ID: 954116369

View in Genome Browser
Species Human (GRCh38)
Location 3:48469004-48469026
Sequence CTGGACACACACAGCACACA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 1, 2: 5, 3: 46, 4: 316}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954116361_954116369 30 Left 954116361 3:48468951-48468973 CCACATATACAGGCAGGACACAC 0: 2
1: 0
2: 1
3: 14
4: 155
Right 954116369 3:48469004-48469026 CTGGACACACACAGCACACATGG 0: 1
1: 1
2: 5
3: 46
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954116369 Original CRISPR CTGGACACACACAGCACACA TGG Exonic
900188960 1:1345338-1345360 CAGGACCCAAACAGCACAGAGGG + Intronic
900432161 1:2607504-2607526 CAGGACACACACAGGCCCCAGGG - Intronic
901143559 1:7050931-7050953 CTGGGAACACACAGTACAGAGGG - Intronic
902388397 1:16088861-16088883 ATGGGCACACACAGCACTGAGGG + Intergenic
903181499 1:21607196-21607218 CTGGACTCACTCAGGCCACAGGG - Intronic
905281199 1:36850429-36850451 ATGGACACAGACAGAAAACAGGG + Intronic
905508996 1:38503498-38503520 CTGGCCACACACAACAGCCAGGG + Intergenic
907056343 1:51372241-51372263 CTTGACACACACCGCCCACTAGG - Intronic
910035848 1:82787344-82787366 CTCGGAACACACAGCACAAAAGG + Intergenic
910192402 1:84607268-84607290 TGGGACAGACACAGCACAGAAGG + Intergenic
915279844 1:154814935-154814957 CTGGATGATCACAGCACACAAGG - Intronic
916576040 1:166067397-166067419 TTAGACACACACACAACACATGG - Intronic
916766114 1:167862355-167862377 TTGGACACAAACAACACACAGGG + Intronic
918536733 1:185583066-185583088 CTGGAGAAAAAGAGCACACAGGG + Intergenic
918993568 1:191729019-191729041 CTGGAGAGACAGAGCCCACATGG - Intergenic
920176268 1:204103891-204103913 CTGGAGGCACACATCACACTGGG + Intronic
920576384 1:207063864-207063886 CACAACACACACAGCACAAAAGG - Intronic
922917808 1:229272423-229272445 CTGCAGAAACACAGCAGACACGG + Intronic
923606263 1:235445881-235445903 GTGGAACCACACAGCACACAAGG + Intronic
924284380 1:242470816-242470838 CTGGACACAGAAAGAAGACAGGG - Intronic
1063374397 10:5545376-5545398 CTGGACACACACAGCTCCTTGGG - Intergenic
1063490500 10:6459417-6459439 CTGCACATCCAGAGCACACATGG + Intronic
1063582620 10:7322393-7322415 GTGGACTGACACAGTACACAAGG + Intronic
1064026607 10:11853635-11853657 CTGGACACTAACAGAACACCAGG - Intronic
1065521612 10:26579414-26579436 CTGGACTCCCACATCACAAATGG + Intergenic
1065857485 10:29842147-29842169 CTACACAAACACAGCACCCATGG - Intergenic
1066754397 10:38696317-38696339 GTGGAAACACACAGGAGACAGGG + Intergenic
1067059378 10:43070204-43070226 CTGGACAGACAGAGCAAGCAGGG + Intergenic
1067077165 10:43194510-43194532 CTGTACACACACAGCAGGCAAGG + Intergenic
1068124038 10:52815982-52816004 CTGGACACACATACCATATAGGG + Intergenic
1069719469 10:70540491-70540513 CCAGACACACGCACCACACAGGG - Intronic
1069915221 10:71783029-71783051 CAGGAAGCACACAGCTCACAGGG - Intronic
1070355810 10:75639271-75639293 CTTGCCACAAACAGCACAAATGG - Intronic
1070599848 10:77857893-77857915 CTGGACCCACAACGCACAAAGGG + Intronic
1072249549 10:93570694-93570716 CTGGGCACCCACAGCCCACATGG - Intronic
1072666055 10:97393279-97393301 ATGAACACACTGAGCACACATGG + Intronic
1072797392 10:98366358-98366380 CTACACACACACAGGACACGTGG - Intergenic
1073220175 10:101865370-101865392 ATGCACACAAACACCACACATGG + Intronic
1073453794 10:103624535-103624557 CTGAACTCCCACAGCACACCTGG + Intronic
