ID: 954111117

View in Genome Browser
Species Human (GRCh38)
Location 3:48433706-48433728
Sequence TCTCGAGCACAGGATGCTGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 130}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954111117_954111125 28 Left 954111117 3:48433706-48433728 CCTGCAGCATCCTGTGCTCGAGA 0: 1
1: 0
2: 1
3: 8
4: 130
Right 954111125 3:48433757-48433779 CCCTGGAGACACGGTCCAAGCGG 0: 1
1: 0
2: 0
3: 14
4: 88
954111117_954111122 19 Left 954111117 3:48433706-48433728 CCTGCAGCATCCTGTGCTCGAGA 0: 1
1: 0
2: 1
3: 8
4: 130
Right 954111122 3:48433748-48433770 GACTGTCCTCCCTGGAGACACGG 0: 1
1: 1
2: 2
3: 27
4: 248
954111117_954111121 11 Left 954111117 3:48433706-48433728 CCTGCAGCATCCTGTGCTCGAGA 0: 1
1: 0
2: 1
3: 8
4: 130
Right 954111121 3:48433740-48433762 CAAGTACTGACTGTCCTCCCTGG 0: 1
1: 0
2: 0
3: 8
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954111117 Original CRISPR TCTCGAGCACAGGATGCTGC AGG (reversed) Exonic
900797300 1:4716089-4716111 TCTATAGCACAGGTTGTTGCTGG + Intronic
901447972 1:9319647-9319669 GCTGGTGCAGAGGATGCTGCGGG + Intronic
905004538 1:34699140-34699162 TCTAGAGCACAGGAAGCTGCAGG + Intergenic
906728337 1:48060139-48060161 TCTCTAGCCCAGGTTGCTACAGG - Intergenic
907265564 1:53258224-53258246 TCTGGGACACAGTATGCTGCTGG - Intronic
907305540 1:53511002-53511024 CCTGGACCACAGGATGCTGCAGG + Intronic
916044200 1:160986650-160986672 ACTAGAGGACAGGATGCTTCTGG - Intergenic
916849323 1:168687048-168687070 TCTGGAGCACAGGAACCTGGCGG + Intergenic
923052370 1:230397826-230397848 GCTTAACCACAGGATGCTGCCGG + Intronic
1063657693 10:8008648-8008670 TGTGGAGCACAGGCTGCTCCAGG + Intronic
1064886162 10:20114772-20114794 TCTGGAGCACAGGATACATCTGG + Intronic
1067187567 10:44043611-44043633 GCCCGGGCAGAGGATGCTGCAGG - Intergenic
1067415394 10:46098189-46098211 TCTGGAGCACAGGGGCCTGCAGG + Intergenic
1067435438 10:46273265-46273287 TCTGGAGCACAGGGGCCTGCAGG + Intergenic
1067438282 10:46294096-46294118 TCTGGAGCACAGGGGCCTGCAGG - Intronic
1069914897 10:71781442-71781464 CCTGGAGCACAGGAGGATGCCGG + Intronic
1071437177 10:85658143-85658165 TCTGGAGCACAGGATGACACAGG - Intronic
1072805877 10:98423877-98423899 TCTCGTGCTCAGGCTGCTCCAGG - Exonic
1075072451 10:119327894-119327916 TCTCGGGCCGAGAATGCTGCTGG + Intronic
1076494630 10:130889018-130889040 TACCGAGCCCAGGAGGCTGCAGG + Intergenic
1077135997 11:999025-999047 TCTGGTGCACAGGCTGCTGTGGG + Intronic
1080407749 11:31994828-31994850 TGTAGTGGACAGGATGCTGCAGG - Intronic
1083769595 11:64859082-64859104 GAGCGAGCACAGGCTGCTGCGGG - Intronic
1084289736 11:68154334-68154356 TCTCCGGCACAGAATGATGCTGG + Intergenic
1085267688 11:75246926-75246948 TCCCGAGCCCAGGATGCCCCAGG + Intergenic
