: 16
4: 184
954108710_954108714 -7 Left 954108710 3:48422629-48422651 CCCAGTCCTGGGGAGAGGAGCTC 0: 1
1: 0
2: 6
3: 28
4: 259
Right 954108714 3:48422645-48422667 GGAGCTCAGGTCATCTCTCCTGG 0: 1
1: 0
2: 1
3: 16
4: 184
954108709_954108714 -4 Left 954108709 3:48422626-48422648 CCACCCAGTCCTGGGGAGAGGAG 0: 1
1: 0
2: 0
3: 55
4: 666
Right 954108714 3:48422645-48422667 GGAGCTCAGGTCATCTCTCCTGG 0: 1
1: 0
2: 1
3: 16
4: 184
954108703_954108714 30 Left 954108703 3:48422592-48422614 CCTAGCGGGGATGGAGGAAAGTC 0: 1
1: 0
2: 0
3: 9
4: 105
Right 954108714 3:48422645-48422667 GGAGCTCAGGTCATCTCTCCTGG 0: 1
1: 0
2: 1
3: 16
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954108714 Original CRISPR GGAGCTCAGGTCATCTCTCC TGG Intronic