1075353659 10:121750207-121750229 CTGAACCCACACAGCACAACAGG + Intronic
1075754746 10:124801855-124801877 GTGGAAACACACAGCACTGAAGG - Exonic
1076404520 10:130202977-130202999 CACAGCACACACAGCACACACGG + Intergenic
1076404538 10:130203075-130203097 CACAGCACACACAGCACACACGG + Intergenic
1076404553 10:130203169-130203191 CACAGCACACACAGCACACATGG + Intergenic
1077023236 11:428920-428942 CGGGACACTCACCCCACACATGG + Intronic
1077023258 11:429017-429039 CGGGACACTCACACCACACGTGG + Intronic
1077023311 11:429269-429291 CGGGACACTCACCCCACACATGG + Intronic
1077023352 11:429462-429484 CGGGACACACACCTCAGACACGG + Intronic
1077340776 11:2025453-2025475 CAGGAGGCACACAGCACAGAGGG - Intergenic
1079078221 11:17396650-17396672 CTGGACTCCCCCAGCTCACACGG - Intronic
1079275306 11:19030068-19030090 CTGGACCCAGAGAGAACACATGG + Intergenic
1079480656 11:20876403-20876425 CATGGAACACACAGCACACAGGG - Intronic
1080317011 11:30960779-30960801 ATGTATACACACAGCCCACAAGG + Intronic
1081240434 11:40698921-40698943 CTGGACCCTCCCAGAACACATGG + Intronic
1081683637 11:45026324-45026346 CTGCACACGCACAGCACACCAGG + Intergenic
1082075610 11:47973855-47973877 CAGGACAGACCCAGGACACAGGG - Intergenic
1082903794 11:58284814-58284836 CTGAACACACACACCCCACTGGG + Intergenic
1083222949 11:61265216-61265238 CAGGACACAGAAAACACACAAGG + Intronic
1084402216 11:68951204-68951226 CTGGAGCCACACACCACACCTGG - Intergenic
1084440442 11:69169772-69169794 CTGGAAACACCGAGGACACACGG + Intergenic
1084465546 11:69320972-69320994 CTGGACACCCACAGAACTCCTGG - Intronic
1086061799 11:82707618-82707640 CAGGACTCACCCAGCACACCAGG - Intergenic
1088313706 11:108486408-108486430 CCGGACACTCACAGTACTCATGG + Exonic
1089169911 11:116504752-116504774 CTGCAGACACACAGCGCCCAGGG - Intergenic
1089651682 11:119918527-119918549 GTGTACACACACAGAACACGTGG - Intergenic
1090024867 11:123158829-123158851 CTAGTGATACACAGCACACAAGG + Intronic
1090099747 11:123781910-123781932 ATAGACACACTCTGCACACATGG - Intergenic
1091090550 11:132767272-132767294 GTGCACACACACACCACCCAGGG - Intronic
1202823761 11_KI270721v1_random:80642-80664 CAGGAGGCACACAGCACAGAGGG - Intergenic
1092247112 12:6869823-6869845 TTGGACAGACACAGCCCACATGG + Intronic
1095034680 12:37346771-37346793 CTGAATACACACAACACAAAAGG + Intergenic
1095919802 12:47517662-47517684 CTGAACTTACACACCACACATGG + Intergenic
1096009699 12:48202490-48202512 ATGAACCCCCACAGCACACATGG - Exonic
1100370226 12:93962422-93962444 CTCCACACACCCAACACACATGG + Intergenic
1100957236 12:99922580-99922602 CTGGACATACAAAGAAGACAAGG + Intronic
1101735452 12:107459810-107459832 CCTGCCACCCACAGCACACAGGG - Intronic
1101748096 12:107559342-107559364 CCCCAGACACACAGCACACACGG - Intronic
1102029501 12:109731752-109731774 CTCCACACACCCAGAACACACGG - Intronic
1102520423 12:113474698-113474720 CTGGAAACACACACCAGACAGGG - Intergenic
1102799141 12:115716373-115716395 CTGAACAGACACACCACCCAAGG - Intergenic
1104971430 12:132532602-132532624 ATGGACACGCTCAGCACACATGG - Intronic
1106393277 13:29356295-29356317 GTGGTCACAGACAGCTCACAGGG - Intronic
1107183148 13:37485506-37485528 TTGCACACACAGAACACACAAGG - Intergenic
1107640876 13:42441907-42441929 CTGTATACACACAGCCAACAAGG + Intergenic
1107794058 13:44031728-44031750 CTGCTCACACACACCATACAGGG + Intergenic
