ID: 954112937

View in Genome Browser
Species Human (GRCh38)
Location 3:48445900-48445922
Sequence AAGGAGCAGCAATTTGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 261}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954112937_954112941 6 Left 954112937 3:48445900-48445922 CCCACCTCAAATTGCTGCTCCTT 0: 1
1: 0
2: 3
3: 20
4: 261
Right 954112941 3:48445929-48445951 GCTTTACCTCTGTTCGCCACCGG 0: 1
1: 0
2: 0
3: 5
4: 52
954112937_954112943 20 Left 954112937 3:48445900-48445922 CCCACCTCAAATTGCTGCTCCTT 0: 1
1: 0
2: 3
3: 20
4: 261
Right 954112943 3:48445943-48445965 CGCCACCGGTAACTCTTACCTGG 0: 1
1: 0
2: 0
3: 2
4: 26

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954112937 Original CRISPR AAGGAGCAGCAATTTGAGGT GGG (reversed) Intergenic
901064197 1:6486926-6486948 GAGGAGGAGCAATTAGGGGTGGG - Intronic
901475437 1:9486175-9486197 AAGGAGCAACCAGATGAGGTGGG - Intergenic
905107124 1:35570622-35570644 AAGGAGAAGCAGGTTGGGGTTGG + Intergenic
905785104 1:40749216-40749238 AAGGAGAAACAATATGAGGAAGG - Intronic
908117889 1:60958284-60958306 AAGCAGCAACAATTTGTGCTTGG - Intronic
908236529 1:62152362-62152384 AAGGAGCAGCAGTCTGAGTGCGG + Intronic
908635157 1:66155330-66155352 AGGGAGCAGAAATTGTAGGTAGG - Intronic
909764206 1:79334371-79334393 GAGGAGCAGCAACTTTAGGGCGG + Intergenic
910230685 1:84983602-84983624 AAGGAACAGAAATCGGAGGTGGG - Intronic
910539048 1:88334009-88334031 AATGAACAGACATTTGAGGTGGG - Intergenic
913158141 1:116120313-116120335 AAGGGGCAGCTATTTTAGTTAGG - Intronic
915637852 1:157198983-157199005 AAGGGGCAGCAATTTGACAGGGG + Intergenic
915706973 1:157853410-157853432 AAACAGCAGAAATTTGAGCTGGG + Intronic
916199890 1:162260699-162260721 AAGGAGCAGCAAAAAAAGGTGGG - Intronic
917212346 1:172643766-172643788 AAGGAGCAGGAATCTGCGGGGGG + Intergenic
919193558 1:194254348-194254370 AAATAGCAGCTCTTTGAGGTGGG + Intergenic
919531783 1:198730011-198730033 AAAGAACAGCAATTTGACTTGGG + Intronic
919802305 1:201361274-201361296 AAGCAGCAGAAATATGAGGTGGG - Exonic
920843836 1:209577003-209577025 GAGGAGCAGCACCTGGAGGTAGG + Intergenic
920977654 1:210801089-210801111 CAGCAGCAGCAATTTCAGGGAGG + Intronic
922244023 1:223777325-223777347 AAGCAGCAGCAAAGAGAGGTAGG - Intergenic
922682889 1:227615675-227615697 GAGAAGCTGCAATTTGAGGAGGG - Intronic
922847880 1:228704171-228704193 AAGGCGGAACAACTTGAGGTGGG - Intergenic
923090348 1:230735767-230735789 AAGGAGAAGCAGTTTCAGGAAGG - Intergenic
923188709 1:231598946-231598968 AAGCAGGAGCAAGTTGGGGTAGG + Intronic
1063135927 10:3216179-3216201 AAGGAGCTTCATTTTGAGCTGGG + Intergenic
