ID: 954115389

View in Genome Browser
Species Human (GRCh38)
Location 3:48464371-48464393
Sequence CAGAATAGGGGGCTGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 606
Summary {0: 1, 1: 0, 2: 8, 3: 58, 4: 539}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954115374_954115389 16 Left 954115374 3:48464332-48464354 CCTGATGACTGATCCTGTCTTGG 0: 1
1: 0
2: 0
3: 9
4: 104
Right 954115389 3:48464371-48464393 CAGAATAGGGGGCTGGAGGCAGG 0: 1
1: 0
2: 8
3: 58
4: 539
954115378_954115389 3 Left 954115378 3:48464345-48464367 CCTGTCTTGGCTTTGGGACGTGG 0: 1
1: 0
2: 0
3: 8
4: 121
Right 954115389 3:48464371-48464393 CAGAATAGGGGGCTGGAGGCAGG 0: 1
1: 0
2: 8
3: 58
4: 539

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954115389 Original CRISPR CAGAATAGGGGGCTGGAGGC AGG Intronic
900092545 1:926716-926738 CCAACTAGGGGGCTGGAGACTGG - Intronic
900093814 1:932291-932313 CGGAGGAGGGGGCTGCAGGCAGG - Intronic
900285799 1:1899764-1899786 CAGGAAATGGGGCTGGGGGCTGG - Intergenic
900488478 1:2934804-2934826 CAGGGCTGGGGGCTGGAGGCCGG - Intergenic
900516567 1:3085016-3085038 CAGGAAAAGGGGCTGGATGCTGG - Intronic
900542797 1:3212502-3212524 CAGAACATGGGGACGGAGGCAGG - Intronic
900601378 1:3504145-3504167 CAGAGGAGGGGGCTGGCGCCGGG + Intronic
900616796 1:3569149-3569171 CTGAACAGGCGGCTGGTGGCGGG - Intronic
900780084 1:4612270-4612292 CAGAAAAGGGGAGAGGAGGCGGG - Intergenic
901506806 1:9690118-9690140 CCGAATAGGGGGCAGGGGGAGGG - Intronic
901685148 1:10939589-10939611 CAGGGAAGGGGGATGGAGGCAGG + Intergenic
901930044 1:12591361-12591383 CAAAACAGGGGCCTGGAGCCAGG - Intronic
902342158 1:15791039-15791061 GAGAATAGCGTTCTGGAGGCTGG + Intergenic
902546519 1:17193842-17193864 CAGAAAAGAGAGCAGGAGGCAGG + Intergenic
902557598 1:17256149-17256171 CAGGAAACGGGTCTGGAGGCAGG - Intronic
902713262 1:18255110-18255132 CAGAGGAAGGGGCTGGAGACTGG - Intronic
902733789 1:18386769-18386791 CAGACAATGGGGCTGGAGGAAGG + Intergenic
903059773 1:20661670-20661692 CAGACTAGGGGGCGGGAGGCCGG - Intergenic
903675580 1:25062616-25062638 CTGATTAGGGGGCGGGAGGTGGG + Intergenic
903979576 1:27176280-27176302 CAGCATTGGGGGTTGGGGGCTGG - Intergenic
904109332 1:28113112-28113134 CAGAATAGAGAACTGGAGGCGGG + Intergenic
904364721 1:30002948-30002970 CACAATGGGAGGCTGGGGGCCGG - Intergenic
904446940 1:30581426-30581448 CAGGGTCGGGGGCTGGAGGAGGG - Intergenic
904836124 1:33338098-33338120 CAGGAGTGGGGGATGGAGGCAGG - Intronic
904880772 1:33695183-33695205 CAGCATGGCAGGCTGGAGGCTGG + Intronic
904924741 1:34038682-34038704 AAGACTGGGGGGCTGGAGCCAGG - Intronic
905277334 1:36826969-36826991 CAGAACATGGGGCTGAAGGAGGG - Intronic
906090165 1:43172208-43172230 GGGAGTAGGGGGCTGAAGGCAGG - Intronic
906609770 1:47193148-47193170 CAAAAGTGGGGGCTGGAGGGAGG - Intergenic
906686161 1:47764745-47764767 CAGAACAGGGAACAGGAGGCAGG + Exonic
906836243 1:49086016-49086038 GAGACCACGGGGCTGGAGGCTGG - Intronic
907241969 1:53085895-53085917 GAGAGCAGGGGACTGGAGGCAGG + Intergenic
907401467 1:54227332-54227354 CAGGATAAGGGCCAGGAGGCGGG + Intronic
907555055 1:55336159-55336181 CAGAAGAAGGGGCAGGAGGGAGG + Intergenic
907685682 1:56609168-56609190 CATAATAGTTGGGTGGAGGCAGG - Intronic
907849978 1:58247151-58247173 CAGAATGGGGGCAAGGAGGCTGG + Intronic
908238418 1:62169131-62169153 CACCAGAGGGGGCGGGAGGCTGG - Intergenic
908903573 1:68983174-68983196 GAGAAAAGGGGGCAGGAGACAGG + Intergenic
910644499 1:89498779-89498801 CAGAAGTGGGGCCTGGAGCCAGG - Intergenic
911664546 1:100538813-100538835 CAGAATAATGGGCTGGGGGAGGG - Intronic
911681061 1:100716276-100716298 TAGAGTAGGGGGCTGGGGGAGGG - Intergenic
912690492 1:111801205-111801227 CAGAAGGGAGGGCTGGATGCTGG + Intronic
912865217 1:113250408-113250430 CAGAAAAGGGGAGTGGAGGCTGG + Intergenic
914302071 1:146386084-146386106 CAGAATTGGGGGCGGGGGGGGGG - Intergenic
914350117 1:146833211-146833233 CAGAATATGCAGCTGGAGGTAGG - Intergenic
914908607 1:151766985-151767007 CAGAATAGGGGGTGGAAAGCTGG + Intronic
915165532 1:153946096-153946118 CAGAAGGGGGTGCAGGAGGCCGG + Intronic
915340676 1:155175061-155175083 CAGAGATGGGGGATGGAGGCAGG + Intronic
915588527 1:156858055-156858077 CAGGACAGGGCCCTGGAGGCAGG + Intronic
915649062 1:157294389-157294411 CTGAAAAGGGGGCTGAAGCCAGG + Intergenic
916075631 1:161198541-161198563 CACAATGGGGAGCAGGAGGCAGG + Exonic
916252749 1:162754632-162754654 CAGAAGAAGGGGATGGAGCCTGG + Exonic
916567602 1:165994939-165994961 CAAAATTGTGGGGTGGAGGCAGG + Intergenic
917336797 1:173931918-173931940 CTGAACAGGGGGGTGGAGGCAGG + Exonic
917485510 1:175451480-175451502 CAGACTGGAGGCCTGGAGGCTGG - Intronic
918126681 1:181590074-181590096 CAACATAGGGAACTGGAGGCAGG - Intronic
919790720 1:201289093-201289115 CAGCAGAGGGGGCAGGAGGCTGG + Intronic
919884181 1:201920730-201920752 TAGAATAGGGGGTGGGAGGCTGG + Intronic
920075826 1:203335752-203335774 CAAAATAGGACTCTGGAGGCAGG - Intergenic
920245648 1:204585669-204585691 AAGAAGAGGGGCCTGGAGGAGGG - Intergenic
920264552 1:204712110-204712132 CTGAGTAGAGGGATGGAGGCCGG - Intergenic
920294502 1:204947556-204947578 CAGCAGTGGGAGCTGGAGGCTGG - Intronic
920347758 1:205317586-205317608 CGGTAGAGGGGGCTGGAGGATGG - Intronic
921140913 1:212305316-212305338 AAAAATTGGGGGCTGGAGCCGGG - Intronic
921472062 1:215561551-215561573 CGGAGTAGGGGGATGGCGGCAGG - Intergenic
921484877 1:215703789-215703811 CTGAAAAGGGGGCTGAAGCCAGG - Intronic
921962219 1:221047599-221047621 CTGAAAAGGGGGCTGAAGCCAGG + Intergenic
