ID: 954108721

View in Genome Browser
Species Human (GRCh38)
Location 3:48422668-48422690
Sequence AAGCTATCCCTGTGACCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 129}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954108721_954108735 29 Left 954108721 3:48422668-48422690 CCCAGGGGTCACAGGGATAGCTT 0: 1
1: 0
2: 0
3: 4
4: 129
Right 954108735 3:48422720-48422742 CCCTCCAGACTCTGGGGCAGGGG 0: 1
1: 0
2: 2
3: 32
4: 450
954108721_954108729 21 Left 954108721 3:48422668-48422690 CCCAGGGGTCACAGGGATAGCTT 0: 1
1: 0
2: 0
3: 4
4: 129
Right 954108729 3:48422712-48422734 AATCTGTTCCCTCCAGACTCTGG 0: 1
1: 0
2: 0
3: 20
4: 193
954108721_954108725 -10 Left 954108721 3:48422668-48422690 CCCAGGGGTCACAGGGATAGCTT 0: 1
1: 0
2: 0
3: 4
4: 129
Right 954108725 3:48422681-48422703 GGGATAGCTTAAACCAGGCTGGG 0: 1
1: 0
2: 0
3: 6
4: 87
954108721_954108732 27 Left 954108721 3:48422668-48422690 CCCAGGGGTCACAGGGATAGCTT 0: 1
1: 0
2: 0
3: 4
4: 129
Right 954108732 3:48422718-48422740 TTCCCTCCAGACTCTGGGGCAGG 0: 1
1: 0
2: 1
3: 33
4: 324
954108721_954108733 28 Left 954108721 3:48422668-48422690 CCCAGGGGTCACAGGGATAGCTT 0: 1
1: 0
2: 0
3: 4
4: 129
Right 954108733 3:48422719-48422741 TCCCTCCAGACTCTGGGGCAGGG 0: 1
1: 0
2: 4
3: 32
4: 334
954108721_954108730 22 Left 954108721 3:48422668-48422690 CCCAGGGGTCACAGGGATAGCTT 0: 1
1: 0
2: 0
3: 4
4: 129
Right 954108730 3:48422713-48422735 ATCTGTTCCCTCCAGACTCTGGG 0: 1
1: 0
2: 0
3: 35
4: 221
954108721_954108731 23 Left 954108721 3:48422668-48422690 CCCAGGGGTCACAGGGATAGCTT 0: 1
1: 0
2: 0
3: 4
4: 129
Right 954108731 3:48422714-48422736 TCTGTTCCCTCCAGACTCTGGGG 0: 1
1: 0
2: 2
3: 33
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954108721 Original CRISPR AAGCTATCCCTGTGACCCCT GGG (reversed) Intronic