ID: 954113028

View in Genome Browser
Species Human (GRCh38)
Location 3:48446484-48446506
Sequence TCCGTGGAGGAGGGCCGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954113028_954113039 14 Left 954113028 3:48446484-48446506 CCTGCGCGGCCCTCCTCCACGGA No data
Right 954113039 3:48446521-48446543 GCGCAAAGCCACCAGCGCGGCGG 0: 1
1: 0
2: 0
3: 6
4: 64
954113028_954113038 11 Left 954113028 3:48446484-48446506 CCTGCGCGGCCCTCCTCCACGGA No data
Right 954113038 3:48446518-48446540 GGAGCGCAAAGCCACCAGCGCGG 0: 1
1: 0
2: 0
3: 6
4: 143
954113028_954113035 -10 Left 954113028 3:48446484-48446506 CCTGCGCGGCCCTCCTCCACGGA No data
Right 954113035 3:48446497-48446519 CCTCCACGGAATGCCAGGGAGGG No data
954113028_954113040 20 Left 954113028 3:48446484-48446506 CCTGCGCGGCCCTCCTCCACGGA No data
Right 954113040 3:48446527-48446549 AGCCACCAGCGCGGCGGAGCTGG 0: 1
1: 0
2: 3
3: 8
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954113028 Original CRISPR TCCGTGGAGGAGGGCCGCGC AGG (reversed) Intergenic