ID: 954117016

View in Genome Browser
Species Human (GRCh38)
Location 3:48472654-48472676
Sequence TGCCCAACAGAGGCCCAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 198}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954117009_954117016 -9 Left 954117009 3:48472640-48472662 CCCCCAGCAGCCTCTGCCCAACA 0: 1
1: 0
2: 6
3: 53
4: 464
Right 954117016 3:48472654-48472676 TGCCCAACAGAGGCCCAAGGAGG 0: 1
1: 0
2: 0
3: 22
4: 198
954117006_954117016 27 Left 954117006 3:48472604-48472626 CCAAAAACTCTAGGAGCTTTGTT 0: 1
1: 0
2: 1
3: 20
4: 167
Right 954117016 3:48472654-48472676 TGCCCAACAGAGGCCCAAGGAGG 0: 1
1: 0
2: 0
3: 22
4: 198
954117010_954117016 -10 Left 954117010 3:48472641-48472663 CCCCAGCAGCCTCTGCCCAACAG 0: 1
1: 1
2: 2
3: 56
4: 562
Right 954117016 3:48472654-48472676 TGCCCAACAGAGGCCCAAGGAGG 0: 1
1: 0
2: 0
3: 22
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954117016 Original CRISPR TGCCCAACAGAGGCCCAAGG AGG Intronic
900570644 1:3356648-3356670 TGCCCCAGAGCGGCCCCAGGAGG + Intronic
903334535 1:22616222-22616244 TGGAAATCAGAGGCCCAAGGAGG - Intergenic
903591228 1:24457339-24457361 AGCCCAACAGAGGGCCTGGGAGG + Intronic
904863398 1:33557533-33557555 CACCCAACAGAGGCTCAAGAAGG + Intronic
905910130 1:41647874-41647896 GGCCTCCCAGAGGCCCAAGGAGG - Intronic
906672885 1:47669982-47670004 TGCCAAACAGTGTCCCAAAGTGG + Intergenic
908480296 1:64533041-64533063 TTCCCAACAGAGCCCCAAAGAGG + Intronic
910801675 1:91153420-91153442 TGGTCAACAGTGGCCCCAGGAGG + Intergenic
913165855 1:116183896-116183918 TACCCAATAGATGCCCAGGGAGG - Intergenic
913178747 1:116298798-116298820 TGCCCAACAGATTTCCAAAGTGG + Intergenic
913699746 1:121362751-121362773 GAAGCAACAGAGGCCCAAGGAGG - Intronic
914137795 1:144917285-144917307 GAAGCAACAGAGGCCCAAGGAGG + Intronic
915400629 1:155619196-155619218 TACCCACCAGTGGCCCAAGGTGG - Intergenic
915418154 1:155758202-155758224 TACCCACCAGTGGCCCAAGGTGG - Intronic
918059050 1:181046117-181046139 GGCCGCACAGAGGCCCATGGAGG - Intronic
920487159 1:206381460-206381482 GAAGCAACAGAGGCCCAAGGAGG - Intronic
922221563 1:223612245-223612267 TGCCCCACAGGTTCCCAAGGAGG - Exonic
922482887 1:225951216-225951238 TGCCCAGCAGGGGACCTAGGGGG - Intergenic
922796018 1:228340267-228340289 TTCTGAACTGAGGCCCAAGGGGG - Intronic
923906615 1:238392024-238392046 TTCCCAAAAGAGTCCCAAAGGGG - Intergenic
1064732620 10:18348394-18348416 TGGAATACAGAGGCCCAAGGTGG + Intronic
1064798393 10:19040119-19040141 TGCTCAACAGAGGGCCACAGAGG + Intergenic
1065989584 10:30994529-30994551 TTCTCTACAGAGTCCCAAGGTGG - Intronic
1066653254 10:37679217-37679239 AGACCAAGAAAGGCCCAAGGAGG + Intergenic
1067037611 10:42931756-42931778 AGACCAAGAAAGGCCCAAGGAGG + Intergenic