1063877839 10:10498433-10498455 AAGAGACAGCAATTTGAGCTTGG + Intergenic
1064257029 10:13751099-13751121 AAGGAGCTGAAACTTGAGTTTGG + Intronic
1064523831 10:16231989-16232011 AAGGAGAAGCAAGTTGATGATGG - Intergenic
1064604058 10:17019888-17019910 AAGGAGCAGCACTTGAAGCTTGG + Exonic
1065134255 10:22652754-22652776 AAGGAGCAGCGTTTTCAGTTGGG - Intronic
1065517943 10:26543700-26543722 AACAAGGAGCAATATGAGGTAGG + Intronic
1068602294 10:58968623-58968645 AAGAAGCAGAAATTGGGGGTAGG + Intergenic
1069086168 10:64142065-64142087 AAGGAGCATGAATTTGTAGTTGG - Intergenic
1069846616 10:71376723-71376745 GAGTAGCAGCAATTAGAAGTGGG + Intergenic
1070348130 10:75565387-75565409 CAAGAGCAACAATTTCAGGTAGG - Intronic
1070655996 10:78271788-78271810 GAGTAGCACCAATGTGAGGTGGG + Intergenic
1071437968 10:85664391-85664413 AGGGAAGAGCATTTTGAGGTAGG - Intronic
1071513219 10:86280356-86280378 AAGGAGCAGCAAGTAGAGGAGGG - Intronic
1073241672 10:102063140-102063162 AAGGAGGAGCAGTTTGGGGCAGG + Intergenic
1073495247 10:103884987-103885009 AAGGAGGAGCAAGTAGAGCTTGG + Intronic
1074079185 10:110153931-110153953 AAGGAGGAGGCATTTGAGCTGGG - Intergenic
1075826462 10:125360749-125360771 AATGAGCTGCATTTTGGGGTAGG - Intergenic
1076260997 10:129066077-129066099 CAAGAGCAGCTCTTTGAGGTGGG - Intergenic
1077606741 11:3617407-3617429 AAGGAGCCTGAATTTAAGGTTGG + Intergenic
1078252074 11:9624342-9624364 AAGGTGCAGAATTTAGAGGTGGG - Intergenic
1078954982 11:16183171-16183193 AATGAACAGCTATTTGAGATAGG - Intronic
1078986050 11:16599325-16599347 ACAGAGCAGCAAATTGAAGTTGG + Intronic
1079130034 11:17741882-17741904 GAGGAGCTGCTGTTTGAGGTGGG - Intronic
1079431818 11:20397332-20397354 AAGGAGCTACAATCTGCGGTTGG + Intronic
1080429316 11:32184143-32184165 AAGGAACAGCAACTGGAGGCTGG + Intergenic
1086450276 11:86908831-86908853 AAGCAGCAGCAATATCAGCTAGG + Intronic
1086964023 11:93009219-93009241 AAGGAGCAGGAATGCGAGGGCGG + Intergenic
1087171506 11:95054052-95054074 ACAGAGCAGAAATGTGAGGTTGG + Intergenic
1088177032 11:107065314-107065336 AAGGAGCAGCAATTGGAATTAGG - Intergenic
1088717610 11:112562556-112562578 AAGCAGGAGCAACTTGGGGTTGG - Intergenic
1088800671 11:113303980-113304002 AAGGATATGCAATTTGAGGAAGG + Intergenic
1089682726 11:120128366-120128388 AGGGAGCAGCAAGGTGAGCTTGG + Intronic
1091009578 11:131986582-131986604 AAGGGGCTGCAATTTTAGATAGG - Intronic
1092114311 12:5988126-5988148 AAGGAGGAGGAATTCCAGGTGGG + Intronic
1092667763 12:10823638-10823660 AAAGAGGAGAAATTTGGGGTGGG - Intergenic
1093522241 12:20064608-20064630 AAGGAGTAGCATTTTTAGGTTGG - Intergenic
1093954566 12:25201509-25201531 AAGGAGAAGCAATTGGAGAGGGG + Intronic