1087729736 11:101765220-101765242 TCTGGAGCAGAGGCTGCTGGAGG - Intronic
1088560628 11:111112227-111112249 ACTGGAGCACAGAATGCTGAGGG + Intergenic
1088821086 11:113457957-113457979 TCCCCAGCCCAGGCTGCTGCTGG - Intronic
1093679423 12:21983900-21983922 TCTTGATCACAAGATGCTTCTGG - Intergenic
1097180625 12:57169732-57169754 GCTTGAGAAAAGGATGCTGCAGG + Intronic
1103860253 12:124006748-124006770 TCGAGTGCACAGGATGCTGGGGG + Intronic
1104602509 12:130162867-130162889 TCCCGGGCACGGGCTGCTGCTGG - Exonic
1106105364 13:26728397-26728419 GCTTGAGCACACGACGCTGCAGG + Intergenic
1107415967 13:40200413-40200435 CCTAGAGCAGGGGATGCTGCAGG - Intergenic
1108445223 13:50501772-50501794 TCACCAGCACAGGATATTGCAGG - Intronic
1108508405 13:51133984-51134006 GAGCGTGCACAGGATGCTGCAGG - Intergenic
1108567906 13:51719343-51719365 TGTCCAGCAAAGGATACTGCAGG - Exonic
1115514138 14:34168288-34168310 ACCAGAGCACAGGATGCTGGAGG - Intronic
1119220981 14:72907225-72907247 TCAAGAGCACATGGTGCTGCTGG + Intergenic
1119690478 14:76667929-76667951 TATCGAGGCCAGAATGCTGCTGG + Intergenic
1120964161 14:90152897-90152919 TCTGTAGCACAGGATCATGCTGG + Intronic
1122212557 14:100182061-100182083 GCTGGAGCAGAGGATGCTGGAGG + Intergenic
1125077296 15:35634082-35634104 TCTTGAGCACAGGAGGTTGGAGG + Intergenic
1126127518 15:45309211-45309233 TCTCGAGGACAAGAAGCTTCTGG + Intergenic
1129231355 15:74198904-74198926 TCTCCACCACATGATTCTGCTGG - Intronic
1130520082 15:84655394-84655416 TCTTCAGTACAGGAGGCTGCTGG - Exonic
1133777306 16:8907074-8907096 TCTCAAGCACAGCATGCACCCGG + Intronic
1134054753 16:11162865-11162887 TCTGCAGCATGGGATGCTGCAGG + Intronic
1136172921 16:28499162-28499184 GCTCGGCCTCAGGATGCTGCTGG + Intergenic
1139484016 16:67246286-67246308 TCTCCAGCACTGGAGGCGGCCGG + Intronic
1142247512 16:88976717-88976739 TCTCCAGCACAGGGTGCGTCTGG + Exonic
1147611081 17:41802170-41802192 TCTGGACCACAGGATGGTGGTGG - Exonic
1148861075 17:50604612-50604634 GCTCGAGCACAGTGGGCTGCAGG + Intronic
1156781041 18:40851203-40851225 TCTTGAGCAAAAAATGCTGCCGG - Intergenic
1160085911 18:75777700-75777722 TCTAGAGCATAGGAGGCTGCAGG + Intergenic
1162337519 19:10071014-10071036 TCGGGTTCACAGGATGCTGCAGG + Intergenic
1166864717 19:45828933-45828955 TCTCGGGGACAGGAGGGTGCAGG + Intronic
1168413283 19:56153374-56153396 CCTGGAGCTCAGGATGGTGCTGG + Intronic
924971698 2:133918-133940 TCCCCAGCACTGGCTGCTGCTGG - Intergenic
925194265 2:1910547-1910569 TCTCCAGCAGAGAATGCTGGCGG + Intronic
928453323 2:31398196-31398218 TCACCAGAACAGGATTCTGCAGG - Intronic
929927964 2:46230890-46230912 TCTGCAGGACAGGATGTTGCTGG + Intergenic
933637595 2:84724611-84724633 TCTCCAGCAAAGCCTGCTGCTGG + Intronic