922484459 1:225962505-225962527 CAGAAGTAGGGGCTGGAGGCGGG + Intergenic
923126220 1:231036781-231036803 CAGAATGTGGAGCTGGAAGCTGG - Intronic
923269203 1:232339407-232339429 CAGACTAGGGGGCTAGGGACAGG + Intergenic
923471276 1:234293075-234293097 CATCAGAGGGGTCTGGAGGCAGG - Intronic
924050063 1:240071492-240071514 TAGAACAGGAGGCTGGAGGTAGG + Intronic
924123238 1:240823811-240823833 CAGAGTGGGGGGCGGGAGGGGGG - Intronic
924362497 1:243255777-243255799 CTGAAGAGTGGGATGGAGGCGGG + Intergenic
924837816 1:247672152-247672174 CAGAATAGGGAGATGCAGGCAGG - Exonic
1063556617 10:7086316-7086338 CAGAATAGCTGGCTGTCGGCTGG - Intergenic
1063655430 10:7983315-7983337 CAGAATAAGGGGCAAGAGGCAGG + Intronic
1064321486 10:14309655-14309677 CAGGAGGGGGGCCTGGAGGCTGG - Intronic
1064353284 10:14596251-14596273 CAGTTCAGGGGGCTGGAGTCTGG - Intronic
1064404774 10:15051984-15052006 CAGAATATGTGGCTGCAGGCTGG + Intronic
1065260523 10:23919087-23919109 CTGAATGTGGGGCTGGAGGTTGG - Intronic
1065565200 10:27001237-27001259 CAGAGTTAGGGGCTGGAGTCTGG + Intronic
1067343528 10:45422277-45422299 CAGAATGAGAGGATGGAGGCTGG - Intronic
1069961640 10:72082556-72082578 CTGAATAAGAGGCTAGAGGCTGG + Intronic
1070312579 10:75284353-75284375 CAGAAGAGGGAGCAGCAGGCGGG + Intergenic
1071248493 10:83791102-83791124 CAGTCTAGGGGACTGGAGACTGG - Intergenic
1071979456 10:90988754-90988776 AAGAATGGGGGGTAGGAGGCTGG - Intergenic
1072100534 10:92225267-92225289 CAGAAAATGGGGTAGGAGGCTGG - Intronic
1072226393 10:93374001-93374023 CGGGATAGGGGGCTGGGGGAGGG - Intronic
1072478869 10:95791384-95791406 GAGAATAGGGGACTTGAGGATGG + Intronic
1072799641 10:98384156-98384178 CAGAATAAGGGGCTGGGGGGAGG + Intronic
1073054200 10:100688629-100688651 CAGAAAAGGGGGCTCAAGGTGGG + Intergenic
1073103071 10:101016986-101017008 CAGAAGAGGGGGGTGGATGTCGG - Intronic
1073376669 10:103041168-103041190 CGGAAGACGGGGCTGGAGACAGG - Intronic
1074472522 10:113740525-113740547 CAGAGCAGGGTGCTGGAAGCAGG + Intergenic
1075155285 10:119971190-119971212 CAGAGTGTGGGGCTGGAGGGAGG - Intergenic
1075983935 10:126767022-126767044 CTGAAAAGGGGGCTGAAGCCAGG - Intergenic
1076043175 10:127268925-127268947 CAGAATTGGGGTGTAGAGGCTGG - Intronic
1076461470 10:130650131-130650153 CAGGTGAGGGGGCTGGGGGCGGG + Intergenic
1076555279 10:131317521-131317543 GAGAATAGGGGCATGGAGGGTGG - Intergenic
1077026011 11:440280-440302 CAGAAGGGGAGGCTGGAGGTTGG + Intronic
1077026343 11:441668-441690 CAGAATCCCGGGCTGGAGGGAGG + Intronic
1077174113 11:1180982-1181004 CAGACTGGGGGACAGGAGGCCGG - Intronic
1077384493 11:2262628-2262650 CAGAACAGGGACCCGGAGGCAGG + Intergenic
1077385899 11:2269406-2269428 CAGATTGGGGTGCTGGAGGCGGG - Intronic
1078068256 11:8091962-8091984 CAGAATAGGGGCCTGCACCCAGG + Intronic
1078622913 11:12925442-12925464 CAGAGGAGGGGCCTGGTGGCAGG - Intronic
1080338981 11:31234707-31234729 CGGAGGAGGGGGCAGGAGGCAGG + Intronic
1080768337 11:35317337-35317359 GAGAAGAGGGGGCTGGGGGTGGG + Intronic
1080879486 11:36306233-36306255 CAGGATGGGGGGCTGGGGGAGGG - Intronic
1083441322 11:62678644-62678666 GAGAATTGGGGGCTGGCGGGAGG - Intronic
1084296692 11:68216716-68216738 CAGAATTCCAGGCTGGAGGCAGG + Intergenic
1084403030 11:68956036-68956058 CAGAGTAGGGGTCTGGGGGTGGG + Intergenic
1084557187 11:69882145-69882167 CAGCAGAGGGGGCTGTAGGTGGG - Intergenic
1085268142 11:75249929-75249951 CAGAGAGGGGGGCTGCAGGCTGG - Intergenic
1085708999 11:78812298-78812320 CAGAGCACGGGGCAGGAGGCTGG + Exonic
1085929271 11:81061659-81061681 CAGGAAAAGGGTCTGGAGGCAGG + Intergenic
1086355858 11:85998494-85998516 AAGAGAAGGGGTCTGGAGGCTGG + Intronic
1087261510 11:96017589-96017611 AAGAAAACAGGGCTGGAGGCGGG + Intronic
1087832846 11:102838300-102838322 GAGAAGAGGGGGCTCCAGGCAGG + Intronic
1089763529 11:120746484-120746506 CAGAAAAGGGGGCTGGAGGAAGG - Intronic
1090227881 11:125082533-125082555 GAGAAAAGGTGGCTGGAGTCAGG - Intronic
1090238548 11:125166144-125166166 CAGAGCAGAGGGCTGGAGGTCGG + Intronic
1091145424 11:133275110-133275132 CAGCAAAGGGGGTGGGAGGCTGG + Intronic
1091218868 11:133919192-133919214 CTGAGGAGGGGGCTGGAGTCCGG + Intronic
1091227205 11:133964827-133964849 CAGAAGTGGGGGCTGGAGAGAGG + Intergenic
1092232373 12:6783280-6783302 CTGCAAAGGGGGCTGGGGGCAGG - Intergenic
1092233836 12:6793209-6793231 CAGAACAGGGAGCTGGAGGCAGG + Intronic
1094470232 12:30796064-30796086 GAGAAAAGGGGGTTGGAGGTGGG - Intergenic
1095654223 12:44650282-44650304 AAAAATTGGGGGGTGGAGGCAGG - Intronic
1095832358 12:46601553-46601575 CAGGAAAGGGGGCTGAAGGCAGG - Intergenic
1096072308 12:48782239-48782261 CAGAATGTGGGGCTGGAGGCAGG - Intronic
1096470334 12:51871592-51871614 CAGAGTGGGGGGCTGGTGGAGGG + Intergenic
1096514760 12:52149717-52149739 CAGGACAGGGGGCAGGAGGAGGG - Intergenic
1096675171 12:53222089-53222111 CTGACTAGGGGGCTTGAAGCAGG + Intronic
1096864572 12:54554654-54554676 CAGGATAGGTGGCTGGAGGGAGG + Intronic
1097198446 12:57258074-57258096 CAGGAGAGGGTGCTGGAGACTGG + Exonic
1098339886 12:69441016-69441038 CAGACTAGGTGGCTGGAAGCCGG - Intergenic
1101580676 12:106038727-106038749 CAGAAGAGGGGCATGGATGCTGG - Intergenic
1102093601 12:110216489-110216511 AATAATAGGAGGCTGGGGGCTGG - Intronic
1102565543 12:113794991-113795013 CTGAATAGGGGGAAGGAGGGAGG + Intergenic
1102688563 12:114742695-114742717 CAGAAAAGAGAGATGGAGGCAGG + Intergenic
1103007757 12:117435630-117435652 CAGAAATGGCTGCTGGAGGCAGG - Intronic