1095292726 12:40493815-40493837 AAGGAGCAGCAGTTTGCGGTGGG + Intronic
1096197406 12:49657530-49657552 AAGGTGCAGCAACTGGAAGTGGG - Intronic
1096442903 12:51660931-51660953 AAGGAAAAGGAATTTTAGGTTGG + Intronic
1096684007 12:53275907-53275929 AAGAGGGAGCAACTTGAGGTGGG + Intronic
1097335273 12:58375933-58375955 AAGGAGCAACAGTTACAGGTGGG - Intergenic
1097418102 12:59339186-59339208 AAGGAACTGCATTTTGAAGTTGG + Intergenic
1101737136 12:107471575-107471597 GAGTAGCAGTACTTTGAGGTTGG + Intronic
1102391235 12:112550405-112550427 AAGGAACAGCACTTTGAGGTAGG - Intergenic
1103020352 12:117529009-117529031 AAGGAGCAGCAACTTGCCGGGGG - Intronic
1107650465 13:42540000-42540022 AAGGACCAGGGATTTGGGGTCGG + Intergenic
1108776348 13:53769552-53769574 AAGGTGCAAGAAGTTGAGGTTGG + Intergenic
1110570344 13:76996009-76996031 AAGGGGCATCCATTTCAGGTCGG - Exonic
1114255746 14:21000084-21000106 AAGCAGCAGAAATTAGATGTGGG - Intronic
1114258082 14:21019175-21019197 AAAGAGTAGGAATTTTAGGTGGG + Intronic
1114337676 14:21709001-21709023 AAGAAGGAGCAAATTGGGGTTGG - Intergenic
1115020780 14:28678715-28678737 AAGGAGCTGCCATTAGAGGATGG + Intergenic
1115148375 14:30253764-30253786 AAGGGGCAGCAACTTCAGGAAGG + Intergenic
1115163975 14:30427499-30427521 AAGGAGGCAGAATTTGAGGTGGG + Intergenic
1115341610 14:32298689-32298711 AAGAAGCAGCAGTTTGGGGCTGG + Intergenic
1115632036 14:35254901-35254923 CAGGAGCAGCAAGTTGAAGGTGG - Intronic
1116254572 14:42534891-42534913 ATGGAGCAGCAATTTAAGGTTGG - Intergenic
1116447412 14:45026670-45026692 AAGGAGCAAGGATTTGAGCTGGG - Intronic
1118971053 14:70638346-70638368 AAAGAGAAGAAATTAGAGGTTGG - Intergenic
1119123062 14:72097826-72097848 AAGGAGCTACAATCTGAGGAAGG - Intronic
1120279921 14:82426364-82426386 AAGTAGCAGCTGTTTGTGGTTGG + Intergenic
1120320593 14:82955930-82955952 AAGGATCATCAATATGAGGAAGG + Intergenic
1120541258 14:85753647-85753669 ATGGAGGAGCAAGTTGTGGTTGG + Intergenic
1122992891 14:105246971-105246993 AAGGATCAGCAGGTTGTGGTGGG - Intronic
1123016422 14:105377715-105377737 AAGGAGCAGCAAGTTGGGCTGGG - Intronic
1127694052 15:61426702-61426724 AAGAAGCAGGAAGTTGGGGTGGG + Intergenic
1128081178 15:64857790-64857812 AAGGAGCTGCAGTTTGGGCTGGG + Intronic
1129425514 15:75459607-75459629 ATAGAGCAGGAATTTGAGATGGG - Intergenic
1129637281 15:77333841-77333863 AAGGAGTAGCATTATGAAGTTGG - Intronic
1130287842 15:82570591-82570613 AAGCAGAAGCAATTTAAGGGGGG + Intronic
1131016682 15:89063262-89063284 AAGAAGCAGCAATTTTTGGCCGG - Intergenic
1131674132 15:94654121-94654143 AATGCTCAGCATTTTGAGGTCGG + Intergenic
