ID: 954108723

View in Genome Browser
Species Human (GRCh38)
Location 3:48422676-48422698
Sequence TCACAGGGATAGCTTAAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 439
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 408}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954108711_954108723 23 Left 954108711 3:48422630-48422652 CCAGTCCTGGGGAGAGGAGCTCA 0: 1
1: 0
2: 6
3: 30
4: 237
Right 954108723 3:48422676-48422698 TCACAGGGATAGCTTAAACCAGG 0: 1
1: 0
2: 0
3: 30
4: 408
954108709_954108723 27 Left 954108709 3:48422626-48422648 CCACCCAGTCCTGGGGAGAGGAG 0: 1
1: 0
2: 0
3: 55
4: 666
Right 954108723 3:48422676-48422698 TCACAGGGATAGCTTAAACCAGG 0: 1
1: 0
2: 0
3: 30
4: 408
954108710_954108723 24 Left 954108710 3:48422629-48422651 CCCAGTCCTGGGGAGAGGAGCTC 0: 1
1: 0
2: 6
3: 28
4: 259
Right 954108723 3:48422676-48422698 TCACAGGGATAGCTTAAACCAGG 0: 1
1: 0
2: 0
3: 30
4: 408
954108713_954108723 18 Left 954108713 3:48422635-48422657 CCTGGGGAGAGGAGCTCAGGTCA 0: 1
1: 0
2: 0
3: 32
4: 328
Right 954108723 3:48422676-48422698 TCACAGGGATAGCTTAAACCAGG 0: 1
1: 0
2: 0
3: 30
4: 408
954108720_954108723 -10 Left 954108720 3:48422663-48422685 CCTGGCCCAGGGGTCACAGGGAT 0: 1
1: 0
2: 3
3: 31
4: 290
Right 954108723 3:48422676-48422698 TCACAGGGATAGCTTAAACCAGG 0: 1
1: 0
2: 0
3: 30
4: 408

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954108723 Original CRISPR TCACAGGGATAGCTTAAACC AGG Intronic