ID: 954114366

View in Genome Browser
Species Human (GRCh38)
Location 3:48457293-48457315
Sequence GAAGCATGTTCTCCACAATT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 123}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954114363_954114366 -1 Left 954114363 3:48457271-48457293 CCCTTCTGTGGTTATAAAGCCAG 0: 1
1: 0
2: 1
3: 18
4: 200
Right 954114366 3:48457293-48457315 GAAGCATGTTCTCCACAATTTGG 0: 1
1: 0
2: 1
3: 6
4: 123
954114360_954114366 15 Left 954114360 3:48457255-48457277 CCAGTCCTAGGAAAAACCCTTCT 0: 1
1: 0
2: 0
3: 15
4: 179
Right 954114366 3:48457293-48457315 GAAGCATGTTCTCCACAATTTGG 0: 1
1: 0
2: 1
3: 6
4: 123
954114362_954114366 10 Left 954114362 3:48457260-48457282 CCTAGGAAAAACCCTTCTGTGGT 0: 1
1: 0
2: 3
3: 19
4: 198
Right 954114366 3:48457293-48457315 GAAGCATGTTCTCCACAATTTGG 0: 1
1: 0
2: 1
3: 6
4: 123
954114364_954114366 -2 Left 954114364 3:48457272-48457294 CCTTCTGTGGTTATAAAGCCAGA 0: 1
1: 1
2: 2
3: 14
4: 180
Right 954114366 3:48457293-48457315 GAAGCATGTTCTCCACAATTTGG 0: 1
1: 0
2: 1
3: 6
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954114366 Original CRISPR GAAGCATGTTCTCCACAATT TGG Exonic
904704964 1:32383005-32383027 GAGGCATAATCTCCACATTTGGG - Intronic
909684254 1:78328845-78328867 GAATCTTGTTCTCCACAACCTGG + Intronic
916011655 1:160711746-160711768 GAAGCATGTGCTCCAGAGGTTGG - Exonic
916071150 1:161170704-161170726 GAAGCAGCTGCTACACAATTAGG + Exonic
916368728 1:164064132-164064154 GCATCTTGTTCTCCTCAATTTGG + Intergenic
917230930 1:172837081-172837103 GATGCATGTTCAACACAAATGGG + Intergenic
921319819 1:213927868-213927890 GAGGAATGTTCAGCACAATTGGG - Intergenic
924171713 1:241349254-241349276 GAAGCATGTGCACTAGAATTGGG - Intronic
924215016 1:241811916-241811938 TAAGGATGTTCTCCATAATATGG - Intergenic
1062942916 10:1438235-1438257 GAAGCAGGTTCTTCACTATGGGG + Intronic
1062942964 10:1438464-1438486 GAAGCAGGTTCTTCACTATGGGG + Intronic
1070036976 10:72735497-72735519 GAAGCATGGTGTCCAGAATGAGG + Intronic
1070669564 10:78368502-78368524 GAAGGCTGTTCTCCTCAAGTAGG - Intergenic
1072640996 10:97211308-97211330 GGAGCTGGTCCTCCACAATTAGG - Intronic
1072822035 10:98567788-98567810 GAGGCAAGTGCTACACAATTTGG - Intronic
1073044885 10:100631100-100631122 GAAGCATGTTCTATCCTATTGGG - Intergenic
1074267760 10:111921628-111921650 GAAGCAGGAGCTCCACTATTAGG + Intergenic
1074405672 10:113178418-113178440 GGGGCATGGTCTCCACACTTGGG + Intergenic
1078924772 11:15864800-15864822 GAAGTGAGTTGTCCACAATTAGG + Intergenic
1079295118 11:19226056-19226078 GAAACATGTTCTGCATTATTCGG - Intronic
1087565489 11:99851520-99851542 GTAGCAGTTTCTCCACAGTTGGG + Intronic
1088824562 11:113482918-113482940 GAAGCATCTTCCTCACACTTTGG + Intergenic
1095221228 12:39618780-39618802 AAAGCCTGTTCTCCCAAATTTGG - Exonic
1095647852 12:44570279-44570301 GATGCTGGTGCTCCACAATTAGG + Intronic
1096927801 12:55168055-55168077 GAAGCATTTTCTTTAAAATTAGG + Intergenic
1101582255 12:106052030-106052052 CAATCATGCTCTTCACAATTAGG - Intergenic
1106901540 13:34358994-34359016 GAATCATCATCTCCACAACTTGG - Intergenic
1107103088 13:36614891-36614913 GAGGCATGCTAACCACAATTGGG - Intergenic
1112007088 13:95262999-95263021 GTACCATGTTCTTCACATTTTGG + Intronic
1112673184 13:101665685-101665707 AAAGCATTTTCTCCAAGATTGGG - Intronic
1113608214 13:111625297-111625319 AAAGCATGTTCTGAACATTTGGG - Intronic
1114563161 14:23607907-23607929 TAAGAATGTTCTTCACATTTTGG + Intergenic