1069698183 10:70402901-70402923 TGCCCACAACATGCCCAAGGTGG - Intergenic
1069786050 10:70988620-70988642 TACCCAAAAGACACCCAAGGTGG - Intergenic
1069907319 10:71739532-71739554 TGCTCAACAGAGGGCCCACGTGG + Intronic
1070726865 10:78798019-78798041 CTCCCAACAGAGGCCAGAGGAGG + Intergenic
1070794004 10:79206482-79206504 TGCCCCTCAGAGGCCACAGGTGG - Intronic
1072734129 10:97867617-97867639 AGCCCCACAGGGGCCCAGGGAGG - Exonic
1074600445 10:114908344-114908366 TGCTAAACAGAGGCCCAAAGGGG - Intergenic
1074715164 10:116211448-116211470 TGGACAGCAGAGGCCCAGGGAGG + Intronic
1075469856 10:122679967-122679989 TGCCCAACACAGGCCCCACTGGG - Intergenic
1076641961 10:131923517-131923539 TGCCAAACAGTTTCCCAAGGTGG + Intronic
1076676615 10:132150221-132150243 TGCACAGCAGAGGCCCCAGTGGG - Intronic
1076774229 10:132685371-132685393 TGCCCATGTGAGGCCCCAGGTGG - Intronic
1076887319 10:133268657-133268679 TGCCCAGCACGGGCCCATGGTGG - Intronic
1078010448 11:7569501-7569523 TGCCCCACTGAGGCCCCAGAGGG - Intronic
1079138948 11:17794969-17794991 TGCCCAGCAGATGCAGAAGGGGG - Intronic
1079505493 11:21148014-21148036 TGCCCCAGGGAGGCCCAAGAGGG - Intronic
1081554093 11:44141676-44141698 TCTCCAACAAATGCCCAAGGAGG - Intronic
1081738886 11:45424398-45424420 TGACCAATAGAGGCTCAGGGAGG - Intergenic
1082010962 11:47449292-47449314 TGCCTAAGGGACGCCCAAGGGGG - Intergenic
1083298272 11:61726913-61726935 CGCCCCAGAGAGACCCAAGGGGG - Intronic
1083627046 11:64077253-64077275 TGCCCAACAGGTACCCCAGGCGG + Intronic
1083627374 11:64078573-64078595 TGCCCCACAGGGTCCCATGGGGG + Intronic
1085300524 11:75455767-75455789 TGCCCACCAGGGCCCCAAGAAGG + Intronic
1090075530 11:123578130-123578152 TGCCTAAAATAGGCCCCAGGGGG + Intronic
1091110508 11:132962198-132962220 TGTACAACAGAGGGCCAAGGAGG + Intronic
1093478604 12:19582174-19582196 TGCCCAGCAGAGCCCCCAGAAGG - Intronic
1094170499 12:27486253-27486275 TGCCCAGCAGAGTGCCAAAGAGG - Intronic
1096425358 12:51497097-51497119 TGCCAAAAAGAAGGCCAAGGAGG + Exonic
1102535130 12:113575657-113575679 AGGCAAACAGGGGCCCAAGGAGG + Intergenic
1103475117 12:121212167-121212189 TGCCCAAGGGAAGCCCAAGCAGG + Intronic
1103894805 12:124265807-124265829 GTCCCCACAGTGGCCCAAGGAGG + Intronic
1104975144 12:132548843-132548865 GGCCCTGCAGAGGCCCGAGGCGG + Intronic
1107295466 13:38902424-38902446 TGCCTCCCAGAGGTCCAAGGTGG - Intergenic
1108467503 13:50731500-50731522 TGTCCAACAGATTCCCAGGGAGG - Intronic
1110284658 13:73735447-73735469 TGACCACCAGAGCCCCTAGGGGG - Intronic
1112000345 13:95203915-95203937 GGCCCAATACAGACCCAAGGTGG - Intronic
1112750981 13:102583109-102583131 AGGCCAACTGAGTCCCAAGGGGG - Intergenic
1116326895 14:43541231-43541253 TGCCCTACAGCGGGCCAAGCAGG - Intergenic
1118317450 14:64733916-64733938 TGCCAAACATATACCCAAGGTGG + Intronic