1103213496 12:119183768-119183790 CAAAAGAGGGGCCTGGAGGTGGG - Intronic
1103256373 12:119544826-119544848 TAGCAGAGGGGGCTGGAGGTCGG - Intergenic
1103345633 12:120248241-120248263 TAGAAGAGGGGGCTGGAGGATGG + Intronic
1103555920 12:121766433-121766455 CAGAACAGGGAGCTGGAGCCGGG - Intronic
1103659980 12:122506447-122506469 TAGAAAATGGGGATGGAGGCTGG + Intronic
1103845757 12:123901080-123901102 CAGAAGCATGGGCTGGAGGCTGG - Intronic
1103938357 12:124488612-124488634 GAGAAGACGGGGCTGGAGGGAGG + Intronic
1104658008 12:130588202-130588224 CATGAGAAGGGGCTGGAGGCTGG - Intronic
1104917709 12:132274416-132274438 CAGAGCAGCAGGCTGGAGGCCGG - Intronic
1104920628 12:132288736-132288758 CAGCATTGGGGGCAGGAGGGTGG + Intronic
1105069429 12:133225760-133225782 CAGAAGAGGGGGAGGGTGGCAGG + Intronic
1105611858 13:21975751-21975773 CAGAACTGAGGGCTGGAGACCGG + Intergenic
1105692549 13:22856485-22856507 CAGCACTGGGGGCTGAAGGCTGG + Intergenic
1108044145 13:46367051-46367073 AAGAATATAGGACTGGAGGCAGG + Intronic
1108383789 13:49879539-49879561 CTGAAGAGGGGGCTGAAGCCAGG + Intergenic
1108505980 13:51112813-51112835 CAGCATAATGGGCTGGAAGCTGG - Intergenic
1108601301 13:51997543-51997565 CAGAAAAGGGGGCTGGGGCCAGG + Intronic
1110019934 13:70457468-70457490 CTGGAAAGGGGGCTGGAGGCAGG + Intergenic
1110096506 13:71529556-71529578 GAGAATAGAGGCCTGGTGGCAGG - Intronic
1110520694 13:76472536-76472558 CAGAAAAGGAGGCGGGGGGCAGG + Intergenic
1110803300 13:79725720-79725742 CAGGATGGGGGGCAGGAGGATGG - Intergenic
1112109242 13:96276251-96276273 CAGAAGACAGGGCTGGAGGGAGG - Intronic
1113994821 14:16056939-16056961 GAGGGTAGGGGGCTGGACGCCGG + Intergenic
1114557221 14:23568916-23568938 CACCAGAGGGGGCTGGAGGAGGG + Exonic
1114621007 14:24095961-24095983 GAGAATAGGTGACTGGATGCTGG - Intronic
1114979682 14:28147423-28147445 CAGTATAGGAGGATGGAAGCAGG - Intergenic
1115097065 14:29650012-29650034 CAGGAAAGGGAGCTGGAAGCAGG - Intronic
1115188465 14:30719949-30719971 CAGAATTGGGGGCAGGGGGGTGG + Intronic
1115538031 14:34391682-34391704 CTGGAAAGGGGGCTGGAGCCAGG + Intronic
1117748248 14:58893204-58893226 CAGAAAAAGGGGCAGGAGACAGG + Intergenic
1118709887 14:68510368-68510390 TAGAGTAGGAGGCTGGGGGCGGG + Intronic
1118733492 14:68685654-68685676 CCCAAAAGGGGGCTGAAGGCGGG + Intronic
1119420629 14:74505908-74505930 CAGCATAGGGAGGTGCAGGCGGG - Intronic
1119430846 14:74567257-74567279 CACATGAGGGGGCTGGAGGGTGG - Intronic
1119832485 14:77716018-77716040 AAGAATGGTGGGGTGGAGGCTGG + Intronic
1121080467 14:91103884-91103906 CAGAAGTGGGAGCTGGAGGTGGG - Intronic
1121102188 14:91257507-91257529 TAGAGTAGGGGGATGGAGACTGG - Intergenic
1121740371 14:96247755-96247777 CAGTACAGGGGCTTGGAGGCAGG + Intronic
1122093221 14:99353445-99353467 AAGAACTGGGGCCTGGAGGCAGG + Intergenic
1122574252 14:102731824-102731846 GAGAAAAGGGAGCTGGAGCCAGG - Intergenic
1122630110 14:103103910-103103932 CAGGGCAGGGGGCTGGGGGCGGG - Intronic
1122860351 14:104579732-104579754 CAGCAGAGAGGGCTGGAGACGGG + Intronic
1122979496 14:105185260-105185282 CAGAAGAGGGAGCAGGAGGGTGG - Intergenic
1123159551 14:106264655-106264677 CAGAAAAGTGTGCAGGAGGCCGG - Intergenic
1123190591 14:106565637-106565659 CAGAAAAGCGCGCAGGAGGCCGG - Intergenic
1123480807 15:20629254-20629276 CTGGAAAGGGGGCTGAAGGCAGG + Intergenic
1123637204 15:22371111-22371133 CTGGAAAGGGGGCTGAAGGCAGG - Intergenic
1123820981 15:24030460-24030482 GAGAATAGGGGCCTGGAGGCAGG - Intergenic
1124373732 15:29117524-29117546 CAGCCAAGGGGGCGGGAGGCAGG - Exonic
1124888224 15:33707150-33707172 GAAAATAGGGGGTTGGTGGCTGG + Intronic
1125231687 15:37463670-37463692 CAGAAGAGGGGCCTGGTGGGAGG + Intergenic
1125675289 15:41498928-41498950 GAGATTGGGAGGCTGGAGGCAGG + Intronic
1127485200 15:59412189-59412211 CAGCATAGTGGACTGGGGGCTGG + Intronic
1127716347 15:61652958-61652980 GTGAATAGGGGCGTGGAGGCGGG + Intergenic
1128726288 15:69990806-69990828 CAGGGTAGGGGGCTGGGGGGAGG + Intergenic
1128736219 15:70055398-70055420 GAGCAGAGGGGGCTAGAGGCAGG - Intronic
1128744115 15:70101755-70101777 CCAAATAAGGGGCTGGGGGCTGG - Intergenic
1129126748 15:73448162-73448184 CTGAAAAGGGGGCTGAAGCCAGG + Intronic
1129179722 15:73866377-73866399 CAGGATAGGAGGCAGGAGACTGG + Intergenic
1129252056 15:74314577-74314599 CAGACTAGGGGGCTGGCAGGGGG - Intronic
1129514905 15:76151456-76151478 CAGAACAGGGCCCTGGAGGGTGG - Intronic
1129892869 15:79083168-79083190 CAGTGAAGGAGGCTGGAGGCTGG + Intronic
1130327867 15:82896071-82896093 CTGTAGAGGGGGCTGGAGGTGGG + Intronic
1130553266 15:84905424-84905446 CAGAGGATGGGGCTGGAGCCAGG - Intronic
1132010445 15:98270999-98271021 CAGAATAGCAGGAGGGAGGCAGG + Intergenic
1132546031 16:533853-533875 CTGCAGAGAGGGCTGGAGGCGGG + Intronic
1133032593 16:3018304-3018326 CAGAGGGGGGCGCTGGAGGCTGG + Exonic
1133198139 16:4184902-4184924 CAGATTAGGGGGGTGGAGCACGG - Intergenic
1133702154 16:8318743-8318765 CAGAATAGAGGGTGGGAGGAGGG - Intergenic
1133748636 16:8707104-8707126 CAGGCTAGGGGAGTGGAGGCTGG + Intronic
1133749341 16:8712644-8712666 CCGATTTGGGGGCTGGGGGCTGG + Intronic
1133767465 16:8848063-8848085 TAGACTAGGGGGCTGGGGGTGGG - Exonic
1135588391 16:23688682-23688704 CAGAAGATGGGGATGCAGGCAGG - Exonic
1136153203 16:28365496-28365518 CAGAATGGGGGGATGGAGGGTGG + Intergenic
1136172397 16:28496833-28496855 CAGGAGAGGAGCCTGGAGGCAGG + Exonic
1136209883 16:28749777-28749799 CAGAATGGGGGGATGGAGGGTGG - Intergenic
1136552757 16:30990240-30990262 CGGAAGAGGGGACTGGGGGCTGG + Exonic