1111085119 13:83365447-83365469 CTGGACAGACACAGTAAACAAGG - Intergenic
1111596106 13:90413079-90413101 CTGGAAAAACACAGCACACCAGG + Intergenic
1112694943 13:101937414-101937436 CTGGACACACAGAGATCCCAGGG + Intronic
1112994141 13:105552078-105552100 TTGCACACACACAGCGCACACGG - Intergenic
1113079602 13:106504404-106504426 ATGGACACACACAGCTTAGATGG + Intronic
1113217586 13:108060714-108060736 CTGGACACACCCTGGACAGAAGG + Intergenic
1113481549 13:110625536-110625558 CCTGTCACACACAGCCCACAGGG - Intronic
1113800475 13:113083718-113083740 CAGCACACACACGGCTCACAGGG - Intronic
1113990180 14:16022686-16022708 GTGCATGCACACAGCACACATGG - Intergenic
1115380931 14:32738171-32738193 CTGCACACACACAGCTCAAAGGG - Intronic
1119424186 14:74525063-74525085 CTGGACAGACACAGCTCACAGGG + Intronic
1120181026 14:81342575-81342597 AGGGCCCCACACAGCACACAGGG - Intronic
1120841528 14:89089618-89089640 TTGGACAGAGACAGCACACAGGG + Intergenic
1121502627 14:94450383-94450405 TTGGACACAGACAACACACAGGG + Intronic
1121636184 14:95455327-95455349 CTGGGCACAGACAGCACCCTGGG + Intronic
1122915856 14:104858519-104858541 CTGGACACACACATCAGAGCAGG - Intergenic
1124076139 15:26446172-26446194 TTGGACACAGATACCACACAGGG - Intergenic
1124077391 15:26459367-26459389 CTAGACACACAAATCACACTTGG + Intergenic
1124181578 15:27480398-27480420 CTGGCCACTGACAACACACAGGG - Intronic
1124595099 15:31085809-31085831 CTGGACACAGACAGCAGCCAGGG + Intronic
1129896150 15:79107509-79107531 TTGGTCACACACAATACACAAGG + Intergenic
1130740368 15:86592568-86592590 CAGTAAACACACTGCACACACGG - Intronic
1131050571 15:89345004-89345026 ATGGAAACACACATAACACAAGG - Intergenic
1131786813 15:95922328-95922350 GTGGACTGAGACAGCACACAAGG + Intergenic
1132028387 15:98421378-98421400 CGGGACACACGCAGCAACCACGG - Intergenic
1132379245 15:101355099-101355121 CTGGAAAAACACAGCACATGTGG + Intronic
1132565116 16:618639-618661 CTGCGCACACACTGCACACATGG - Intronic
1132565152 16:618883-618905 CTGAGCACACACTGCACACATGG - Intronic
1132565187 16:619124-619146 CTGAGCACACACTGCACACATGG - Intronic
1132565207 16:619249-619271 CTGCACACACACTGCACACATGG - Intronic
1132565227 16:619374-619396 CTGCACACACACTGCACACATGG - Intronic
1132638072 16:963094-963116 CGGGACACAGACTGGACACAAGG + Intronic
1133730008 16:8570647-8570669 CTGGACACTCACAGGCCACTGGG - Intronic
1136013888 16:27382790-27382812 CTGGCCACACACAGGACCTAGGG + Intergenic
1136728284 16:32380526-32380548 GTGGAAACACACAGGAGACAGGG - Intergenic
1138569156 16:57857149-57857171 TGGAAGACACACAGCACACAGGG - Intronic
1138660253 16:58512362-58512384 AGGGGCACACACACCACACATGG - Exonic
1139327652 16:66164636-66164658 CTGGCCACACACAAAGCACATGG - Intergenic
1140210564 16:72966650-72966672 CTGAACACACACACCATTCACGG + Intronic
1140985945 16:80158049-80158071 CCACCCACACACAGCACACATGG + Intergenic
1141118688 16:81333898-81333920 CAGCACACACACAGCACCCCAGG - Intronic
1141158793 16:81615693-81615715 ATGCACACACACGACACACAAGG - Intronic
1142407015 16:89895935-89895957 ATGGCCACACACAGCAACCACGG - Intronic
1202998154 16_KI270728v1_random:137228-137250 GTGGAAACACACAGGAGACAGGG + Intergenic
1142805729 17:2370168-2370190 CAGGACTCCCTCAGCACACACGG + Intronic
1143785019 17:9249462-9249484 CTGCGCACACTCAACACACAGGG + Intergenic
1144776944 17:17789587-17789609 CTGGAATCACATAGCACCCAGGG - Intronic
