ID: 954108716

View in Genome Browser
Species Human (GRCh38)
Location 3:48422652-48422674
Sequence AGGTCATCTCTCCTGGCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 1, 2: 0, 3: 17, 4: 199}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954108713_954108716 -6 Left 954108713 3:48422635-48422657 CCTGGGGAGAGGAGCTCAGGTCA 0: 1
1: 0
2: 0
3: 32
4: 328
Right 954108716 3:48422652-48422674 AGGTCATCTCTCCTGGCCCAGGG 0: 1
1: 1
2: 0
3: 17
4: 199
954108711_954108716 -1 Left 954108711 3:48422630-48422652 CCAGTCCTGGGGAGAGGAGCTCA 0: 1
1: 0
2: 6
3: 30
4: 237
Right 954108716 3:48422652-48422674 AGGTCATCTCTCCTGGCCCAGGG 0: 1
1: 1
2: 0
3: 17
4: 199
954108710_954108716 0 Left 954108710 3:48422629-48422651 CCCAGTCCTGGGGAGAGGAGCTC 0: 1
1: 0
2: 6
3: 28
4: 259
Right 954108716 3:48422652-48422674 AGGTCATCTCTCCTGGCCCAGGG 0: 1
1: 1
2: 0
3: 17
4: 199
954108709_954108716 3 Left 954108709 3:48422626-48422648 CCACCCAGTCCTGGGGAGAGGAG 0: 1
1: 0
2: 0
3: 55
4: 666
Right 954108716 3:48422652-48422674 AGGTCATCTCTCCTGGCCCAGGG 0: 1
1: 1
2: 0
3: 17
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954108716 Original CRISPR AGGTCATCTCTCCTGGCCCA GGG Intronic