935582139 2:104765568-104765590 ACTGGAGCATAGGATGCTGTGGG + Intergenic
941812479 2:169768339-169768361 TCTGGCGCCCATGATGCTGCCGG - Intronic
942911792 2:181252825-181252847 TCACCAGCACAAGATGCTTCTGG + Intergenic
946219071 2:218210958-218210980 TCTCCACAACTGGATGCTGCTGG + Intergenic
948312869 2:237002254-237002276 TCCCCTGCACAGGCTGCTGCTGG + Intergenic
948797271 2:240411491-240411513 TCTGGGGGACAGGAAGCTGCAGG + Intergenic
1170384536 20:15801320-15801342 GCTGGAGCAGAGGATGCTGGAGG + Intronic
1171785149 20:29457207-29457229 TCTGGAGCACAGGGTGCGGGAGG + Intergenic
1175388877 20:58614032-58614054 CCTAGAGCACTGGATGCTGGGGG + Intergenic
1175482975 20:59324469-59324491 TCCCGAGACCAGGATGCTGCAGG - Exonic
1180799509 22:18625224-18625246 TCTGGAGGAGAGGATGCTGAGGG + Intergenic
1181222207 22:21370042-21370064 TCTGGAGGAGAGGATGCTGAGGG - Intergenic
1181637966 22:24183035-24183057 TCTGGAGGAGAGGATGCTGAGGG - Exonic
1181735212 22:24876241-24876263 TCATGCTCACAGGATGCTGCAGG - Intronic
1182674227 22:32025163-32025185 TCTTGAGCACAGGTAGCTGCTGG + Intergenic
1184651915 22:45923311-45923333 TCTAGAGGACCGGATGCAGCTGG - Exonic
950730297 3:14950454-14950476 TCTAGAGCACAGGAAGCTAGGGG - Intronic
952974535 3:38682553-38682575 TCTGAAGCAGAGGATGATGCTGG - Intergenic
953434460 3:42867588-42867610 TCTGGAGCACTGGAGGCTGGTGG - Intronic
954111117 3:48433706-48433728 TCTCGAGCACAGGATGCTGCAGG - Exonic
955927666 3:64023543-64023565 TGTCCAGCAGAGGACGCTGCCGG - Intronic
958818673 3:98947516-98947538 TTCTGAGCACAGGATGCTTCTGG + Intergenic
960262077 3:115579506-115579528 TCTCCAGTGCAGGATGCTGCTGG - Intergenic
960864756 3:122188063-122188085 TCTAGGGCAAAGGAAGCTGCTGG + Intronic
961109018 3:124268093-124268115 TCTCCAGCAAATGATGATGCAGG - Intronic
961905776 3:130261488-130261510 TCTCCAGCACAGGTTGGTGTGGG - Intergenic
962996492 3:140633908-140633930 TTTTAAGCACAGGATGCTACAGG - Intergenic
964568555 3:158087311-158087333 TCTGTAGCACATGATGCTGTTGG + Intergenic
964599017 3:158474568-158474590 TCTACAGCACATGATGCTGTTGG + Intronic
965363443 3:167768791-167768813 TATCCAGCACTGGCTGCTGCAGG + Intronic
966060665 3:175750233-175750255 TCTTGAGGGCAGGATGCTACAGG + Intronic
968832628 4:2940966-2940988 GCACCAGCCCAGGATGCTGCTGG - Intronic
968919798 4:3516639-3516661 TCACGAGCACAACATCCTGCTGG - Intronic
978192837 4:105935175-105935197 TCTCGAGAAAAGGATACTGATGG - Intronic
982291695 4:153788826-153788848 TCGCGCGCCCACGATGCTGCAGG - Exonic
983692092 4:170482649-170482671 GCTGGAGCGCTGGATGCTGCTGG - Intergenic
985998325 5:3610274-3610296 TCTTGAGCCCACGATGCTGGAGG - Intergenic
986113071 5:4739362-4739384 GCTCGGGCACAGGTTGCTGAAGG - Intergenic
997353025 5:133244317-133244339 TGCCGAGCACAGGGTGCTGCTGG + Intronic