1145056272 17:19706006-19706028 CTGGAAAGACAGACCACACAGGG - Intronic
1145247688 17:21280322-21280344 ATGCACACACACATGACACAAGG - Intergenic
1145908900 17:28531503-28531525 GTGGACAAACACATCAGACAGGG + Intronic
1149572575 17:57683850-57683872 CTGGGCACAGACACTACACAAGG + Exonic
1150284084 17:63945771-63945793 CTGCACACACACAGCCCAGCAGG - Intronic
1151063080 17:71119464-71119486 CTGCACAGACTCAGCACACTAGG - Intergenic
1151547110 17:74799905-74799927 CGGGGCACTCACAGCACGCATGG - Intronic
1151906954 17:77054944-77054966 CGGGCCACCCACAGCACCCAGGG + Intergenic
1151953185 17:77366593-77366615 CTGCACACACACAGGACAGAAGG - Intronic
1151982240 17:77520105-77520127 CTGGACAATCTCAACACACATGG + Intergenic
1153752973 18:8252629-8252651 GTGGACCAACACATCACACATGG - Intronic
1155098507 18:22584400-22584422 CTGGGCACAGACACTACACAAGG - Intergenic
1155574442 18:27229457-27229479 CTGGCAAGACACAGCATACATGG - Intergenic
1155737304 18:29239627-29239649 CTGGACAAAGACATGACACAGGG + Intergenic
1155767468 18:29653207-29653229 CTGGACACACCCAGGACCCTAGG + Intergenic
1157472747 18:48002706-48002728 ATGCACACACACCACACACATGG - Intergenic
1160076770 18:75684835-75684857 CTGGACTCACACAACACATTGGG + Intergenic
1160364804 18:78314648-78314670 CTGGACACACCCAGGAGTCAGGG + Intergenic
1160604102 18:80036052-80036074 ATGAACACACCCAGCACCCATGG - Intronic
1160719577 19:591284-591306 CTGTTCACACACAGCCCACGGGG - Intronic
1161076191 19:2286936-2286958 CAGGACCCACCCAGCTCACAGGG + Intronic
1161597384 19:5157538-5157560 TTAGACACACACAGCAGACATGG - Intergenic
1161931856 19:7345935-7345957 CGAGACACACACAGAACACAAGG - Intergenic
1162311656 19:9911502-9911524 CAGAAAACACACAGCACACAGGG + Intronic
1163216827 19:15885299-15885321 CAGGACACTCCCAGCCCACATGG - Intronic
1163717441 19:18880212-18880234 CTGGACACACCCACCTCACCAGG + Intronic
1164789576 19:30964690-30964712 TTGGAGACACACAGGACCCAAGG + Intergenic
1165262868 19:34635944-34635966 CCGGGCACAAACTGCACACACGG - Intronic
1166257332 19:41615793-41615815 CTAGTCACACACAGCACTCAGGG - Intronic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
1168170687 19:54586676-54586698 GAGGACACAGAGAGCACACAAGG + Intronic
925080854 2:1064780-1064802 CAGAACACACACGGCAAACATGG + Intronic
925256234 2:2491010-2491032 CTGGTCCCTCCCAGCACACATGG + Intergenic
925287958 2:2728215-2728237 CAGGACTCATACACCACACACGG + Intergenic
925750531 2:7086676-7086698 CTGGAAACACACAGCTTACTAGG - Intergenic
927393920 2:22627589-22627611 CTTGACACCCACTCCACACAAGG + Intergenic
927684858 2:25163315-25163337 CTGGACACAGTCAGGACCCATGG - Intronic
928446479 2:31337818-31337840 CTGAACACAGACAGGGCACAGGG + Intronic
929916970 2:46144207-46144229 CTGGACCCACAGAGCCCACGTGG - Intronic
931650819 2:64467304-64467326 CTGGACACACAGAGAACACCAGG + Intergenic
933657687 2:84903195-84903217 CTGGTAACACACAGCCCCCAAGG - Intronic
934317690 2:91940561-91940583 GTGGAAACACACAGGAGACAGGG + Intergenic
934681737 2:96288589-96288611 CAGGATGCACACAGCACACAGGG + Intronic
934861254 2:97765097-97765119 CTGGACACACGGACCACCCACGG + Intronic
935499817 2:103825046-103825068 CTGGAGACAAACAGCAAACTGGG - Intergenic
935596093 2:104879142-104879164 CAGTACACACACAATACACATGG + Intergenic
935795275 2:106634910-106634932 TTGGACACAGACCACACACAGGG + Intergenic
936814768 2:116446107-116446129 CAGGAGACAGACAGCACAAAGGG + Intergenic