1131787017 15:95924329-95924351 AAGGAGCAGGTATTGGAGCTGGG + Intergenic
1132590871 16:725961-725983 AAGGAGCAGCAGCTGCAGGTGGG - Exonic
1133434730 16:5769343-5769365 AAGGAGGAGAAATTTGGGCTGGG + Intergenic
1134739587 16:16530799-16530821 AAGGAGGAGAAATTTGAAATGGG - Intergenic
1134927912 16:18181353-18181375 AAGGAGGAGAAATTTGAAATGGG + Intergenic
1136181689 16:28557136-28557158 AAGGGCCAGCAATTTTAGGCTGG + Intronic
1139588397 16:67919066-67919088 AAGGAGCAGCCATGTGAGCAGGG + Intronic
1140947871 16:79787068-79787090 AAGGAGCAATAATTTGGGGGTGG - Intergenic
1141122129 16:81367798-81367820 AAGGAGCAAGAAGCTGAGGTGGG + Intronic
1141906661 16:87031273-87031295 CAGAAGCAGTAATTTGGGGTGGG - Intergenic
1144124263 17:12187155-12187177 AAAGAGCAGAAATCTGAAGTAGG - Intergenic
1144447964 17:15348730-15348752 AATGTACAGCCATTTGAGGTAGG - Intergenic
1146207295 17:30915720-30915742 AACCAGCAGCAATTTGAGAGAGG - Intronic
1146456549 17:33013883-33013905 AAGGAACAGCAAGCTCAGGTGGG - Exonic
1148764696 17:50030429-50030451 AGGGAGCAGTGGTTTGAGGTTGG - Intergenic
1149514373 17:57269046-57269068 TAGGAACAGCATTTTGAGGAAGG + Intronic
1149632394 17:58137277-58137299 AAGTAACAGCAGTTTGAGGAAGG - Intergenic
1150515972 17:65809550-65809572 AAGCAGCAGGAATTTTTGGTAGG + Intronic
1151346342 17:73504687-73504709 AAAGAGAAGGAATTTGAGCTGGG + Intronic
1153458609 18:5308779-5308801 AAGGCGCAGCAGTTTTAAGTTGG - Intergenic
1153655683 18:7280133-7280155 AAGAAGCAGAAAGTTCAGGTAGG + Intergenic
1155021108 18:21897819-21897841 AAGGAACAGAAAGGTGAGGTAGG - Intergenic
1157636269 18:49158115-49158137 AAGGAGTTGAAATTTGAGCTGGG - Intronic
1157860441 18:51136219-51136241 AAGGAAGAGAAACTTGAGGTGGG + Intergenic
1158213107 18:55071884-55071906 AAAGAGAAGAAATTTGAGGGTGG + Intergenic
1158309023 18:56139153-56139175 TAGGAGGAGCAATTTGGGGGTGG + Intergenic
1158413880 18:57232264-57232286 AAACATCAGCATTTTGAGGTTGG + Intergenic
1158950659 18:62491744-62491766 AAGGAGCTGTGATTTGAGCTAGG + Intergenic
1158999593 18:62960684-62960706 CAGCAGCACCAATTTGAGGGGGG - Intronic
1159140470 18:64388453-64388475 AAGGAGGAGAATTTTGATGTAGG - Intergenic
1159258262 18:65976853-65976875 AAGAAGCAGCAGCTTGACGTTGG - Intergenic
1161390640 19:4018685-4018707 AAGGAGCAGCAGAGTGATGTAGG + Intronic
1163426445 19:17243467-17243489 AGGGAGCAGCAATTTTGGGTGGG - Intronic
1163622179 19:18367640-18367662 AAGAAGCAGGAATTCAAGGTGGG + Exonic
1163847179 19:19644158-19644180 AGGGAGCAGCCCTTTTAGGTAGG + Intergenic
1165763277 19:38335221-38335243 AAGGAGTAGAATTTTGGGGTAGG + Intergenic
1165994827 19:39836678-39836700 AAGGAGCAGCAGTTAAAAGTTGG + Intronic