1137980418 16:53064531-53064553 CAGTACAGTGGGCTGGAGGCTGG + Intronic
1138437780 16:57015223-57015245 CACAAGAAGAGGCTGGAGGCCGG - Intronic
1139234380 16:65319069-65319091 CTGAATAAAGGCCTGGAGGCAGG + Intergenic
1139491152 16:67286723-67286745 CAGAGTTGGGGGCTGGTGGGTGG - Intronic
1139497244 16:67328819-67328841 CAGTGTAGGGGGTTGGAGGTGGG - Intronic
1139697409 16:68684981-68685003 CTGAATAGGGGTTTGGGGGCAGG + Intronic
1139983923 16:70882320-70882342 CAGAATATGCAGCTGGAGGTAGG + Intronic
1140038109 16:71386430-71386452 CAGAATCGGGAGCTGGGGGAGGG + Intronic
1140339399 16:74142012-74142034 CAGAATTGTGGGCGGGAGGAAGG - Intergenic
1141273249 16:82559664-82559686 CAGAAGAGGGGCCTGGTGGCAGG - Intergenic
1141900400 16:86987036-86987058 CAGAGGAGGGGGCTGGGGCCAGG - Intergenic
1142358890 16:89616977-89616999 CAGAGAATGGGGCGGGAGGCTGG + Intronic
1143282504 17:5765354-5765376 CAGAGCAGGGGGTTGGAGTCAGG + Intergenic
1143912760 17:10265557-10265579 CAGAATTGGGGGGAGGAGGGGGG - Intergenic
1144335585 17:14266224-14266246 AAGAATAGGGGGTTGGCTGCCGG - Intergenic
1144639678 17:16930582-16930604 GAGAAGAGGGAGCTCGAGGCTGG + Intronic
1144649520 17:16998355-16998377 CAGCAGAGGGGGCTGGACTCTGG - Intergenic
1144711779 17:17406045-17406067 CAGAAGATGGGCCTGGAGGTGGG - Intergenic
1145077882 17:19870138-19870160 AAGAAGTGGGGGCAGGAGGCAGG + Intergenic
1145275073 17:21424339-21424361 CAGACTTGGGGGCTGGGGGTTGG - Intergenic
1145312927 17:21710239-21710261 CAGACTTGGGGGCTGGGGGTTGG - Intergenic
1145755887 17:27389846-27389868 CAGGCCAGGAGGCTGGAGGCTGG - Intergenic
1146472018 17:33132135-33132157 CTGAATAGGTGGCTGGAAGGAGG - Intronic
1146472974 17:33139283-33139305 CAGAAGAGGGGGCTGGCCTCAGG - Intronic
1146527855 17:33582040-33582062 GAGAATAAGGGTCTGGAGGCAGG - Intronic
1146581257 17:34040287-34040309 CGGATTAAGGGGCCGGAGGCAGG - Intronic
1146935471 17:36810081-36810103 CAGAAGAGGGGACCTGAGGCCGG + Intergenic
1147402857 17:40191512-40191534 CGGGATGGGGGGCCGGAGGCCGG + Intronic
1147971889 17:44222531-44222553 CAGGAGCGGTGGCTGGAGGCTGG - Intergenic
1148051810 17:44773230-44773252 AAGATGAGGGGGCTGGAGGGTGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149114033 17:53070018-53070040 CATAATAGGTAGCTGGTGGCCGG - Intergenic
1149491214 17:57086057-57086079 CCGAATTGGGGTCTGGAGGTCGG + Exonic
1150108499 17:62478850-62478872 CGGATTAAGGGGCCGGAGGCGGG + Intronic
1150129000 17:62656607-62656629 CAGAGGAGGTGCCTGGAGGCTGG - Intronic
1150437257 17:65163766-65163788 CAGAACCAGAGGCTGGAGGCAGG + Intronic
1150603243 17:66668804-66668826 TATAATAGGGTGCAGGAGGCTGG + Intronic
1151087622 17:71398802-71398824 AACAATAGGGGGATGGGGGCAGG - Intergenic
1151535268 17:74735812-74735834 GAAAATACAGGGCTGGAGGCTGG + Intronic
1151719174 17:75845910-75845932 CAGGCTGGGGGGCTGGTGGCAGG + Exonic
1152037275 17:77881123-77881145 CAGGATAGGAGGATGGAGGATGG + Intergenic
1152301376 17:79496957-79496979 CAGAACAGGGGTCCCGAGGCAGG - Intronic
1152640763 17:81448289-81448311 CAGGGGAGGGGGCAGGAGGCTGG + Intronic
1152878122 17:82800010-82800032 CAGAGCAGGGGGATGGGGGCTGG - Intronic
1154345920 18:13543433-13543455 CTGAAGAGTGTGCTGGAGGCAGG + Intronic
1154484987 18:14866234-14866256 GAGAAGGGGGAGCTGGAGGCTGG + Intergenic
1155114205 18:22748797-22748819 CTGAAAAGGGGGCTGAAGCCAGG + Intergenic
1155155748 18:23156096-23156118 CAGCAGCGGGGGCTGGAGGGTGG + Intronic
1155910432 18:31498551-31498573 CAGAAAAGGGCGCTGGGGCCTGG - Intronic
1157368102 18:47085044-47085066 CAGCATAGGGAGCTGGGGCCGGG - Intronic
1157700640 18:49759822-49759844 CAGTACCGGGGGCTGGGGGCGGG + Intergenic
1157723703 18:49945882-49945904 AATAATGGGAGGCTGGAGGCAGG + Intronic
1158941922 18:62412496-62412518 TAGAAGAGGGAGGTGGAGGCTGG - Intergenic
1159901747 18:74053416-74053438 CTGAAAAGGGGGCTGAAGCCAGG + Intergenic
1159954967 18:74512767-74512789 CTGAGTTGGGTGCTGGAGGCAGG - Intronic
1159973205 18:74678430-74678452 CAGAAAATGGGGTTGCAGGCAGG - Intronic
1160012274 18:75115176-75115198 CAGAAGAGGGGTCTGGTGGGAGG + Intergenic
1160184090 18:76661051-76661073 CAATACAGGGGGCTGGATGCTGG - Intergenic
1160392266 18:78543130-78543152 CAGAGCAGGAGGCTGGAGGCAGG + Intergenic
1160608059 18:80066982-80067004 CAGAGGAGGGTGCTGGAGGGAGG + Intronic
1161021419 19:2013382-2013404 CAGAAAGGAGGGCTGGGGGCTGG + Intronic
1161659664 19:5538154-5538176 CAGGACAGGGAGGTGGAGGCAGG + Intergenic
1161717895 19:5887078-5887100 CCAAAAAGGGGGCTGGAGCCAGG - Intronic
1162133554 19:8542154-8542176 CAGAATAGGGGATGGGGGGCGGG + Intronic
1162300714 19:9843289-9843311 CAGAAGGAGGGGCTAGAGGCTGG - Intronic
1162549570 19:11351055-11351077 CAGAACTGGGGAATGGAGGCAGG + Intronic
1162949514 19:14062148-14062170 CAGAGAGGGGGGCTGGGGGCTGG + Intergenic
1162952763 19:14081766-14081788 CAGAATAGGGGGCAGGGGAGGGG - Exonic
1163478241 19:17539472-17539494 CGGGATAGGGGGCGGGATGCGGG + Intronic
1163566151 19:18052320-18052342 CAGAGGTGGGGGCTGGGGGCGGG + Intergenic
1163570828 19:18081390-18081412 CAGAAAAGGATGCTGGGGGCTGG - Intronic
1163748382 19:19061283-19061305 AAGATGAGGGGCCTGGAGGCAGG - Intergenic
1164631005 19:29761385-29761407 AAGAAAAGGGGACTGGAGGTCGG + Intergenic
1164697109 19:30253584-30253606 CAAAATGTGGGGCTGGAGGCAGG + Intronic
1164855347 19:31516801-31516823 CAGCATCCGGGGCTGGAGGGAGG - Intergenic
1165423072 19:35732026-35732048 AAGAACGGGGGGCTGGAGGAGGG - Exonic
1166141899 19:40809686-40809708 CAGAATGGGAGGCTGCAGTCTGG - Intronic