998182070 5:139952823-139952845 CCTCTAGCAGAGGAGGCTGCAGG + Intronic
999246129 5:150155706-150155728 GGGCGAGCACAGGCTGCTGCTGG + Exonic
1003133875 6:3418191-3418213 TCCCGACCCCAGGTTGCTGCCGG + Intronic
1003461618 6:6334061-6334083 TCTCCAGGGCAGGTTGCTGCAGG + Intergenic
1003464434 6:6364926-6364948 TCTTTAGCCCTGGATGCTGCAGG - Intergenic
1005042980 6:21616091-21616113 TCTCGGACACAGGGTGCTCCTGG - Intergenic
1005638011 6:27769516-27769538 ACTCTAGCCCAGGATGCAGCGGG + Intergenic
1006127969 6:31852206-31852228 AATCGAGCACAGCAAGCTGCTGG - Intergenic
1006516113 6:34546670-34546692 TCTCCACCACAGGAAGCTGCAGG - Intronic
1012942162 6:105426946-105426968 TCTATAGGACAGGATGCTGTGGG + Intergenic
1018787020 6:167116408-167116430 TTTCCAGCACAGGAGGCAGCTGG + Intergenic
1018883570 6:167911096-167911118 TTTAGAACACAGGATGCTTCTGG + Exonic
1018903017 6:168060535-168060557 ACTCGGGCACAGCAGGCTGCAGG + Intronic
1019636162 7:2076968-2076990 TCTCGGGCTCACCATGCTGCGGG - Intronic
1021421586 7:20450895-20450917 TGTTGAGCACATGATGCAGCTGG + Intergenic
1023888645 7:44377533-44377555 ACTGGAGCAGAGGCTGCTGCTGG - Intergenic
1023999983 7:45183688-45183710 TGCGGAGCACAGGATGCAGCAGG - Exonic
1029450703 7:100640652-100640674 ACTCGAGAACAGGATGGGGCAGG + Intronic
1034518641 7:151601766-151601788 TCTCGCACAGTGGATGCTGCGGG - Intronic
1034883027 7:154776777-154776799 TCTCAAGCACAAGATGCTAAAGG + Intronic
1036619272 8:10413211-10413233 GCTAGAGCACAGGAAGCTTCAGG - Intronic
1039405784 8:37311366-37311388 TCTGGAGAACAGGCTGCTACAGG + Intergenic
1047199676 8:122754494-122754516 TCTCCAGCAAAGGATGCAGCTGG + Intergenic
1049608093 8:143539030-143539052 TCTCAAGGACATGCTGCTGCGGG + Exonic
1050157037 9:2678810-2678832 TCTTGAGCCCAGGAAGCAGCTGG + Intergenic
1054451197 9:65404345-65404367 TTTCCAGCACAGGAAGCTCCTGG - Intergenic
1056911874 9:90708391-90708413 TCCCGAGCACAGGCCCCTGCTGG - Intergenic
1058713394 9:107701166-107701188 TCTCTGGCACAAGATGCTCCAGG + Intergenic
1059337575 9:113578871-113578893 TCTCTGGCACAGGAAGCAGCAGG + Intronic
1060003998 9:119983550-119983572 TCTCCAGCACACCATACTGCTGG + Intergenic
1061746703 9:132745494-132745516 TCTGGAGCTCAGGTTTCTGCCGG - Intronic
1203445935 Un_GL000219v1:56439-56461 TCTGGAGCACAGGGTGCGGGAGG + Intergenic
1186025750 X:5309288-5309310 CCTTGAGCACAGAATTCTGCTGG - Intergenic
1187672353 X:21680739-21680761 TCTACATCACAGGATGCTCCAGG - Intergenic
1198312960 X:135438164-135438186 GGACGAGCAGAGGATGCTGCAGG + Intergenic
1199262288 X:145789438-145789460 TCACCAGCACAGAATGCTGAAGG - Intergenic
1201644567 Y:16215635-16215657 TCTTGGGCACAGAATTCTGCTGG + Intergenic
1201658248 Y:16369686-16369708 TCTTGGGCACAGAATTCTGCTGG - Intergenic