936903991 2:117515906-117515928 CTGGACACAAAAAGGAAACAAGG - Intergenic
937362541 2:121239069-121239091 CTGCAGACACACAGGCCACATGG - Intronic
941731056 2:168918348-168918370 CTGGTCACACAGAGGACAAATGG + Intergenic
942045670 2:172097932-172097954 TTGAAGACACACAGCACAGATGG + Intergenic
945201441 2:207285658-207285680 CTGGAATCACACAGATCACATGG + Intergenic
946200218 2:218067277-218067299 CCATATACACACAGCACACATGG + Intronic
947794605 2:232886185-232886207 CATAGCACACACAGCACACATGG - Intronic
947794618 2:232886416-232886438 CAGGGCACACACTGCACACACGG - Intronic
948290339 2:236819718-236819740 CTGGACACTCACGGAACAGATGG - Intergenic
948893906 2:240919480-240919502 CTGGGCACACACAGGACAGGCGG - Intronic
948948874 2:241236227-241236249 CTCGACACTGACTGCACACAAGG + Intronic
949036794 2:241819171-241819193 CAGGACACACACGTGACACAAGG - Intergenic
1169519982 20:6360447-6360469 CTGAATACACACTGCACAGAAGG - Intergenic
1170153349 20:13247856-13247878 TAGGACACACACATCACACTGGG - Intronic
1170204285 20:13781661-13781683 CTGGACACACAGAGCTCCCAGGG - Intronic
1170516465 20:17135364-17135386 CTGGCACCACACTGCACACATGG + Intergenic
1170569601 20:17625367-17625389 CTGGACCCCCACAGCACAATGGG + Intronic
1171216263 20:23354773-23354795 CTGGTCAAACACATCAGACAGGG - Exonic
1171725789 20:28620128-28620150 CTGGACTCACACGTCACAAATGG + Intergenic
1172393195 20:34580563-34580585 CTGGACACCCACAGCAGGCAAGG + Intronic
1172801747 20:37580974-37580996 CTGGACACAAAAGCCACACAAGG - Intergenic
1173056259 20:39616228-39616250 CTGGAAATAAACAGCAAACAGGG - Intergenic
1173190250 20:40870495-40870517 ATACACACACACACCACACATGG - Intergenic
1173253860 20:41379103-41379125 CTGAACACACACCACACAAAAGG - Intergenic
1173382497 20:42558627-42558649 ATGGACTCACACGGCACAGAGGG + Intronic
1173849122 20:46206930-46206952 CTGGACTCTGGCAGCACACATGG + Intronic
1174590209 20:51639280-51639302 AGGGACACACGCAGCACACCTGG + Intronic
1175424768 20:58856255-58856277 CTGCACACACACAGCTCGCCTGG + Intronic
1175549106 20:59805254-59805276 CCAGACACACATAGAACACAAGG + Intronic
1175787075 20:61718430-61718452 CTGGACACACCCAACACAGAAGG + Exonic
1176049739 20:63112379-63112401 ATGCACACACACAGCACTGATGG + Intergenic
1176063702 20:63183295-63183317 GTCCACACACACAGCACATAGGG + Intergenic
1178778509 21:35575927-35575949 TTGAACACACACAGAATACAGGG - Intronic
1179912714 21:44458948-44458970 CGTGACTCACACTGCACACACGG - Exonic
1180090160 21:45529994-45530016 ATGGACACACACCACACACACGG - Intronic
1180305859 22:11124230-11124252 GTGGAAACACACAGGAGACAGGG + Intergenic
1180317091 22:11284840-11284862 GTGCATGCACACAGCACACATGG + Intergenic
1180390689 22:12279735-12279757 CTGGACTCCCACATCACAAATGG + Intergenic
1180409054 22:12585022-12585044 CTGGACTCCCACATCACAAATGG - Intergenic
1180544378 22:16486413-16486435 GTGGAAACACACAGGAGACAGGG + Intergenic
1180744776 22:18079894-18079916 CTGGATCCCCACAACACACAGGG - Exonic
1181048039 22:20225127-20225149 CAGCACACACAATGCACACATGG + Intergenic
1181899587 22:26142160-26142182 GCAGACACACACAGCTCACAAGG + Intergenic
1182103895 22:27675395-27675417 CTGGACAGACGCGGGACACAGGG - Intergenic
1182262675 22:29086358-29086380 CTGTACACACATAGTACATATGG - Intronic
1182518835 22:30873800-30873822 CTGGCCAGACAAAGCCCACATGG + Intronic
1182521797 22:30889038-30889060 CTGTCTACACACAGAACACACGG + Intronic