1166119091 19:40674277-40674299 AGGGAGGAGCTACTTGAGGTGGG - Intronic
927322152 2:21759453-21759475 AAGGAGCTGTAATCTGAGGGAGG - Intergenic
928385481 2:30863942-30863964 ATGGAGCAGAAATATGAGGCAGG + Intergenic
929289031 2:40168271-40168293 AAAGAGGAGCTATTTGAAGTTGG + Intronic
930266032 2:49200134-49200156 AAGGAGGAGCAAATTGGGGTAGG - Intergenic
930462869 2:51706077-51706099 AATGAGAAGTGATTTGAGGTTGG + Intergenic
930820675 2:55643191-55643213 CAGGAGCAGCAATTAGAATTTGG - Exonic
933586175 2:84181703-84181725 AGGGAGCAGGAATTTGGGGGAGG - Intergenic
934922840 2:98359765-98359787 AAGGAGCAGCTGTTTGTGGGGGG - Intronic
935391947 2:102562129-102562151 AAGAAGCAGAAATGTGAGCTTGG + Intergenic
935606166 2:104974183-104974205 AAGAAGCAGGAATTGGAAGTTGG - Intergenic
935863749 2:107362762-107362784 AAGGAGCTGGAATTTGAGAGGGG + Intergenic
936077581 2:109411493-109411515 AACGAGCAGCAATTTGCTGGTGG - Intronic
938629744 2:133153810-133153832 AAGGAGGAACTATTTGAAGTGGG - Intronic
938746513 2:134283511-134283533 AAGGATCACACATTTGAGGTAGG + Intronic
940163151 2:150736273-150736295 AAGGAGAAGTAATTTGAGAGTGG + Intergenic
941908706 2:170741934-170741956 AAGGAGCTGAAATTTTAGGTAGG + Intergenic
941910721 2:170762135-170762157 ATGGGGTAGCAAGTTGAGGTTGG - Intergenic
943588990 2:189774750-189774772 AAGGAGGAGGCATTTCAGGTAGG + Intronic
944245433 2:197525506-197525528 AGGGAGGATCACTTTGAGGTTGG + Intronic
945555439 2:211269892-211269914 CAGGACCAGCAAACTGAGGTGGG - Intergenic
946104214 2:217355132-217355154 AGAGGGCAGCAATTTGAGCTAGG + Intronic
946916370 2:224526918-224526940 AAGCAGCAGGAATTTAAGGAAGG + Intronic
1168765548 20:379923-379945 ATGGAGCAGGAAGTTGAGGCAGG + Intronic
1174875363 20:54221821-54221843 ATGGAAAAGCCATTTGAGGTAGG + Intronic
1175006940 20:55694209-55694231 AAGCAGCAGCTATTTTAGTTAGG - Intergenic
1178918511 21:36723018-36723040 AAGCAGGAGCAAGATGAGGTTGG - Intronic
1181915123 22:26273722-26273744 ATGGAGCACCACTTTGAGCTAGG - Intronic
1182804245 22:33057447-33057469 AGGGAGCAGGAATTCCAGGTGGG - Intronic
1183334300 22:37237852-37237874 AAGGAGCAGCAAGATGAAGTCGG + Intronic
1184299682 22:43550112-43550134 AAGCAGCAGCAAGCTGAGGTGGG + Intronic
1184877814 22:47286584-47286606 AAGCAGCAGCAGTTTCACGTGGG + Intergenic
1184884425 22:47333672-47333694 AAGGGCCAGCAATTTGTGCTGGG + Intergenic
949431573 3:3982291-3982313 CAGGAGCAGCAATTAGAATTTGG - Intronic
950176859 3:10881034-10881056 AAGGAGTAGCAAATTGTTGTTGG + Intronic
950323609 3:12082899-12082921 AAGGGGCAGAAATATGAGCTAGG - Intronic
953249781 3:41234280-41234302 ACACAGCAGCAATTTGTGGTAGG + Exonic
954112937 3:48445900-48445922 AAGGAGCAGCAATTTGAGGTGGG - Intergenic