1166195555 19:41203467-41203489 CTGAATCGGGAGCTGGGGGCTGG + Exonic
1166330853 19:42077167-42077189 CAGAATAGGAGGCTGGTGAGAGG + Intronic
1166748171 19:45151861-45151883 GAGAATAGGGGGCTGGACTGGGG - Exonic
1166778731 19:45328460-45328482 CTGATTATGGGGCTGCAGGCTGG - Intergenic
1166871323 19:45872764-45872786 CAGGCTCAGGGGCTGGAGGCGGG - Exonic
1167462482 19:49633098-49633120 CAGAATAGGGGGTTGGATGGGGG + Intergenic
1167609574 19:50500738-50500760 CAGAATATGGGGGTTGGGGCAGG + Intergenic
925011013 2:486302-486324 CAAAAGAGGAGGCTGGGGGCAGG - Intergenic
925101487 2:1250166-1250188 CAGAGGAAGGGGCAGGAGGCTGG - Intronic
925913222 2:8586781-8586803 CAGGACAGGGGCCTGGAGCCAGG + Intergenic
927259734 2:21075893-21075915 GTGTATAGGGGGCTGGAGGCAGG + Intergenic
927694348 2:25230232-25230254 CAGACTGGGGGGCCGCAGGCGGG - Exonic
927879310 2:26679527-26679549 CAGAATAGAGGACTTGAAGCTGG + Intergenic
928071691 2:28223480-28223502 CAGTTTAAGGGGCTGTAGGCAGG - Intronic
928087166 2:28353027-28353049 CAGAAAAAGGGGCTGGAGGGAGG + Intergenic
928223131 2:29421835-29421857 CAGAATGGGGCTCTGGAGGAAGG - Intronic
929489889 2:42386637-42386659 TAGAAGAGAGTGCTGGAGGCTGG - Intronic
929533206 2:42764905-42764927 CGGAATAGGGAGTGGGAGGCTGG + Intergenic
929588066 2:43128330-43128352 CAGAGTAGGGGCATGGAGGAAGG + Intergenic
929792337 2:45032825-45032847 TAGGACTGGGGGCTGGAGGCAGG - Intergenic
929837999 2:45426013-45426035 CTGGAAAGGGGGCTGGAGCCAGG + Intronic
931151398 2:59578037-59578059 AAGAATAGGGGGCTTGTGTCAGG - Intergenic
931538647 2:63304762-63304784 CTGGAAAGGGGGCTGAAGGCAGG + Intronic
932397889 2:71460653-71460675 CAGACTAGGAAGTTGGAGGCTGG + Intronic
933703911 2:85275670-85275692 CAGAATTGGGAGGTGAAGGCGGG + Intronic
935049301 2:99510781-99510803 CAGAATACAGTTCTGGAGGCCGG + Intergenic
935334170 2:101999746-101999768 CAGCATATGGAGCTGGAGGTTGG - Intronic
936267819 2:111023708-111023730 CAGAACACAGGGCTGGAGGAAGG + Intronic
936463810 2:112729672-112729694 CAGGAGAGGAGGCAGGAGGCAGG - Exonic
937013284 2:118580997-118581019 CAGAACAGGGGGCAGGATGGAGG - Intergenic
937084961 2:119165506-119165528 AAGACTAAGGGGCTGGAGGTGGG - Intergenic
937893279 2:126956762-126956784 CTGAAAAGGGGGCTGAAGCCAGG + Intergenic
938157456 2:128953295-128953317 CATAATGGGTGGCTGGGGGCGGG + Intergenic
938169218 2:129059884-129059906 CAGCACAGGAGACTGGAGGCAGG - Intergenic
939033250 2:137101553-137101575 CTGGAAAGGGGGCTGAAGGCGGG + Intronic
939640869 2:144638646-144638668 CTGAAAAGGGGGCTGAAGCCAGG - Intergenic
940652691 2:156453448-156453470 CAGTGTAGGGTGCTTGAGGCTGG + Intronic
940999001 2:160181152-160181174 CTGAAAAGGGGGCTGAAGCCAGG + Intronic
941856188 2:170233643-170233665 CAGAAGATGGGGCTGGGGCCAGG + Intronic
943464958 2:188217867-188217889 AAGAAAAGGGAGCAGGAGGCTGG - Intergenic
944361764 2:198865406-198865428 CAGAACACTGGCCTGGAGGCTGG - Intergenic
945130153 2:206562546-206562568 CAGAATGTGGGGCTGGGGGCAGG + Intronic
945649493 2:212539770-212539792 CATAACTGGGGGCGGGAGGCGGG - Intergenic
946146565 2:217735492-217735514 GAGAATGGCGGGCAGGAGGCTGG - Intronic
946167762 2:217875855-217875877 CAGAACCGGGGGCTGGTGACAGG - Intronic
946373857 2:219296717-219296739 CAGAGGTGGGGGCTGGAGTCAGG + Intronic
947551727 2:231051310-231051332 CAGAGCAAGGGGCTGGGGGCGGG - Intergenic
947666249 2:231907587-231907609 CAGAACAGTGGGCTCCAGGCAGG + Intergenic
948079686 2:235195637-235195659 CAGAATGGTGGGATGGAGCCAGG - Intergenic
948197103 2:236104293-236104315 CAGGATGGAGTGCTGGAGGCTGG - Intronic
948461957 2:238134125-238134147 CAGAGGAGGGGGCTGGAGGCAGG + Intergenic
1168884701 20:1240626-1240648 CAGAATTGGGGGTTGGACACCGG + Intronic
1169210792 20:3765305-3765327 CACAGGAGGAGGCTGGAGGCAGG - Intronic
1169410971 20:5370094-5370116 AAGAATGAGGGGCAGGAGGCAGG - Intergenic
1169924038 20:10764876-10764898 CATGATAGTGGGCTGCAGGCTGG + Intergenic
1169984122 20:11423100-11423122 CTGGAAAGGGGGCTGAAGGCAGG - Intergenic
1171120881 20:22568273-22568295 TAGAATGGGGGGCGGGATGCTGG - Intergenic
1171423245 20:25032898-25032920 CAGAAGAGGCCGCTGGAGCCAGG - Intronic
1172519967 20:35560041-35560063 CGGAAGTGAGGGCTGGAGGCAGG + Intergenic
1173617809 20:44414273-44414295 CAGAGGAGGGGGCAGGGGGCAGG + Intronic
1173998405 20:47357232-47357254 CAGAAAAAGGGGCTTGAGGCAGG + Intergenic
1174554476 20:51383936-51383958 CAGAAAAGAGACCTGGAGGCTGG + Intergenic
1175078211 20:56393639-56393661 GAGAATTGGGGGCGGGGGGCGGG + Intronic
1175155496 20:56968319-56968341 CTTCATAGGGGGCTGGAGGGAGG - Intergenic
1175254352 20:57630189-57630211 CAGAATAAGGGGTTGGGTGCTGG - Intergenic
1175377011 20:58534837-58534859 CAGACTAGAGGCCTGCAGGCAGG + Intergenic
1175940775 20:62536599-62536621 CAGGATACAGGGCTGGAGCCAGG - Intergenic
1176282601 20:64322746-64322768 GGGAAGAGGGAGCTGGAGGCTGG + Intergenic
1176796342 21:13373241-13373263 GAGAAGGGGGAGCTGGAGGCTGG - Intergenic
1178892227 21:36529920-36529942 CAGGATTGGAGGCTGGGGGCAGG - Intronic
1179582388 21:42351985-42352007 GAGAATGGGGGCCTGGAGGATGG - Intergenic
1180304902 22:11066363-11066385 GAGAAGGGGGAGCTGGAGGCTGG + Intergenic
1180312271 22:11250470-11250492 GAGGGTAGGGGGCTGGACGCCGG - Intergenic
1180629752 22:17220232-17220254 CAGTAGAGGGGGCAGGAGGTAGG + Intronic
1181437243 22:22918054-22918076 GAGAAAAGGGGGCTGGACCCTGG + Intergenic
1184035899 22:41917942-41917964 CAGCATTGGGAGCTGGGGGCGGG - Intergenic
1184092350 22:42299324-42299346 CAGAGCAGGGGGCTGGATGTGGG - Intronic
1184245347 22:43232967-43232989 CAGCATGGGGGCCTGGAGGTCGG - Intronic
