ID: 954108717

View in Genome Browser
Species Human (GRCh38)
Location 3:48422653-48422675
Sequence GGTCATCTCTCCTGGCCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 230}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954108710_954108717 1 Left 954108710 3:48422629-48422651 CCCAGTCCTGGGGAGAGGAGCTC 0: 1
1: 0
2: 6
3: 28
4: 259
Right 954108717 3:48422653-48422675 GGTCATCTCTCCTGGCCCAGGGG 0: 1
1: 0
2: 1
3: 21
4: 230
954108709_954108717 4 Left 954108709 3:48422626-48422648 CCACCCAGTCCTGGGGAGAGGAG 0: 1
1: 0
2: 0
3: 55
4: 666
Right 954108717 3:48422653-48422675 GGTCATCTCTCCTGGCCCAGGGG 0: 1
1: 0
2: 1
3: 21
4: 230
954108713_954108717 -5 Left 954108713 3:48422635-48422657 CCTGGGGAGAGGAGCTCAGGTCA 0: 1
1: 0
2: 0
3: 32
4: 328
Right 954108717 3:48422653-48422675 GGTCATCTCTCCTGGCCCAGGGG 0: 1
1: 0
2: 1
3: 21
4: 230
954108711_954108717 0 Left 954108711 3:48422630-48422652 CCAGTCCTGGGGAGAGGAGCTCA 0: 1
1: 0
2: 6
3: 30
4: 237
Right 954108717 3:48422653-48422675 GGTCATCTCTCCTGGCCCAGGGG 0: 1
1: 0
2: 1
3: 21
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954108717 Original CRISPR GGTCATCTCTCCTGGCCCAG GGG Intronic