955990228 3:64619040-64619062 ATGGAGCACCAATTTGAGGGTGG - Intronic
956114120 3:65901492-65901514 AAGGGGAAGCAATTGGAAGTTGG + Intronic
957156751 3:76553237-76553259 AAGGAGCAACATTTTAAGGATGG + Intronic
958012723 3:87900822-87900844 AAGGAGCAGAAATTTGTTTTTGG + Intergenic
959436149 3:106317432-106317454 AAGGACCACCAAGTGGAGGTGGG - Intergenic
959957121 3:112251936-112251958 AAGTGGCAGCAATTTGAGCAAGG - Intronic
960922097 3:122757427-122757449 GAGGAGCTGCCATTTGTGGTGGG - Intronic
961049978 3:123737786-123737808 AAGGAGCCTGAGTTTGAGGTAGG + Intronic
961520451 3:127464686-127464708 GAGGAGGAGGAATGTGAGGTGGG + Intergenic
966964084 3:184971735-184971757 AACCAGCAGCAACGTGAGGTAGG + Exonic
967252905 3:187561415-187561437 AAGGAGGAGGAATTAGAGGTAGG + Intergenic
967748328 3:193084338-193084360 AAGGGGGGGCAATTTGAAGTGGG + Intergenic
970498113 4:16648257-16648279 AAGGAGCTGGAATTTAAGTTTGG - Intronic
971559717 4:28062433-28062455 AAGAACCATAAATTTGAGGTTGG + Intergenic
975236704 4:72006603-72006625 AAGGAGCGTTACTTTGAGGTTGG + Intergenic
978493790 4:109337243-109337265 AAGGACCAGGAATCTGAGGTTGG - Intergenic
980073718 4:128270698-128270720 TAGGAGAAGGAATTTCAGGTGGG - Exonic
981585955 4:146302601-146302623 AATGAGAAACAAGTTGAGGTGGG + Intronic
986441501 5:7786706-7786728 AAACAGCAGCACATTGAGGTGGG + Intronic
986453172 5:7887051-7887073 AAGGAGCAGCAATGTGTAGCTGG - Intronic
988427208 5:31077665-31077687 GATGAGCAGCAATTTGTGCTGGG - Intergenic
988889136 5:35595795-35595817 AAGCAGCAGCTATTGGAGGCTGG - Intergenic
989747108 5:44842399-44842421 AGGAAGTAGCAATTTGAGCTGGG - Intergenic
990826674 5:59907860-59907882 AACAAACAGCAATTTGTGGTGGG - Intronic
991406927 5:66308978-66309000 AAGGATCAGAAATCTGGGGTGGG + Intergenic
993683373 5:90907653-90907675 AATGCCCAGCCATTTGAGGTTGG - Intronic
996443558 5:123518268-123518290 AAGGAGCAGGAAGTCCAGGTTGG + Intronic
996823932 5:127660242-127660264 AAGGAGCAGTAATCTGAGAAGGG - Intergenic
996856240 5:128010581-128010603 AAGTAGCAGCAATGTCAGGTTGG - Intergenic
997023890 5:130035161-130035183 AAGAAGCAGAAAGATGAGGTAGG + Intronic
997713510 5:136025844-136025866 AAGAAGCAGCAACCTCAGGTGGG + Intergenic
997745542 5:136296951-136296973 AAGAGGAGGCAATTTGAGGTAGG - Intronic
998032316 5:138881392-138881414 CAGGAGAAGCAATTTGACCTTGG - Intronic
998619993 5:143783110-143783132 AAGGTGATGCAATTTGAGGAGGG + Intergenic
999145188 5:149388007-149388029 AACCAGCAGCAGTTAGAGGTGGG + Intronic
999287381 5:150402258-150402280 GAGAAGCAGCAGGTTGAGGTTGG + Intronic
1000038463 5:157466945-157466967 AAGGAGCAGCCCTTAGAGGCCGG + Intronic