1117454685 14:55885245-55885267 AAAGCATCTACTCCTCAATTTGG + Intergenic
1121161907 14:91751195-91751217 GAAACATTTTCTGCACCATTTGG + Intronic
1128031437 15:64484226-64484248 GAAGCATAATCTCAACAATTTGG - Intronic
1128428805 15:67571521-67571543 GAAACATGTTCGCAACAATAGGG - Intronic
1130156614 15:81356298-81356320 GGAGCATGTTCACCTCACTTTGG + Intronic
1130366647 15:83246521-83246543 GAATCATGTTGTCCGCAAATAGG + Intergenic
1132776084 16:1594925-1594947 AAAGCATGTTATCCAGCATTTGG - Intronic
1143277694 17:5724138-5724160 GAAATATGTTATCCACAATGAGG + Intergenic
1143858038 17:9867141-9867163 GATCCATGTTCCCCAAAATTGGG - Intronic
1146831656 17:36074924-36074946 CAAGCATGTTCTTCCCAAATTGG + Intergenic
1149063771 17:52456044-52456066 GAAGCATGTTGTCTACAAACAGG - Intergenic
1154058011 18:11030376-11030398 GAAACATGGTCTCCAAACTTTGG - Intronic
1155817011 18:30324905-30324927 GAAAAATGTTTTCCAAAATTTGG - Intergenic
1157272231 18:46284788-46284810 GAATCATGTTCTTCACTTTTTGG - Intergenic
1157371073 18:47112465-47112487 GAAGTATTTCCTGCACAATTAGG - Intronic
1158037457 18:53050702-53050724 GAATCATGTTATCCACAAATAGG + Intronic
1160944814 19:1636751-1636773 GAAGCATTTTCTCCCCCACTCGG - Intronic
1168438864 19:56346391-56346413 GAAGCCTGCTCTCTACCATTAGG + Intronic
928918479 2:36500333-36500355 GAAAAAGGTACTCCACAATTTGG + Intronic
929107438 2:38378021-38378043 GAAGAAGGTTCATCACAATTAGG - Intergenic
933492962 2:83011891-83011913 GATGGAAGTTCTTCACAATTTGG + Intergenic
935110415 2:100088938-100088960 GAAGCATGTTCTGTATTATTAGG - Intronic
935410593 2:102757858-102757880 CAAGCATCTTCTTCACAATGTGG + Intronic
936124559 2:109776266-109776288 GAAGCATGTTCTGTATTATTAGG + Intergenic
936220129 2:110595190-110595212 GAAGCATGTTCTGTATTATTAGG - Intergenic
938557229 2:132436493-132436515 GAGTCATGTTCTCCGCATTTTGG + Intronic
938752275 2:134344066-134344088 GAAGCAGGATATCCATAATTTGG + Intronic
941239711 2:163021485-163021507 GAAGCATGTTTTACACAAAATGG + Intergenic
941604759 2:167583313-167583335 AAAGCATCTTCTCTACATTTTGG + Intergenic
941989049 2:171536797-171536819 GTAGCATTTTCTCCCCAATCTGG - Intronic
945608773 2:211971977-211971999 GAATCATGTTATCCACAAACAGG - Intronic
946518194 2:220436465-220436487 AAAGCATGTTCTTCACAATTTGG + Intergenic
947958839 2:234217746-234217768 GAGGCATGTTCCCCACAGTGTGG + Intergenic
948592498 2:239060325-239060347 GAAGCAGGTTCTCCACACATTGG - Intronic
1170451212 20:16486135-16486157 GAAGACTTTTCCCCACAATTGGG - Intronic
1170703023 20:18721147-18721169 GAAGCATTGTCTCTAAAATTAGG - Intronic
1173884359 20:46444564-46444586 TAAGCATGTTATCCACGAATAGG + Intergenic
1174556050 20:51396525-51396547 CAAGCATGTTTTCCAAAATCTGG + Intronic
1182760102 22:32715805-32715827 AAAGCATAGTCTGCACAATTAGG + Intronic
1183247103 22:36702373-36702395 GCAGCAGGTTCTCCATAATCCGG + Exonic
949178469 3:1096419-1096441 GAAGCAAGATAACCACAATTTGG - Intronic
951463038 3:22971265-22971287 GAAGCATATTCTACACAAGCAGG + Intergenic
954114366 3:48457293-48457315 GAAGCATGTTCTCCACAATTTGG + Exonic
955281260 3:57597015-57597037 AAGGCAGGGTCTCCACAATTGGG - Intronic
955487452 3:59448954-59448976 GAAGGATGTTCTTAACAACTAGG - Intergenic
962449087 3:135496764-135496786 GAAACATGTTCTTCCCAATAAGG - Intergenic
965058634 3:163754008-163754030 GAAGTCTGTGCTCCGCAATTGGG - Intergenic
969470376 4:7384249-7384271 GAACCATGTTGTCCCCATTTGGG - Intronic
969673325 4:8601641-8601663 GCAGCATGTTCCCCACAAAAGGG + Intronic
972361604 4:38330795-38330817 GAAGCCTGGTGTCCACATTTTGG + Intergenic