1118867995 14:69718314-69718336 TTCCCAGCAGCGGCCCAGGGTGG + Intergenic
1119774952 14:77242557-77242579 TGCCCAACAGAGACTCCAAGGGG + Intronic
1119848110 14:77846087-77846109 TGGCCAAGAGAGGCCCCATGTGG - Intronic
1120772887 14:88400541-88400563 TTCCCAACAGAGGCCACATGTGG + Intronic
1122153570 14:99737585-99737607 TGCCCCAGAGAGGCCCTGGGCGG + Intergenic
1122505583 14:102229824-102229846 TGCCCACTAGAGTCCCACGGGGG + Intronic
1125329130 15:38564979-38565001 TGGCCAAGAGAGGTCGAAGGCGG - Intronic
1125805516 15:42490669-42490691 TGCCCAACTGGGGACGAAGGAGG + Intronic
1125950328 15:43746374-43746396 TGCCACACAGCGGCCCAAGCCGG + Exonic
1126882606 15:53115443-53115465 TGGCCAACGGAGTCCCAAGCAGG - Intergenic
1128656683 15:69467760-69467782 GGCCCAACAGGGGCCCTGGGAGG - Intergenic
1128866495 15:71118522-71118544 TGACCTGGAGAGGCCCAAGGAGG - Intronic
1130948575 15:88567827-88567849 AGGCCACCAGAGGCCCTAGGAGG + Intergenic
1132980532 16:2736763-2736785 AGCCTCCCAGAGGCCCAAGGCGG + Intergenic
1133024724 16:2983624-2983646 GGCCAAAAAGAGGCCCCAGGAGG + Intergenic
1136077116 16:27824818-27824840 TTACCCACAGATGCCCAAGGAGG + Intronic
1138229435 16:55326487-55326509 TGCTCCATAGATGCCCAAGGCGG - Exonic
1140663657 16:77210747-77210769 TTCTCAACAGAGGCCCATGAAGG + Intronic
1141153256 16:81579269-81579291 TGCCCCATGGAGGCCCCAGGAGG - Intronic
1141725564 16:85786184-85786206 AGGGCCACAGAGGCCCAAGGAGG + Intronic
1142128298 16:88420985-88421007 TCTCCAGCAGAGGCCCCAGGAGG + Intergenic
1142424985 16:89997398-89997420 AGGCCGTCAGAGGCCCAAGGAGG + Intergenic
1143725602 17:8843088-8843110 TGCCCAGCAGAGGGACCAGGTGG - Intronic
1143871013 17:9957363-9957385 TGCCCATCAGGGGCCCAACAAGG + Intronic
1144765052 17:17728013-17728035 TGCACAACACATGCCCAAGCTGG - Intronic
1146301314 17:31691790-31691812 TGGCCCAGAGAGGCCCGAGGGGG - Intergenic
1146623612 17:34419416-34419438 GGCCCAGCAGAGGCCCAGAGAGG + Intergenic
1147732751 17:42614190-42614212 TGCCAAAGAGAAGCCAAAGGGGG + Intronic
1148767732 17:50049041-50049063 TCACAAACAGAGGCCCAAAGTGG + Intergenic
1150412449 17:64956601-64956623 GGCCCAACGGAGACACAAGGAGG + Intergenic
1151178536 17:72309101-72309123 TCCCCTACAGTGGCCCAGGGAGG - Intergenic
1151602347 17:75113989-75114011 TGCCCCACAGAGGACCAGAGTGG + Intronic
1151680172 17:75618993-75619015 TGCTCAGCAGAGGGCCTAGGTGG - Intergenic
1151855075 17:76715283-76715305 TGCCCACCACAGAACCAAGGGGG + Exonic
1152307793 17:79531300-79531322 TGCCGCCCAGAGGCCCCAGGTGG + Intergenic
1152431210 17:80249081-80249103 TGCTCTGCAGAGGCCAAAGGAGG - Intronic
1152733151 17:81983381-81983403 TGACCTGCAGAGGCACAAGGCGG - Intronic
1154309977 18:13259888-13259910 GGCCCAATGGAGGCCCCAGGAGG + Intronic
1155022917 18:21912875-21912897 TGCCCCTTAGAGGCCCAAGCTGG + Intergenic
