ID: 954108720

View in Genome Browser
Species Human (GRCh38)
Location 3:48422663-48422685
Sequence ATCCCTGTGACCCCTGGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 290}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954108720_954108723 -10 Left 954108720 3:48422663-48422685 CCTGGCCCAGGGGTCACAGGGAT 0: 1
1: 0
2: 3
3: 31
4: 290
Right 954108723 3:48422676-48422698 TCACAGGGATAGCTTAAACCAGG 0: 1
1: 0
2: 0
3: 30
4: 408
954108720_954108730 27 Left 954108720 3:48422663-48422685 CCTGGCCCAGGGGTCACAGGGAT 0: 1
1: 0
2: 3
3: 31
4: 290
Right 954108730 3:48422713-48422735 ATCTGTTCCCTCCAGACTCTGGG 0: 1
1: 0
2: 0
3: 35
4: 221
954108720_954108725 -5 Left 954108720 3:48422663-48422685 CCTGGCCCAGGGGTCACAGGGAT 0: 1
1: 0
2: 3
3: 31
4: 290
Right 954108725 3:48422681-48422703 GGGATAGCTTAAACCAGGCTGGG 0: 1
1: 0
2: 0
3: 6
4: 87
954108720_954108729 26 Left 954108720 3:48422663-48422685 CCTGGCCCAGGGGTCACAGGGAT 0: 1
1: 0
2: 3
3: 31
4: 290
Right 954108729 3:48422712-48422734 AATCTGTTCCCTCCAGACTCTGG 0: 1
1: 0
2: 0
3: 20
4: 193
954108720_954108731 28 Left 954108720 3:48422663-48422685 CCTGGCCCAGGGGTCACAGGGAT 0: 1
1: 0
2: 3
3: 31
4: 290
Right 954108731 3:48422714-48422736 TCTGTTCCCTCCAGACTCTGGGG 0: 1
1: 0
2: 2
3: 33
4: 306
954108720_954108724 -6 Left 954108720 3:48422663-48422685 CCTGGCCCAGGGGTCACAGGGAT 0: 1
1: 0
2: 3
3: 31
4: 290
Right 954108724 3:48422680-48422702 AGGGATAGCTTAAACCAGGCTGG 0: 1
1: 0
2: 0
3: 8
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954108720 Original CRISPR ATCCCTGTGACCCCTGGGCC AGG (reversed) Intronic