1000960841 5:167599173-167599195 AATGATCAGCAGTTTAAGGTAGG + Intronic
1000990090 5:167902813-167902835 AAGGAGCAGGACATTTAGGTTGG + Intronic
1001000980 5:168006881-168006903 AATGAGCTGCAATTTCAGCTGGG + Intronic
1001173970 5:169447628-169447650 TAAGAGCAGCAATTGGAAGTTGG - Intergenic
1001779043 5:174351703-174351725 AAGGAGAAGCTTTTTGAGCTAGG - Intergenic
1002854621 6:1026155-1026177 GAGGATCAGCAATTTGACTTGGG + Intergenic
1002967963 6:1986248-1986270 AAGCAAGAGTAATTTGAGGTAGG - Intronic
1003628057 6:7761691-7761713 AAGGAGCCACCATTTGAGATGGG - Intronic
1005484551 6:26287088-26287110 AATGAGTTGCATTTTGAGGTGGG + Intergenic
1006452922 6:34115477-34115499 AAGGGGCAGCAATTTGGGCTTGG - Intronic
1007733347 6:43965206-43965228 AGGGTGCAGCAAGTTGGGGTGGG - Intergenic
1009827668 6:68887966-68887988 AAGGAGCACCAATATGAGAAGGG - Intronic
1010032717 6:71288118-71288140 ACGGAGCACCAATTTGTAGTGGG + Intergenic
1010792409 6:80079836-80079858 TAGAATCAGCAATTGGAGGTAGG + Intergenic
1011754929 6:90488625-90488647 ATGCAGCAGCAATTTGACTTTGG - Intergenic
1013835390 6:114329182-114329204 GAGGAGCATCACTTTGAAGTGGG + Intronic
1014042978 6:116850904-116850926 AAGGAGAAGAAATGTGGGGTTGG + Intergenic
1014875422 6:126653695-126653717 AATTAGCAGCAATTTTATGTAGG - Intergenic
1017392667 6:153958369-153958391 AAGGACATGCAATTTGTGGTGGG - Intergenic
1020360733 7:7324074-7324096 AAGTAGCAGCAATGGGAGGAGGG - Intergenic
1020412605 7:7909708-7909730 AAAGAACTGAAATTTGAGGTGGG - Intronic
1020994884 7:15251121-15251143 AAGAGGCAGCATTTTGAGCTGGG - Intronic
1022833344 7:34090396-34090418 AGGGAGAAGCAATATGAGGCTGG - Intronic
1023877305 7:44294021-44294043 AGTGGGCAGCAATCTGAGGTCGG + Intronic
1027216523 7:76187293-76187315 CAGGAGAAGCACTTTGGGGTAGG - Intergenic
1027541728 7:79475785-79475807 AAATAGCAGCGATTTGAGGGTGG + Intergenic
1030642519 7:112022427-112022449 AAGGAGCAGTAATTACAGCTGGG - Intronic
1033191353 7:139283608-139283630 AAGAGGCAGCAATTTGGGCTTGG - Exonic
1033741226 7:144277208-144277230 CTGGAGCAGCAGTTTGAGGCGGG + Intergenic
1033752677 7:144372406-144372428 CTGGAGCAGCAGTTTGAGGCGGG - Exonic
1035430329 7:158815342-158815364 TAGGAGCAGTAGTTTGAGGCTGG - Intronic
1036756662 8:11475796-11475818 GAAGGGCAGCAATTTGAGTTGGG - Intergenic
1036780283 8:11642222-11642244 AAGAAGCAGATATTTGAGGACGG - Intergenic
1037644090 8:20774471-20774493 AAGTAGCAGCAACGTGCGGTGGG - Intergenic
1038318035 8:26503924-26503946 AAGGAGAAGCAATTTCAAGAAGG + Intronic
1041223193 8:55671893-55671915 AAGGAGGAGCAATTACATGTAGG + Intergenic
1041367526 8:57124463-57124485 AAGGTGCTGCAATTTGAGCCTGG - Intergenic