1155719435 18:28992637-28992659 ATCTCATCAGAGGCCCAAGGAGG - Intergenic
1157555234 18:48609178-48609200 AGCCAGACTGAGGCCCAAGGAGG + Intronic
1159262262 18:66029606-66029628 TGGCCAACAGGGGCCTACGGAGG + Intergenic
1159447039 18:68553914-68553936 TGCCCTACTCAGGCCCCAGGAGG - Intergenic
1161280599 19:3443580-3443602 TGCCCTGCAGAGGTCCCAGGAGG - Intronic
1161553556 19:4928005-4928027 TGCCCTACTGAGGTCCCAGGAGG - Intronic
1162792451 19:13070084-13070106 TGCCCACCAGAGGCACAACGTGG - Intronic
1162833374 19:13300596-13300618 TGCCCTACAGAAAGCCAAGGAGG - Exonic
1163421613 19:17216465-17216487 TGCCCAACAGAGGGGCATTGTGG + Intronic
1164713500 19:30375507-30375529 TCCCCAGCAGAGGCGCAAGGAGG - Intronic
1165314467 19:35046180-35046202 TCCCCAAAAGAGGCCCCAGTGGG - Intronic
1165488006 19:36107025-36107047 TGCATGACAGAGGCCCAAGGTGG - Intergenic
1166566154 19:43766884-43766906 GGCCCACCTGAGGCCCCAGGTGG - Exonic
1168340842 19:55622200-55622222 TGCAGAACAGAGGCCCGGGGTGG - Exonic
926314188 2:11697407-11697429 AGCCCCACAGTGGCCCACGGGGG - Intronic
927010288 2:18897035-18897057 TTCCCAAAGGAGGTCCAAGGTGG - Intergenic
927263680 2:21120450-21120472 TGCCCAAAAGCTTCCCAAGGGGG - Intergenic
927648937 2:24899169-24899191 TGACCCACAGAGGCCCAGGGAGG + Intronic
927875698 2:26653836-26653858 TGACAGACAGAGGCCCAAGTAGG + Intergenic
931234886 2:60404919-60404941 TGCCAAAGAGAGACCCCAGGAGG + Intergenic
932722629 2:74148712-74148734 AGCCTAACAGAGGCCCAGGTTGG + Intergenic
932764551 2:74461646-74461668 TGTCCAGCAGGGGCCCAAGGCGG + Exonic
933973507 2:87489451-87489473 TGCCCAACAGAGGCAGGAGCTGG + Intergenic
934524600 2:95043800-95043822 TGCCCAGGAGATGCCCAGGGAGG - Intronic
935082799 2:99814767-99814789 AGCCCAAAGAAGGCCCAAGGTGG + Intronic
936320218 2:111460762-111460784 TGCCCAACAGAGGCAGGAGCTGG - Intergenic
937456011 2:122042346-122042368 TGCCCAACAGAGTGCCATGTCGG + Intergenic
938420950 2:131146277-131146299 TGCCCAACAAAAGCCCAAAAAGG - Intronic
944852572 2:203735005-203735027 GGCCCAACAGGGGCCTGAGGTGG - Exonic
945126090 2:206511599-206511621 TGCCACACAGAGCTCCAAGGAGG - Intronic
945519568 2:210807838-210807860 TTCCAACCAGAGGCCCAAGTAGG + Intergenic
947501820 2:230676458-230676480 TGCCCAACAGGTCACCAAGGAGG + Intergenic
1170588233 20:17751601-17751623 TGCCAAACAGATGCCCAACATGG + Intergenic
1170977513 20:21180486-21180508 TTCCCAACAGAGGCTGAAGTCGG - Intronic
1172176526 20:32975843-32975865 TGGCAAACAGAGGCCCAGAGAGG - Intergenic
1173446348 20:43122317-43122339 TGCCAGACAGAGGACCAAGAGGG - Intronic
1173672178 20:44806286-44806308 TTTCCAACAGATGCCAAAGGGGG - Intronic
1175755803 20:61528962-61528984 TTCCCAACAGAGGCCAAAGCAGG + Intronic
1176022145 20:62967313-62967335 TGCCCAAGAGAGGGCCAGGCGGG - Intronic
