ID: 954108718

View in Genome Browser
Species Human (GRCh38)
Location 3:48422660-48422682
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 5, 3: 38, 4: 282}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954108709_954108718 11 Left 954108709 3:48422626-48422648 CCACCCAGTCCTGGGGAGAGGAG 0: 1
1: 0
2: 0
3: 55
4: 666
Right 954108718 3:48422660-48422682 TCTCCTGGCCCAGGGGTCACAGG 0: 1
1: 0
2: 5
3: 38
4: 282
954108710_954108718 8 Left 954108710 3:48422629-48422651 CCCAGTCCTGGGGAGAGGAGCTC 0: 1
1: 0
2: 6
3: 28
4: 259
Right 954108718 3:48422660-48422682 TCTCCTGGCCCAGGGGTCACAGG 0: 1
1: 0
2: 5
3: 38
4: 282
954108713_954108718 2 Left 954108713 3:48422635-48422657 CCTGGGGAGAGGAGCTCAGGTCA 0: 1
1: 0
2: 0
3: 32
4: 328
Right 954108718 3:48422660-48422682 TCTCCTGGCCCAGGGGTCACAGG 0: 1
1: 0
2: 5
3: 38
4: 282
954108711_954108718 7 Left 954108711 3:48422630-48422652 CCAGTCCTGGGGAGAGGAGCTCA 0: 1
1: 0
2: 6
3: 30
4: 237
Right 954108718 3:48422660-48422682 TCTCCTGGCCCAGGGGTCACAGG 0: 1
1: 0
2: 5
3: 38
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type