1184766546 22:46575518-46575540 CAGAGTAGGGAGCGGTAGGCAGG + Intergenic
1185000898 22:48244913-48244935 CAGTGTCGGCGGCTGGAGGCAGG - Intergenic
1185261349 22:49865956-49865978 CAGCATCGGGAGGTGGAGGCGGG - Intronic
950152119 3:10695990-10696012 CAGAGTGGGTGGCTGGGGGCTGG - Intronic
950479022 3:13233404-13233426 CAGAACAGGGGCCTGAAGCCAGG - Intergenic
952486171 3:33812769-33812791 AAGTGTAGGTGGCTGGAGGCAGG + Intronic
953264264 3:41370808-41370830 CTGAAAAGGGGGCTGAAGCCAGG + Intronic
954115389 3:48464371-48464393 CAGAATAGGGGGCTGGAGGCAGG + Intronic
954390218 3:50264773-50264795 GAGGAGAGGGGGCTGGGGGCGGG - Intergenic
954751913 3:52818611-52818633 CAGGATGGGGGGCTGGAGCTTGG - Exonic
956243383 3:67154436-67154458 CTGGAAAGGGGGCTGAAGGCAGG + Intergenic
956860220 3:73315871-73315893 CAGAGCAGGGGGCTGGAGGGAGG - Intergenic
959089331 3:101885597-101885619 CGGGGTAGGGGGCTGGAGGAGGG - Intergenic
960773174 3:121217158-121217180 CAGGAAAGGGGGCTGAAGCCAGG - Intronic
960957321 3:123042486-123042508 CAGCATTTGGGGCTGGATGCTGG - Intergenic
961528818 3:127526920-127526942 CAGAGGAGGAGCCTGGAGGCTGG - Intergenic
961775205 3:129279231-129279253 CGGACTAGCGGGCGGGAGGCGGG + Intronic
962702673 3:138014472-138014494 AAGCATAGGGGGCTGGGGGAGGG + Intronic
963757079 3:149246159-149246181 CAGATTTGGGAGCTGGAGGTGGG - Intergenic
964556583 3:157946135-157946157 CAGAAGAGGGGGAGGGAGGGAGG + Intergenic
966473947 3:180322918-180322940 GGGAATGGGGTGCTGGAGGCCGG + Intergenic
966891184 3:184408817-184408839 CAGAGTAGGAGACAGGAGGCAGG - Intronic
966929532 3:184666869-184666891 CAGAGAAGGAGGCTGGAGGAGGG + Intronic
966944149 3:184765882-184765904 CAGAGGAGGTGGCTGGTGGCAGG + Intergenic
967018096 3:185499118-185499140 CAGAATCGGGGGCGGGGGCCTGG - Intergenic
968762877 4:2451413-2451435 CAGAGGAGGGGCCTGGGGGCTGG + Intronic
968996059 4:3946585-3946607 GAGCATGGGGGGCTTGAGGCAGG - Intergenic
969039122 4:4280935-4280957 CAGAATAGGTAGCAGGAGGAAGG - Intronic
969608840 4:8216055-8216077 CAGAAGAGGGGCAGGGAGGCAGG - Intronic
970231929 4:13919811-13919833 CTGAATACGTGGCTGGTGGCAGG - Intergenic
970906880 4:21226224-21226246 CAGCATAGGGGGAGGGAGGGGGG + Intronic
971277266 4:25210157-25210179 AAGAATAGGGGCCTGGATCCTGG + Intronic
971477353 4:27084759-27084781 CTGATTAGGGGGCTGGAAACGGG + Intergenic
972743294 4:41909485-41909507 CAGGAAAGGGGGCTGAAGCCAGG - Intergenic
974914431 4:68162304-68162326 TGGAATAGGGTGCTGGAGGCAGG - Intergenic
974932629 4:68376294-68376316 CTGAAGAGGCGGCTGGAGTCGGG - Intergenic
975239158 4:72036466-72036488 CAGATTAGTGGGCTGGAGTTGGG + Intronic
975370913 4:73586486-73586508 CAGAAAGGGGGGCAGAAGGCAGG - Intronic
976065537 4:81183657-81183679 CTGAAAAGGGGGCTGAAGCCAGG + Intronic
976478829 4:85515107-85515129 TAGAATAGAAAGCTGGAGGCTGG + Intronic
978840748 4:113209152-113209174 AAGAATAGGGGCCTGGAGCATGG + Intronic
979965998 4:127077317-127077339 CAGGAAAGGGGGCTGGAGCCAGG - Intergenic
980678986 4:136130301-136130323 CAGAAAAGGAGGCTGTAGGCAGG + Intergenic
980985303 4:139689362-139689384 CACAATAGGGAGGTGGCGGCTGG - Intronic
981045030 4:140256907-140256929 CAGAGCAGGTGGCTAGAGGCAGG + Intergenic
981809502 4:148757717-148757739 CACAAGAGGGGGCTGGAGTTTGG + Intergenic
983514755 4:168644332-168644354 CACATTGGGTGGCTGGAGGCAGG - Intronic
984881073 4:184410404-184410426 CAGCATATGGGGCTGGGGGAAGG - Intronic
985476311 5:81289-81311 AAGAAAGGGAGGCTGGAGGCGGG - Intergenic
985673969 5:1220841-1220863 CAGAATGGGGGGTTGGAGGAGGG - Intronic
985769231 5:1798753-1798775 CAGCAGATGGGGCAGGAGGCCGG + Exonic
985930674 5:3054897-3054919 CAGAAGTGGGGGCTTCAGGCTGG - Intergenic
986051435 5:4094103-4094125 CAGAATAGAGGGGTGGGGGAGGG + Intergenic
986675170 5:10177854-10177876 CTGAAAAGGGGGCTGAAGTCAGG + Intergenic
986824070 5:11501711-11501733 CATAAGAAGGGGCAGGAGGCTGG + Intronic
987292578 5:16522647-16522669 TAGAAGAGGGGGCTGGATGCTGG - Intronic
987940126 5:24523077-24523099 CAGAAAACGGGGATGGGGGCAGG + Intronic
990499022 5:56376535-56376557 CAGAATGGGGAGCTGGAGAGGGG + Intergenic
991584828 5:68191237-68191259 CTGCTTAGGGGGCAGGAGGCAGG - Intronic
992077842 5:73207232-73207254 CTGAAAAGGGGGCTGAAGCCAGG + Intergenic
993460187 5:88173107-88173129 CTGAAAAGGGGGCTGAAGCCAGG - Intergenic
993467647 5:88268504-88268526 GAGACTAGCGGGCCGGAGGCAGG - Intronic
995684480 5:114757351-114757373 CAGAACTGGGGGCTAGAGGGTGG - Intergenic
996266349 5:121545560-121545582 CAGAAGATGGGGCTGGAGGTGGG - Intergenic
997045545 5:130312524-130312546 AAGATTAGGGAACTGGAGGCTGG - Intergenic
997223877 5:132194460-132194482 CAGAAGATGAGGCTGGAGGCTGG - Intronic
998091181 5:139370792-139370814 AAGAAAAGGGGGCTCTAGGCTGG + Intronic
999090367 5:148930942-148930964 GATAGTAGGGGTCTGGAGGCTGG - Intronic
999433138 5:151540997-151541019 CAAAATATGTGGCTGAAGGCAGG + Intronic
999519799 5:152339545-152339567 CTTAATGGGGGGATGGAGGCAGG + Intergenic
999539035 5:152551463-152551485 CAGAATGTGGGGCTGAAGGCAGG + Intergenic
999956595 5:156709848-156709870 CAGAGTAGGGGGCGGGAGGGTGG - Intronic
1000548047 5:162625872-162625894 CAGGAAAGGGGGCTGAAGTCAGG + Intergenic
1000616621 5:163434781-163434803 CAGAATAATGGCCTTGAGGCTGG - Intergenic
1001636081 5:173211361-173211383 CAAAGGAGGGGGCTGGGGGCTGG - Intergenic
1001686251 5:173597046-173597068 GGGAAAAGGAGGCTGGAGGCAGG - Intergenic
1001889430 5:175326874-175326896 CAGAGGATGGGGCTGGAGGCTGG - Intergenic