1176128326 20:63485779-63485801 GGCCCCACAGAGGCCCAGGATGG + Intergenic
1178300720 21:31450548-31450570 TGACCCACAGAGGCACCAGGGGG + Intronic
1178767222 21:35465858-35465880 TGCCCAACAGAAGGCTAGGGAGG - Intronic
1181431573 22:22884814-22884836 TGACCAGCAGAAGGCCAAGGTGG + Intronic
1183109998 22:35641946-35641968 TGGCCAAGAGAGGCCCAGGTGGG + Intergenic
1184471294 22:44697786-44697808 AGACAAACAGAGGCCCAGGGAGG - Intronic
1184771884 22:46601950-46601972 TGCCCAAGAGCTGCCCAAGAAGG - Intronic
1185169103 22:49282021-49282043 TGCCCAAAAGACCCCTAAGGAGG + Intergenic
1185341016 22:50291156-50291178 TGCCCGCCAGAGCCCCCAGGCGG + Intronic
1185413962 22:50699760-50699782 AGCTCAGCAGAGGCCCAGGGAGG + Intergenic
950264589 3:11564638-11564660 TGCACAACAGAGGCGAAGGGTGG + Intronic
952871574 3:37905599-37905621 TGCCCAGCTGTGGCACAAGGAGG - Intronic
953044467 3:39282240-39282262 TCCTTTACAGAGGCCCAAGGAGG - Intergenic
954117016 3:48472654-48472676 TGCCCAACAGAGGCCCAAGGAGG + Intronic
954426858 3:50447907-50447929 TGCCCCACAGAGGTCTAAGCAGG + Intronic
960846260 3:122006955-122006977 GGACCCACAGAGGGCCAAGGGGG + Intronic
963955892 3:151253437-151253459 GGCCCAACAAAGGCCAGAGGAGG - Intronic
964980559 3:162672312-162672334 TGGCCAACAGAGGCTTAATGGGG - Intergenic
967874461 3:194257495-194257517 TTTCCAACAGAGGCCCATGGAGG - Intergenic
968090600 3:195896104-195896126 CGCCCAACACAGGCCCACGCGGG + Intronic
968654976 4:1774543-1774565 TGCCCAGAAGAGGCTCAGGGTGG + Intergenic
968764559 4:2461510-2461532 TGCCCACCAGCTCCCCAAGGTGG + Intronic
969301255 4:6298830-6298852 GGCCCACCAGAAGGCCAAGGAGG - Intronic
969846455 4:9923796-9923818 GCCCCAACTGAGGCCCAAGGAGG - Intronic
973649120 4:52979990-52980012 TGCACAGCACAGGTCCAAGGGGG + Intronic
977701186 4:100024775-100024797 TGCCCAACAGAGGCCATTGAAGG + Intergenic
978807756 4:112818360-112818382 TGCCCAGCCCAGACCCAAGGAGG - Intronic
980142398 4:128935519-128935541 AGCCAAACTGAGGCCAAAGGAGG - Intronic
983282248 4:165695475-165695497 TTTCCAACAGCGGCCCAAGAGGG - Intergenic
983773451 4:171577863-171577885 TGCCTAAGAGAGGCCCAGGCAGG - Intergenic
986410585 5:7475066-7475088 TTCCCACCAGAGGCCCAGGCAGG - Intronic
990357836 5:54987792-54987814 TGCCAAACAGGTGCCCAAGGTGG + Intronic
992182163 5:74208443-74208465 TTCCCAACACAGACCCAAGAGGG + Intergenic
997625657 5:135329057-135329079 AGCCCAGCAGTGGCCCAAGGTGG + Intronic
998184374 5:139967425-139967447 AGCCCAACAAAGGCCACAGGTGG + Intronic
1001411122 5:171512755-171512777 TGCCCAATGTAGGCCCCAGGAGG - Intergenic
1003127070 6:3363826-3363848 TGCCCAAGAGAGGACCAGGATGG - Intronic
1006116951 6:31780617-31780639 TGCCCACCAGAGGCTCAGGGTGG + Intronic
1006294477 6:33163988-33164010 TGCCCAGCAGAGGCACACGGTGG - Intronic
1006296642 6:33172826-33172848 TCCCCAACAGAGACACAAGGTGG - Intronic