975539679 4:75494823-75494845 TAACCATGTTCCCCACACTTTGG + Intronic
976828059 4:89282489-89282511 CAAGCTTGTTCTACACACTTTGG - Intronic
978489816 4:109301392-109301414 GAAATATTCTCTCCACAATTGGG + Intronic
978626076 4:110686940-110686962 TAAGCATTTTCTACACAATGGGG - Intergenic
981429550 4:144644703-144644725 GAGGAATGTTCACCACATTTGGG - Intergenic
985860822 5:2469277-2469299 GAAGCAGGGTGTCCACATTTTGG - Intergenic
986413816 5:7508425-7508447 GAAGGATGAACTCCAGAATTTGG + Intronic
987519088 5:18955401-18955423 GCAGAATGTTCTCCAGAGTTTGG - Intergenic
987770211 5:22292927-22292949 GAAGCTTGTTTACCATAATTAGG - Intronic
989149866 5:38288793-38288815 GAAGCAGTTGCTCAACAATTTGG - Intronic
989398057 5:40979791-40979813 GATGCATGTTCTCCACTGTCAGG + Exonic
989420147 5:41228530-41228552 AAAGCTTTTTCTCAACAATTAGG - Intronic
993019030 5:82568532-82568554 GAATCATGTTGTCTACAAATAGG - Intergenic
997028163 5:130090622-130090644 GATACATGTTCTCCAGAATTTGG - Intronic
999529781 5:152450326-152450348 TGAGCATGTTCTCAACAATATGG - Intergenic
1000293895 5:159896375-159896397 GAAGCATGTTCCCCAGAAGATGG - Intergenic
1001231226 5:169990502-169990524 GAAACATTTTCTGCATAATTTGG - Intronic
1014136724 6:117897974-117897996 GAAGATTGCTCTCCACAATGTGG + Intergenic
1017367228 6:153657925-153657947 GAATCAAGTTCTCAATAATTAGG + Intergenic
1021058097 7:16075816-16075838 GCAGAATGTTCTCTCCAATTTGG - Intergenic
1021944346 7:25711353-25711375 GAAGCTTTCTCTCCAAAATTGGG - Intergenic
1023037210 7:36142536-36142558 AAAGCATGTTCTCCACACCACGG - Intergenic
1023529827 7:41140725-41140747 GAAGCATGTTTTCCATCATGGGG - Intergenic
1028394255 7:90349739-90349761 GTAGCATGTTTTCCAGAATAGGG + Intronic
1030783648 7:113632997-113633019 CAAACATATTCTCCACAGTTGGG - Intergenic
1030976454 7:116129830-116129852 TACCCATCTTCTCCACAATTTGG - Intronic
1036814469 8:11891100-11891122 GAAGCAGATTCTCCCCAGTTGGG + Intergenic
1037213315 8:16418827-16418849 GAAGCATGTTCTTTACAAACTGG + Intronic
1037377195 8:18243633-18243655 GAAGCATCTTCTCTACATTCAGG + Intergenic
1037398159 8:18465326-18465348 GAATCATGTTGTCTACAAATAGG + Intergenic
1041699760 8:60774910-60774932 TAAGCATGTTCTCCATATTTAGG - Intronic
1043139371 8:76569291-76569313 GGAGCCTGTTCTTCACAATATGG + Intergenic
1043686315 8:83090934-83090956 GAAGGACATTCTCAACAATTAGG + Intergenic
1044170435 8:89044302-89044324 GAAAAATGTTCTTCACAGTTAGG - Intergenic
1046994539 8:120502556-120502578 AAGGCATGTTCTTCAAAATTTGG + Exonic
1048214521 8:132481986-132482008 GAAGCATCACCTCCACAATAAGG - Intergenic
1050314851 9:4390938-4390960 GAAACAAGTTCTCCACATTGGGG + Intergenic
1050561766 9:6841437-6841459 GAACCTTGTTCCCCAAAATTAGG - Intronic
1052104843 9:24500468-24500490 GAAGATTGTTCTTCAAAATTTGG + Intergenic
1053106644 9:35415206-35415228 GAAACATGTTCTGCTCAATTGGG - Intergenic
1055623977 9:78153973-78153995 GAATCATGTTGTCCACAAACAGG - Intergenic
1056239673 9:84632056-84632078 TGAGCATGTTCACCACAAGTTGG + Intergenic
1058610069 9:106765985-106766007 GAAGCATGGTCTTAAAAATTTGG + Intergenic
1058895124 9:109393716-109393738 TAAGGATGTTGGCCACAATTTGG - Intronic
1059355093 9:113692648-113692670 GATACATTTTCTGCACAATTAGG - Intergenic
1192347154 X:70320135-70320157 CCAGCATGATCTCCCCAATTAGG + Intronic
1193773517 X:85616547-85616569 GAATCATGTTGTCTACAAATAGG + Intergenic
1195339227 X:103889176-103889198 GAGGCATGTACACCACATTTTGG + Intergenic
1198968412 X:142251713-142251735 GAAGCATGTTTACCAAAATGTGG - Intergenic