1002201342 5:177530420-177530442 CAGGAGAGGGAGATGGAGGCAGG - Intronic
1002723686 5:181281461-181281483 GAGAAGGGGGAGCTGGAGGCTGG + Intergenic
1002763620 6:220071-220093 CAGAATGGGGAACTGGAGCCGGG + Intergenic
1003288875 6:4761000-4761022 CAGAAGAGTGGGCTGGATCCTGG - Intronic
1003687859 6:8322637-8322659 CAGGATAGGGAGCTGGAGAGGGG + Intergenic
1004380522 6:15128541-15128563 GAGAATGAGGGGCTGGAGACAGG - Intergenic
1004395507 6:15244474-15244496 CACGACAGGGGGCTGGAGGCAGG + Intergenic
1006070539 6:31495032-31495054 GAGCAGAGGGGGCTGGAGGTGGG + Intronic
1006091051 6:31629252-31629274 CTGACTAGGGGGCTGGCGGGTGG - Exonic
1006112867 6:31759332-31759354 CAGAGTTAGGGGCTGGAGGTGGG + Intronic
1006339452 6:33438674-33438696 CAGAATCAGGTGTTGGAGGCTGG - Intronic
1006518831 6:34559859-34559881 CAGCCCAGGGAGCTGGAGGCAGG - Intergenic
1007165134 6:39823822-39823844 CAGTCTTGGAGGCTGGAGGCAGG + Intronic
1007742753 6:44022829-44022851 GAGAGGATGGGGCTGGAGGCGGG - Intergenic
1008964309 6:57298884-57298906 GAGAATAGGGTGGGGGAGGCAGG - Intergenic
1009303558 6:62059252-62059274 CTGAATAGGGAGCTTGAAGCTGG + Intronic
1010268387 6:73892552-73892574 CAGAAGAGGGGCCTGGTGGGAGG + Intergenic
1010832822 6:80552100-80552122 CAGAATGGGGGTGTGGAGGTTGG - Intergenic
1011196549 6:84785838-84785860 CAGAATAGGAGGATAGAGGGTGG - Intergenic
1012520170 6:100111800-100111822 CAGGATATGGGCCAGGAGGCTGG + Intergenic
1012534880 6:100283511-100283533 CAGCAGAGGCTGCTGGAGGCTGG - Intergenic
1012978477 6:105805268-105805290 CAGATTGGAGGGCGGGAGGCTGG + Intergenic
1013207626 6:107958637-107958659 TAGAATAGGGGGTGGGAGGCCGG + Intergenic
1013262892 6:108463890-108463912 CATAATCTGGGGCTGGAGGCAGG - Intronic
1013347873 6:109279512-109279534 CAGAATAGAGGGCTGGGGTCAGG - Intergenic
1014089242 6:117384816-117384838 CAGATTAGAGGGCAGGAGGAAGG + Intronic
1015623419 6:135156312-135156334 CAGGAAAGGGGGCTGAAGCCAGG - Intergenic
1015669707 6:135674405-135674427 CTGAAAAGGGGGCTGGAGAAAGG - Intergenic
1016574900 6:145558889-145558911 CATAATAGAGGGGTGGAGGTGGG - Intronic
1016613044 6:146014990-146015012 CAGAAGAGGGGGCTAGAGCTGGG + Intergenic
1017197427 6:151716807-151716829 CAGAAAAGGGGGCTGAAGCCAGG - Intronic
1017567860 6:155708360-155708382 CAGAAGAGGGGACTGGGTGCTGG + Intergenic
1017720630 6:157240951-157240973 GGGAGTAGGGGGCTGGAGCCCGG - Intergenic
1017877822 6:158538121-158538143 CAGAGTAGGGGGCGGGGGACGGG - Intronic
1018472891 6:164112220-164112242 CAGAAGAGGGGGCAGGTGCCTGG + Intergenic
1018765895 6:166932440-166932462 CAGAGCTGGGGGCTGGGGGCTGG - Intronic
1018873199 6:167798438-167798460 CAGAATAGGAGTCTGGGGGTTGG + Intergenic
1018889524 6:167973527-167973549 CAGAACAGGAGGGTGCAGGCAGG + Intergenic
1019722673 7:2582676-2582698 CAGAACACGGGGCGGAAGGCAGG - Intronic
1019771765 7:2887828-2887850 TGGAAGAGGGGGTTGGAGGCCGG - Intergenic
1020051355 7:5084109-5084131 CAAAAAAGGGGGATGGGGGCTGG - Intergenic
1021100657 7:16584170-16584192 CAGGACTGGGGGCTGCAGGCTGG + Intergenic
1021322294 7:19227065-19227087 CTGAAAAGGGGGCTGAAGCCAGG + Intergenic
1021552687 7:21888410-21888432 CAACATAGTGGGCTGGATGCTGG + Intronic
1021907371 7:25348684-25348706 CAGAGTTGGGGGCAGGAGACTGG + Intergenic
1021934928 7:25620895-25620917 CAGAATAAGGTGGTGGTGGCTGG - Intergenic
1022465321 7:30649430-30649452 CAGGGCAGGGGGCTGGGGGCAGG + Intergenic
1023528922 7:41133573-41133595 CAGAAGAAGGGGGTGGGGGCGGG + Intergenic
1024279286 7:47706176-47706198 CAGAATAGAGAGCTGGGTGCAGG + Intronic
1025201905 7:56967383-56967405 GAGCAGAGGGGGCGGGAGGCAGG - Intergenic
1025670041 7:63609545-63609567 GAGCAGAGGGGGCGGGAGGCAGG + Intergenic
1026847308 7:73705369-73705391 CAGAATTGGGGGAGGGGGGCGGG - Intronic
1026876646 7:73883023-73883045 CAAAATAAGGGGGTTGAGGCTGG + Intergenic
1026895946 7:74010184-74010206 GAGAATAGGGGGTTGGGAGCAGG + Intergenic
1026896635 7:74013384-74013406 GAGAATAGGGGGCTGGGAGCAGG + Intergenic
1027232930 7:76282587-76282609 CCGGAAAGGGGGCTGGGGGCGGG - Intronic
1028142389 7:87288385-87288407 CTGGAAAGGGGGCTGGAGCCAGG - Intergenic
1028648184 7:93121040-93121062 CTGAAAAGGGGGCTGAAGCCAGG + Intergenic
1028801427 7:94970124-94970146 CTGGAAAGGGGGCTGAAGGCAGG - Intronic
1029105334 7:98170562-98170584 AAGAAAAGACGGCTGGAGGCGGG - Intronic
1029704796 7:102270574-102270596 CAGAATTGGGGGATGGCTGCTGG - Intronic
1030230336 7:107201964-107201986 CAGAACATGGGGCAGGTGGCTGG + Exonic
1031544749 7:123037016-123037038 CAGAATAAGTGACTGGAGGAGGG - Intergenic
1031921182 7:127601824-127601846 TAGAATAGGGGTCTGGATGAGGG + Exonic
1032037535 7:128531389-128531411 CGGATTAAGGGGCCGGAGGCGGG + Intergenic
1033609198 7:142949540-142949562 CAGGATATGTGGCTGAAGGCAGG + Intronic
1033756389 7:144400831-144400853 CAGAAAATGAGGCTGGAGCCAGG - Intronic
1034496976 7:151428886-151428908 CAGATTAGGGAGCAGGGGGCTGG + Intronic
1035029518 7:155848385-155848407 GAGAATAGGAGACAGGAGGCTGG - Intergenic
1035367359 7:158357843-158357865 CAGAGTTGAGGGCTGGCGGCTGG - Intronic
1035368574 7:158363897-158363919 CAGAAAAGGGGACTTCAGGCTGG + Intronic
1035736959 8:1895897-1895919 TAGAAATGGGGGCTGGGGGCGGG - Intronic
1036185078 8:6615499-6615521 CTGAGTTGGGGGCAGGAGGCAGG + Intronic
1036747319 8:11419090-11419112 CAGAATAGGGGACTTGAGGCTGG + Intronic
1037584115 8:20264806-20264828 CAGAATAAAGGGTTGGAGCCTGG - Intronic
1037819069 8:22127104-22127126 CAGAACAGGGGGCTGGGGGTTGG - Exonic
1038936468 8:32257261-32257283 CTGGAAAGGGGGCTGGAGTCAGG - Intronic