1006732816 6:36248950-36248972 TGCCCTAGAGAGGCCCAATGGGG + Intronic
1009350765 6:62675409-62675431 TACTCAAAAGAGGCACAAGGTGG + Intergenic
1014480046 6:121925087-121925109 TGGCTCACAGAAGCCCAAGGAGG - Intergenic
1015407631 6:132855575-132855597 GGCCCACCAGAAGCCCTAGGAGG + Intergenic
1016713581 6:147200031-147200053 TGACCACCAGTGACCCAAGGAGG - Intergenic
1016866137 6:148769005-148769027 AGGCCAACAGAGGTCCAGGGAGG - Intronic
1017944738 6:159086302-159086324 TTCACAAAAGAGTCCCAAGGTGG - Intergenic
1019124179 6:169828242-169828264 TCCCCCACAGAGGCCCAGGCAGG - Intergenic
1019283071 7:210285-210307 AGGCCACGAGAGGCCCAAGGAGG - Intronic
1020265420 7:6557088-6557110 CGCCCATCAGAGGCCGAAGCAGG + Intergenic
1020796660 7:12685673-12685695 TTACCAACAGAGGCCAAAGGAGG + Intergenic
1022120940 7:27307410-27307432 TTCCTAAGAGAGGCCCAAAGAGG - Intergenic
1023989048 7:45117310-45117332 TGGCAAACTGAGGCCCAGGGAGG + Intergenic
1027220562 7:76211262-76211284 TGCCAGGCAGAGGCACAAGGAGG + Intronic
1027632372 7:80622305-80622327 TGGCCAAGAGAGGCCCAGGTGGG + Intronic
1028172035 7:87609814-87609836 TGGCCAACTGAGGCCCGAGGTGG + Intronic
1029149807 7:98471727-98471749 TGCGAAACTGAGGCCCAGGGAGG + Intergenic
1034942190 7:155237722-155237744 TGAGCTACTGAGGCCCAAGGTGG + Intergenic
1035622882 8:1047681-1047703 TGTCCCACAGAAGGCCAAGGCGG + Intergenic
1036085317 8:5607298-5607320 TGCACAACTGAGGCCTGAGGCGG - Intergenic
1038882797 8:31633478-31633500 TTCCCAAGAGGGTCCCAAGGAGG + Intergenic
1040478168 8:47799225-47799247 TGACCAACAGCTGCGCAAGGAGG - Exonic
1041029210 8:53718874-53718896 TGCACATCAGGGGCCCCAGGTGG + Intronic
1041346967 8:56909649-56909671 TGCCCAACAGTAGCAAAAGGTGG - Intergenic
1048311820 8:133328693-133328715 AGCCAAATAGAGGCCCGAGGAGG - Intergenic
1048863031 8:138737711-138737733 TGCCCCACAGAGGAACAATGTGG + Intronic
1049164147 8:141116321-141116343 TGTCCAGCAGTGGCACAAGGAGG + Intergenic
1049747242 8:144268216-144268238 TGCCCAGCTCAGGTCCAAGGTGG - Exonic
1053157679 9:35791945-35791967 TGCGCCACATAGGACCAAGGGGG - Intergenic
1056262351 9:84861812-84861834 TAACCAACAGATGCCCAAGATGG - Intronic
1057272782 9:93660133-93660155 TGCCAAACTGTGGCCCAAGACGG - Intronic
1057953546 9:99389038-99389060 TGAGGAACAGAGGCCCAAGAAGG + Intergenic
1060799059 9:126532244-126532266 GGCCCAACAGAAGCCACAGGAGG - Intergenic
1061263294 9:129491579-129491601 TGAGAAACAGAGGCCCAAGGAGG + Intergenic
1061670412 9:132185234-132185256 CTTCCAACAGAGGCCCAGGGTGG - Intronic
1062331810 9:136048199-136048221 TTCCCAACAGGGGCCCTGGGTGG + Intronic
1062406227 9:136397883-136397905 AGCCCTGCACAGGCCCAAGGAGG + Intronic
1196899592 X:120369585-120369607 TGCCTGAGAGAGCCCCAAGGAGG + Intronic
1199772843 X:150984726-150984748 TGCCCAACAGAGACCCGCAGCGG - Intronic