ID: 954117395

View in Genome Browser
Species Human (GRCh38)
Location 3:48474740-48474762
Sequence CTTTCAAAGCTGAAAGGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 291}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954117395_954117400 1 Left 954117395 3:48474740-48474762 CCCCCTCCTTTCAGCTTTGAAAG 0: 1
1: 0
2: 0
3: 24
4: 291
Right 954117400 3:48474764-48474786 ACCATGCTGTGTCCTGCTCAAGG 0: 1
1: 1
2: 2
3: 37
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954117395 Original CRISPR CTTTCAAAGCTGAAAGGAGG GGG (reversed) Intronic
900428590 1:2591760-2591782 ATTTCAATGCTGATGGGAGGAGG - Intronic
901025626 1:6277372-6277394 CCTTCAAAGCTGATAGTGGGGGG - Intronic
902682330 1:18052119-18052141 ATTTAAATGCTGAGAGGAGGTGG - Intergenic
905585808 1:39117139-39117161 CTATCACATCTGAAAGGTGGTGG - Intronic
906732265 1:48093136-48093158 GTTTGAATGCTGAATGGAGGTGG + Intergenic
907004051 1:50892485-50892507 CTTAAAGAGCTGAAGGGAGGCGG - Intronic
908033120 1:60022410-60022432 CTTTCAAAGCAGAAAGTACCAGG + Intronic
909858901 1:80578221-80578243 GTTTCAAAACTGAAAGGAAAAGG - Intergenic
910603579 1:89057908-89057930 TTTTCAATGCTGAAACTAGGTGG + Intronic
911176847 1:94825838-94825860 CTTACAAAGAAGACAGGAGGAGG + Intronic
911242575 1:95482036-95482058 CTTTTAAAGCACAAAGGAGTAGG + Intergenic
911744010 1:101419251-101419273 CTTTCAAAGGCCAAAGCAGGTGG + Intergenic
912728470 1:112079867-112079889 CGTTAAGAGCTTAAAGGAGGAGG - Intergenic
915669245 1:157474247-157474269 CTTTCAAAGCTGACCGGGCGTGG + Intergenic
915976666 1:160395492-160395514 CTTTCCAGGCAGAAAGAAGGAGG + Intergenic
917488730 1:175479218-175479240 CTTTCCCATCTCAAAGGAGGGGG - Intronic
917996422 1:180443541-180443563 TTTTCCAGGCTGCAAGGAGGGGG - Intronic
919565013 1:199173901-199173923 CTTGCAAATATGAAAGGAGCAGG - Intergenic
920654923 1:207868107-207868129 GTTGCAAAGCTGGAAGGAAGGGG + Intergenic
920677787 1:208050262-208050284 CATTCATAGCTGAGAGGTGGAGG + Intronic
920678816 1:208057562-208057584 CTTGCAAGGCTTGAAGGAGGTGG - Intronic
922870760 1:228900161-228900183 CTTTGAAAGCAGAAAGAAGATGG - Intergenic
922897086 1:229108854-229108876 CTTCCAAAGCTCTAGGGAGGAGG - Intergenic
923215424 1:231844243-231844265 TTATCAAATCTGAAAGGAAGAGG - Intronic
923285930 1:232495261-232495283 TTTTAAAAGATGAAAGGTGGGGG + Intronic
923467272 1:234260543-234260565 CGTTCAAAACTCAAAGAAGGAGG - Intronic
1063186353 10:3655538-3655560 CTTTCATAGCAGAAAGGGAGAGG + Intergenic
1064633680 10:17342608-17342630 ATTTTAAAGTTGAAAAGAGGAGG + Intronic
1065311115 10:24416754-24416776 CTTGCAAAGCGGAAGGGAGCTGG - Intronic
1068994820 10:63190693-63190715 TTTTCCAAGGTGAAAGGTGGAGG - Intronic
1069125270 10:64623177-64623199 CTTTCAAAACACAAAGGAGAAGG + Intergenic
1069739064 10:70675896-70675918 CTCTCAAAGCTGAAGGGCAGAGG - Intronic
1069773020 10:70911328-70911350 CTGTCACAGCTGCAAGGATGGGG - Intergenic
1070310056 10:75266432-75266454 CATTCAAAGGTGAAAGAGGGAGG - Intergenic
1071325621 10:84513873-84513895 CTTTAAAAGCTGCAAGGACTTGG - Exonic
1071519878 10:86323227-86323249 CTTTCCTAGCTGAAGGGATGTGG + Intronic