1039797034 8:40924521-40924543 CAGAACAGAGGGCAGGTGGCTGG + Intergenic
1039890441 8:41682190-41682212 CACAGGACGGGGCTGGAGGCGGG - Intronic
1040968827 8:53112460-53112482 CTGGAAAGGGGGCTGAAGGCAGG - Intergenic
1041008931 8:53522774-53522796 AATAAAAGGGGGCTGGAGACCGG - Intergenic
1041050792 8:53932292-53932314 CTGAAAAGGGGGCTGAAGCCAGG + Intronic
1041606502 8:59788190-59788212 GAGAATTGGGAGATGGAGGCAGG - Intergenic
1041838355 8:62242213-62242235 CAGAAAAGGGGGCTGAAGCCAGG - Intergenic
1042007808 8:64201788-64201810 TAGGTAAGGGGGCTGGAGGCTGG + Intergenic
1042027845 8:64443106-64443128 CAGAATAAGGGGTGGGAGACAGG + Intergenic
1042110905 8:65380100-65380122 CTGGATAGGGGGCTGAAGCCAGG + Intergenic
1042438072 8:68791364-68791386 CAGAAGAGGGGCCTGGTGGGAGG - Intronic
1042852392 8:73228744-73228766 CAGAATAGGAGGCTGAGGGAAGG + Intergenic
1043315556 8:78917325-78917347 GAGAATAGCGGGGTGGAGGTGGG - Intergenic
1044503543 8:92990916-92990938 CTGAAAAGGGGGCTGAAGCCAGG + Intronic
1044885350 8:96771015-96771037 GAGAAGAGGAGGCTGGAGGCAGG + Intronic
1044885450 8:96772139-96772161 GAGAAGAGGAGGCTGGAGGCAGG + Intronic
1045376042 8:101575079-101575101 CAGCATGGAGGGCTGAAGGCAGG + Intronic
1045909880 8:107394523-107394545 CAGAATAAGGAGCTGGGGGGAGG + Intronic
1046680576 8:117164956-117164978 CAGAATGGGGGAGAGGAGGCAGG - Intronic
1047334534 8:123922973-123922995 CAGAATGGGGGTCTGGGGGGGGG - Intronic
1047522200 8:125603466-125603488 CTGCATAGGGGGCTAGAGGTGGG - Intergenic
1047522559 8:125606448-125606470 CAGACCAGGGGACTGGGGGCAGG - Intergenic
1048888125 8:138924804-138924826 GAGAATAGGGGCCTGGAGGCAGG + Intergenic
1048995604 8:139792054-139792076 AAGAATAGGCGGCAGGCGGCGGG - Intronic
1049145651 8:141000212-141000234 CAGAGTCGGGGGCTGGGGGCGGG + Intronic
1049290009 8:141796825-141796847 CAGAATGGGAGGCGGGAGGAGGG + Intergenic
1049403454 8:142441147-142441169 CAGGAGTGGGGGCTGGAGGTGGG - Intergenic
1049477973 8:142805702-142805724 CTGAAAAGGGGCCAGGAGGCAGG - Intergenic
1049774060 8:144396649-144396671 CAGAGGAGGGGGCTGGGGCCCGG - Exonic
1049842175 8:144779731-144779753 CAGTAGAGGTGACTGGAGGCTGG - Intronic
1050391927 9:5153205-5153227 CTGAAAAGGGGGCTGAAGCCAGG + Intronic
1051331289 9:16027285-16027307 TAGAAAAGGGGGTTGGAGGGAGG - Intronic
1051695831 9:19767270-19767292 CTGAAAAGGGGGCTGAAGCCAGG - Intronic
1052702812 9:31959309-31959331 CAGAAGTGGGGCCTGCAGGCTGG - Intergenic
1052834378 9:33239801-33239823 CAGAGAAGGGGGCTGGAGCCTGG - Intronic
1053885901 9:42645087-42645109 GAGAAGGGGGAGCTGGAGGCTGG + Intergenic
1054224919 9:62452536-62452558 GAGAAGGGGGAGCTGGAGGCTGG + Intergenic
1056992018 9:91421553-91421575 GAGAATCCGGGGCTGGGGGCGGG - Intronic
1057836523 9:98449772-98449794 CAGAAGAGGGGGATGGAGGAGGG + Intronic
1057997293 9:99829563-99829585 CAGAGAAGGGAGATGGAGGCAGG + Intronic
1058307294 9:103459849-103459871 GAGGAAAGGGGGCTGGAGTCAGG - Intergenic
1059754716 9:117281843-117281865 GAGATGAGAGGGCTGGAGGCAGG - Intronic
1059883877 9:118722760-118722782 CAAAGTAGGGGGTAGGAGGCAGG - Intergenic
1060295151 9:122338296-122338318 CAGGATAGGAGGCTGGAGGATGG - Intergenic
1060946890 9:127574973-127574995 ATGCATGGGGGGCTGGAGGCAGG - Intronic
1061967739 9:134025579-134025601 GACGATAGGGGGCTGGAGGATGG + Intergenic
1062212186 9:135371153-135371175 CAGCAGGGGGAGCTGGAGGCAGG - Intergenic
1062262697 9:135670830-135670852 CAGGCGAGAGGGCTGGAGGCGGG - Intergenic
1062478847 9:136742353-136742375 CAGAGTTGGGGGCCGGGGGCCGG - Intronic
1062480359 9:136748168-136748190 GAGAATTGGAGGCTGGAGACTGG - Intronic
1062502882 9:136858802-136858824 CAGAAGCGGAGGCAGGAGGCTGG - Exonic
1062533738 9:137012655-137012677 GAGACTAGGTGGCTGGTGGCCGG + Intronic
1062619291 9:137412134-137412156 AAGGACAGGGGGCTGGAGGCCGG + Intronic
1062712557 9:137984609-137984631 CAGACTTGGGGGCTGGATGATGG - Intronic
1185616034 X:1422588-1422610 CAGAATGGGAGGCTGGAAGGTGG + Intronic
1186773329 X:12839334-12839356 CTGAAAAGGGGGCTGCAGTCAGG - Intergenic
1186900161 X:14045893-14045915 GAGAAAAAGGGGTTGGAGGCTGG + Intergenic
1187076526 X:15940649-15940671 TAGGATGGGGGGCTGGGGGCAGG + Intergenic
1189003788 X:36973853-36973875 CAGAATAGGGAGTTGGAGTGGGG + Intergenic
1189045866 X:37590159-37590181 CAGAATAGGGGGTTGGAGTGGGG - Intronic
1189189617 X:39088969-39088991 CTGAAAAGGGGGCTGAAGCCAGG + Intergenic
1190286789 X:48966756-48966778 CAGAATGGGGGCCTTGAGGTGGG - Exonic
1190301774 X:49061136-49061158 CAGAGAAGGAGGCAGGAGGCAGG + Intronic
1190324778 X:49199862-49199884 AGGAATAGGGGCCTGGGGGCTGG - Intronic
1191705101 X:64085851-64085873 CTGAAAAGGGGGCTGAAGCCAGG + Intergenic
1191802692 X:65098895-65098917 CCGAAAAGGGGGCTGAAGCCAGG + Intergenic
1192447684 X:71223051-71223073 CAGAACAGGTGGGTGCAGGCTGG + Intronic
1192598535 X:72437505-72437527 CTGAAAAGGGGGCTGAAGTCAGG + Intronic
1192931785 X:75814362-75814384 CTGGAAAGGGGGCTGGAGCCGGG + Intergenic
1196133381 X:112181344-112181366 CTGAAAAGGGGGCTGAAGCCAGG + Intergenic
1196467033 X:115983149-115983171 CTGAAAAGGGGGCTGAAGCCAGG + Intergenic
1197142176 X:123129804-123129826 CAGGAAAGGGGGCTGAAGCCAGG + Intergenic
1197728786 X:129793596-129793618 CAGAATATGGGGGTGGAGGTAGG - Intronic
1198555797 X:137792198-137792220 CTGAAAAGGGGGCTGAAGCCAGG + Intergenic
1198784498 X:140272875-140272897 CTGAAAAGGGGGCTGAAGCCAGG - Intergenic
1199067946 X:143442630-143442652 CTGAAAAGGGGGCTGAAGCCAGG - Intergenic
1200799174 Y:7370187-7370209 CAGAGTCTGGGGCTGGAGCCTGG + Intergenic