1044357188 8:91236228-91236250 AATGAAAAGCAATTTGAGGCTGG + Intronic
1045894035 8:107192774-107192796 CAGGGGCAGCAAGATGAGGTAGG + Intergenic
1047285600 8:123484865-123484887 AAGCAGCAGCAAGGGGAGGTGGG + Intergenic
1048324987 8:133432081-133432103 AATGAGCAGACACTTGAGGTGGG - Intergenic
1048937041 8:139366027-139366049 AAGGAGCAGCACCGTGAGGGAGG + Intergenic
1049719415 8:144108683-144108705 AACGAGCAGCAGCCTGAGGTCGG - Exonic
1050084023 9:1945617-1945639 AAATACCAGCAATTTGAGGTTGG + Intergenic
1050236355 9:3585076-3585098 AAAGAGCAGCAAATTGAGAAAGG - Intergenic
1053569322 9:39288023-39288045 AAGCAGCAGCACCTTGAGGACGG + Exonic
1053835279 9:42129053-42129075 AAGCAGCAGCACCTTGAGGACGG + Exonic
1054090954 9:60847007-60847029 AAGCAGCAGCACCTTGAGGACGG + Intergenic
1054112365 9:61122563-61122585 AAGCAGCAGCACCTTGAGGACGG + Intergenic
1054127820 9:61330987-61331009 AAGCAGCAGCACCTTGAGGACGG - Intergenic
1054595345 9:67059578-67059600 AAGCAGCAGCACCTTGAGGACGG - Intergenic
1055744982 9:79433720-79433742 ATGGATCAGGAATTTGAGGGAGG + Intergenic
1055944811 9:81683461-81683483 AAAAAGCATCAATTTGAGCTTGG + Intronic
1058207222 9:102123706-102123728 AAAGAGCAGCAATTAGAGTGAGG - Intergenic
1058532265 9:105917761-105917783 CTGGAGCAGCAATTTGGGCTAGG + Intergenic
1058670533 9:107357313-107357335 AAGGGGCAGCAATTGGACCTTGG + Intergenic
1059626921 9:116077288-116077310 AAGGAGGAGTAATATGAGTTAGG + Intergenic
1059771395 9:117429798-117429820 ATGGAGCAGAAAGTTGAGGAAGG + Intergenic
1060733750 9:126053414-126053436 AAGGAGAAGGAAATTGAGATGGG - Intergenic
1185446743 X:261852-261874 GAGCAGGAGCAATTTGAGGAGGG + Intergenic
1185964866 X:4589289-4589311 AAAGAGATGCCATTTGAGGTGGG + Intergenic
1186776849 X:12873271-12873293 AAGGATCAGGAATGTGGGGTAGG - Intronic
1187217389 X:17290327-17290349 AAGGGTCAGGAATTTGAGGTTGG + Intergenic
1188422097 X:30002658-30002680 AAGGACCAGCCATTTCAGTTTGG - Intergenic
1189025335 X:37388331-37388353 AAGGAGGAGAAATTTGGGGTTGG - Intronic
1191761491 X:64652458-64652480 AAGGAGAAGAAATTTGAGCTTGG - Intergenic
1192175530 X:68882591-68882613 ACGGAGCAGCAATGGGTGGTTGG - Intergenic
1194148364 X:90290416-90290438 AAGGAGTGGCAATTTGAAGCAGG - Intergenic
1195413392 X:104593859-104593881 AGGGAGCATCAATCTGAGCTGGG - Intronic
1196747565 X:119085378-119085400 AAGGAGCCTAAATATGAGGTAGG - Exonic
1197872225 X:131071241-131071263 AGGGAGCAGCAGTTTGAGGCTGG - Intronic
1200316766 X:155141658-155141680 AAGGTGCTGCAATTTTTGGTAGG - Intronic
1202349286 Y:23970334-23970356 AAGCAGCAGCAATTCATGGTCGG + Intergenic
1202521489 Y:25699770-25699792 AAGCAGCAGCAATTCATGGTCGG - Intergenic