1182569258 22:31224080-31224102 CTGCATACACAGAGCGCACAAGG + Intronic
1183230833 22:36580852-36580874 ATACACACACACAACACACAGGG + Intronic
1184404268 22:44291385-44291407 CTGCAGCCACACAGCACACAGGG - Intronic
1184865548 22:47199998-47200020 CTGGGCACACACAGTTCACGTGG - Intergenic
1184916613 22:47573630-47573652 ATGCACCCACACATCACACAAGG - Intergenic
1184916615 22:47573754-47573776 ATGCACACACACATCATACAAGG - Intergenic
1184984742 22:48122181-48122203 CATGACACAGAGAGCACACAGGG + Intergenic
1185149778 22:49157636-49157658 CTGGAGACCCACAACACACCCGG - Intergenic
950398426 3:12751918-12751940 CTGGTCACACACAGCACTTTTGG + Intronic
950429541 3:12942998-12943020 CGTGACACACACCACACACAGGG - Intronic
950499975 3:13357612-13357634 CTGGACACACTCAGCACCTTGGG + Intronic
953796298 3:45988532-45988554 CAGGACTCACACACCTCACAGGG + Intronic
954116362 3:48468964-48468986 CAGGACACACACAGCACACATGG + Exonic
954116369 3:48469004-48469026 CTGGACACACACAGCACACATGG + Exonic
954763352 3:52893559-52893581 CTGTTCACACAGAGCACACAGGG + Intronic
955676656 3:61456083-61456105 ATGGATACACACACCACAAACGG - Intergenic
958655146 3:96991817-96991839 CCTTACACACACAACACACATGG + Intronic
958754519 3:98234711-98234733 CTGCACACCCACAGGCCACAGGG - Intergenic
960305113 3:116051311-116051333 CTGGACCCAGCCAGCACAAAAGG + Intronic
961864574 3:129944444-129944466 ATGCACACACACGACACACATGG - Intergenic
962443538 3:135444994-135445016 TTGGACACACAAAGCAAACCAGG - Intergenic
962578013 3:136772327-136772349 CTGGACACAAAGAACACAAAGGG - Intergenic
963360053 3:144260420-144260442 CTGGACACATACACCTCCCATGG - Intergenic
964716054 3:159723026-159723048 CTGGAAGCACTGAGCACACATGG - Intronic
965417759 3:168418244-168418266 CTGGAAGCTCACAGAACACAGGG + Intergenic
967984670 3:195086055-195086077 TTGTACACACAGAGCACACCTGG + Intronic
968666120 4:1823239-1823261 CTTCACACACACAGGACAGAAGG + Intronic
968936478 4:3613202-3613224 CACACCACACACAGCACACATGG + Intergenic
968936481 4:3613288-3613310 CACAACACACACAGCACACATGG + Intergenic
968936485 4:3613376-3613398 CACACCACACACAGCACACATGG + Intergenic
968936487 4:3613420-3613442 CACACCACACACAGCACACATGG + Intergenic
968936489 4:3613464-3613486 CACACCACACACAGCACACATGG + Intergenic
968936491 4:3613508-3613530 CACACCACACACAGCACACATGG + Intergenic
968936493 4:3613552-3613574 CACACCACACACAGCACACATGG + Intergenic
968936495 4:3613596-3613618 CACACCACACACAGCACACACGG + Intergenic
968936497 4:3613640-3613662 CACACCACACACAGCACACACGG + Intergenic
968936499 4:3613684-3613706 CACACCACACACAGCACACACGG + Intergenic
968936501 4:3613728-3613750 CACACCACACACAGCACACACGG + Intergenic
968936503 4:3613772-3613794 CACACCACACACAGCACACACGG + Intergenic
968936505 4:3613816-3613838 CACACCACACACAGCACACACGG + Intergenic
968936507 4:3613860-3613882 CACACCACACACAGCACACACGG + Intergenic
969318904 4:6398925-6398947 ATTGACACACACAGCAACCAGGG + Intronic
969827696 4:9770988-9771010 CTGGAACCACACAGCACTCTGGG + Intergenic
970178483 4:13363214-13363236 CTGAATACACACACCACAGATGG + Intronic
970535382 4:17024827-17024849 CTGGACCTACACAGGACACGTGG - Intergenic
973131923 4:46658480-46658502 CAGGAAACACACAGCAGTCACGG + Intergenic
973705196 4:53573946-53573968 TTGGCCACACACTGCACACAGGG + Exonic
974290676 4:59925858-59925880 CTGGACCCACCCAGCACATGAGG + Intergenic
977751800 4:100618235-100618257 CTGGACACACAAAAGACACCAGG - Intronic
978315006 4:107426054-107426076 TTGGACATACACAGCAAAGATGG + Intergenic
979662251 4:123270506-123270528 CTTGATGCACAAAGCACACAAGG - Intronic
982070381 4:151689064-151689086 CAGGTTACACACAGCAGACACGG - Intronic
982449995 4:155542026-155542048 TTGGACATAGACAGCACACAGGG + Intergenic
983766682 4:171492587-171492609 CTGAACACCAACAGCAGACAAGG - Intergenic
983976545 4:173941477-173941499 CTGGCCATACCCAGAACACAGGG - Intergenic
985619133 5:944481-944503 CTGGAAGCACAGGGCACACAAGG - Intergenic
985674386 5:1223374-1223396 CTGGACACACACAGTGCCCAAGG - Exonic
985878696 5:2620397-2620419 ATGGGCAGACACAGCACAGATGG - Intergenic
986477161 5:8146294-8146316 TTGGACACAGATAACACACAGGG + Intergenic
986689791 5:10304901-10304923 CTGGAATCAGACAGCCCACAGGG + Intronic
988428940 5:31096480-31096502 CTGGAGACAGAGAGGACACATGG - Intergenic
990269268 5:54117251-54117273 TTGGAAACACACAGGACACCTGG + Intronic
990889372 5:60632208-60632230 CAGGCCACTCAGAGCACACAGGG + Intronic
994553004 5:101260810-101260832 CAGGACAGACACAGTATACATGG - Intergenic
995548587 5:113257227-113257249 CTGGACCCACACACCAGACTGGG - Intronic
995717013 5:115090460-115090482 CCAGGCACACACATCACACAGGG + Intergenic
998179472 5:139926384-139926406 CAGTGCACACACAGTACACATGG + Intronic
1000133783 5:158324623-158324645 CTGGACACCTACAGCAAAAAGGG - Intergenic
1000414339 5:160967557-160967579 CTGTACACACTCATCATACAAGG + Intergenic
1001961561 5:175883044-175883066 CAGCACGCACACAACACACAAGG + Exonic
1003138645 6:3454005-3454027 CTTGAAACACACAGAACACTGGG + Intronic
1004840496 6:19578500-19578522 ATGCACACACAGACCACACATGG + Intergenic
1005816826 6:29559788-29559810 CTGGACAAACACAGCAATCCAGG - Exonic
1007338638 6:41173818-41173840 CTTTACACCCACAGCACACTGGG + Intergenic
1012108440 6:95196454-95196476 CTGGAACCACACGGCACATATGG - Intergenic
1012615383 6:101271916-101271938 CTGGACACACACAACCTACTAGG + Intergenic
1015914961 6:138206691-138206713 CTGCTCACACCCAGCACACCTGG - Intronic
1018027163 6:159815560-159815582 CTGGAGGCAGACAGCACTCATGG - Intronic
1018629536 6:165810158-165810180 CTTGAAACACACAGCTCACGGGG - Intronic
1019497566 7:1347590-1347612 CTGGGCACACACTGCCCACCGGG + Intergenic
1020469026 7:8514569-8514591 CATGACACACACAGCACATGGGG - Intronic
1021541812 7:21767999-21768021 CAGTACACACTCAGCACCCAGGG + Intronic
1022289849 7:28990369-28990391 CCTGACACACACAGCACCCAGGG + Intergenic
1023138010 7:37072811-37072833 TTGGACACACAAAATACACATGG + Intronic
1023807561 7:43884423-43884445 CTGGGCTCACACGGAACACAGGG + Intronic
1024319198 7:48048352-48048374 CTGGCCTCACACGGGACACATGG + Intronic
1026255816 7:68710231-68710253 CTGAACAATGACAGCACACAGGG + Intergenic
1028314255 7:89380418-89380440 CTGGACACTTAAAGAACACATGG - Intergenic
1028652282 7:93162780-93162802 CTGGACAGCCACAGCACAGTAGG + Intergenic
1028732927 7:94173662-94173684 CTGCACATACACAGCCCACTTGG - Intergenic
1028927846 7:96379573-96379595 GTGCACACACAGAGCACTCAAGG - Intergenic
1029584259 7:101460195-101460217 CCACACACACACAGCACACCTGG - Intronic
1030356468 7:108548805-108548827 CTGGTCCCACCCAGGACACATGG + Intronic
1032076501 7:128838550-128838572 CTGGACACACACAGCTGCCCCGG - Intronic
1032401324 7:131626327-131626349 CTGCACACTCACAGCACTGACGG - Intergenic
1033062229 7:138120131-138120153 TTGGACACAGACAACACACAGGG + Intergenic
1034285626 7:149881524-149881546 CTGGACACACACGACTCACCAGG - Intergenic
1034299512 7:150002887-150002909 ATGGGCACACACAGGACCCAGGG + Intergenic
1034732806 7:153402794-153402816 CGGGAGACACACAACACACATGG - Intergenic
1034746330 7:153527003-153527025 CAGGACAGAAACAGGACACATGG + Intergenic
1035395241 7:158530653-158530675 CTGCACACATACACCTCACATGG - Intronic
1035524510 8:301760-301782 CTGGACACAGCCATCACACTGGG - Intergenic
1036799161 8:11776954-11776976 CTGGTCAGACACAGCAGCCAGGG - Intronic
1037833589 8:22203135-22203157 TTGGACACACCCAGCAGGCAAGG - Intronic
1038416252 8:27398197-27398219 CTGTACATGCTCAGCACACAAGG - Intronic
1040983827 8:53271836-53271858 CTGGCCAAACACAGCCCACATGG + Intergenic
1041185182 8:55292139-55292161 CTAGACAGACACAGCACAAAAGG - Intronic
1043340204 8:79229194-79229216 CTGGACACATACAGGACTGAGGG - Intergenic
1045007499 8:97929062-97929084 CTGGACTCACCCAGCCCTCAGGG + Intronic
1047185131 8:122626273-122626295 CAGTACACACCCAGCAAACATGG - Intergenic
1047423056 8:124723137-124723159 CTGAGAACACATAGCACACAGGG + Intronic
1049266243 8:141669363-141669385 AGGGAAAGACACAGCACACAGGG + Intergenic
1049530484 8:143152024-143152046 CAGGACACACCCAGCTCACGGGG - Intergenic
1049547936 8:143243270-143243292 CAGAACACACACAGCACATATGG - Intergenic
1049985937 9:951351-951373 CTGGAAACACAGACCAGACATGG + Intronic
1050327949 9:4515865-4515887 CTGGAAACACACAGGACAGAAGG - Intronic
1050653423 9:7798507-7798529 CGTGACACACACAGCAGGCATGG - Exonic
1050855893 9:10354842-10354864 CTAGACACACAAAGCACGTACGG - Intronic
1055642303 9:78329430-78329452 ATGGGAACACACAGCACAGAGGG + Exonic
1056429457 9:86512748-86512770 TTGGACACACACATCACTTAGGG + Intergenic
1058416612 9:104795337-104795359 TTGTCCAAACACAGCACACAAGG - Intronic
1058580757 9:106454009-106454031 TTGGACACACAGAACACACAGGG - Intergenic
1061484012 9:130911349-130911371 CTGGACACACTCAGCACCACTGG + Intronic
1062068477 9:134541491-134541513 TTGGACACACACTGCACGCCAGG + Intergenic
1203775386 EBV:70170-70192 CTGGACACACATGGCACTCATGG - Intergenic
1203406234 Un_KI270538v1:16837-16859 TTGAACACACACATCACAAAGGG - Intergenic
1185722419 X:2393482-2393504 CTGCACACACATGACACACAGGG + Intronic
1185722465 X:2393696-2393718 CTGCGCACACACGACACACAGGG + Intronic
1185722517 X:2393936-2393958 CTGCGCACACACAACACACAGGG + Intronic
1185865442 X:3619846-3619868 CTGGAGAGACACAGTACACCGGG - Intronic
1186342620 X:8660082-8660104 CTTGACACCCACTGAACACAGGG + Intronic
1186830623 X:13386611-13386633 CTGAACAGACACTGCAGACATGG - Intergenic
1189023628 X:37369002-37369024 CTCTACTCACACAGCCCACAAGG + Intronic
1189080917 X:37971888-37971910 CTGCCCGCAAACAGCACACATGG - Intronic
1189472176 X:41322824-41322846 CAGGACACACATAGCACACACGG + Intergenic
1192758000 X:74066349-74066371 CAGGACACACACAGCACGCACGG - Intergenic
1193591154 X:83390270-83390292 CTTGACACACACAGAAGAAAGGG - Intergenic
1196458776 X:115908634-115908656 CTGGACACTAAAAACACACAAGG + Intergenic
1196498701 X:116351800-116351822 CAGGAGAGACAGAGCACACAGGG - Intergenic
1198233866 X:134718105-134718127 CTGGAAACACAAAGCACATGAGG + Intronic
1200042986 X:153383343-153383365 ATGAAAACACACAACACACATGG + Intergenic
1201065492 Y:10091321-10091343 ACGGACACACACACCACACCTGG + Intergenic