1072301434 10:94065945-94065967 CTTTTACAGGTTAAAGGAGGGGG - Intronic
1073083553 10:100874297-100874319 CTTCCTAGGCTGAAAGGAAGAGG + Intergenic
1073665799 10:105532365-105532387 CTTTCAAAGAGTAAAGGAGGGGG + Intergenic
1075349493 10:121710933-121710955 TTTTCAAAGTTGGAGGGAGGGGG + Intergenic
1079678025 11:23256772-23256794 CTTTCAAAACATTAAGGAGGAGG - Intergenic
1080499023 11:32850676-32850698 TTTGCAAATCTGAAAGTAGGGGG + Intronic
1080809332 11:35687400-35687422 CTTTCCTAGCTCAAAGTAGGAGG + Intronic
1081839661 11:46189399-46189421 CTTTCAAAGCTAGAAGCAGAGGG + Intergenic
1082207360 11:49454190-49454212 CTTAAAAAGCTTAAAGGAAGGGG - Intergenic
1084725189 11:70937225-70937247 CTCTCAAAGCTCAAAGGAGATGG + Intronic
1087985909 11:104679219-104679241 GTTACAATGCTGAAAAGAGGAGG + Intergenic
1089921380 11:122212770-122212792 CCTTGAAGGCTGGAAGGAGGAGG + Intergenic
1091337888 11:134786162-134786184 CTCTCAAAGTTGACAGGAAGAGG - Intergenic
1091363090 11:134993728-134993750 GTTTAACAGGTGAAAGGAGGAGG + Intergenic
1091573475 12:1711786-1711808 CTTACACTGCTGAAAGGAGAGGG - Intronic
1093428896 12:19061186-19061208 CTTCCAATGTTGAAAGGAAGTGG - Intergenic
1095851177 12:46808570-46808592 TTTTCAAAGGTGAAAGGCAGAGG - Intronic
1101762182 12:107667881-107667903 TTTTCAAAGATGGAATGAGGAGG + Intergenic
1103651569 12:122436953-122436975 CTTTGGAAGATCAAAGGAGGAGG - Intergenic
1103974227 12:124691728-124691750 CTTTAAAAGGTGAAAGTGGGTGG - Intergenic
1107201840 13:37729858-37729880 CTTCCAAAACTGGAAGGAAGGGG - Intronic
1107418861 13:40226806-40226828 GTTTAAAAACTGAAAGGCGGCGG + Intergenic
1110038469 13:70718480-70718502 CTGTGAAAGCAGCAAGGAGGGGG + Intergenic
1110124781 13:71929201-71929223 CTTTCAAAGCTCAAAGGCATGGG - Intergenic
1110491563 13:76115629-76115651 CTTTCAAAGCTCTGAAGAGGAGG + Intergenic
1110627274 13:77665341-77665363 CTTTAAGAGGTGAGAGGAGGGGG + Intergenic
1110651777 13:77950475-77950497 CCTTCAGAGCTGACAGAAGGAGG + Intergenic
1111336795 13:86836253-86836275 CTTTGAAAGCAGCCAGGAGGGGG - Intergenic
1111524002 13:89443752-89443774 CATTCAAAGGTAAAAGAAGGTGG + Intergenic
1112220549 13:97485617-97485639 CTTTCAAAGCTTAATGGAAAAGG - Intergenic
1112420663 13:99245134-99245156 CTTTCAAAGCTAAAAAAAGAAGG - Intronic
1113829981 13:113288086-113288108 CATTCAATGCAGAAAGGAGGAGG - Intergenic
1114303908 14:21403525-21403547 CTTCCAAAGCTTAAAGCTGGTGG - Exonic
1114510237 14:23252886-23252908 CTTTCGCAGCTAAAAGGAAGTGG + Intronic
1114865881 14:26596345-26596367 CTTTTAAAACGGAAAGGGGGTGG + Intronic
1115171829 14:30517113-30517135 TTTTCAAAGCTGAAACCAGGGGG - Intergenic
1115927769 14:38456199-38456221 GTTTTTAAACTGAAAGGAGGGGG - Intergenic
1119916697 14:78408734-78408756 TTTTCAAAGCAGGAAGGAGAGGG + Intronic
1119949996 14:78735323-78735345 CTTTCATAGGGTAAAGGAGGAGG + Intronic
1120229932 14:81830930-81830952 CTGTCAAAACTGAAAGGAAATGG - Intergenic
1120394856 14:83956078-83956100 TTTTCAGAGCTGACAGAAGGAGG - Intergenic
1122080070 14:99260994-99261016 CTTTCAACGCTGAAAGTGGGAGG - Intronic
1123104712 14:105835351-105835373 CTTTCAAAGGAAAAATGAGGAGG + Intergenic
1124146853 15:27135819-27135841 CACTCAAACCTGGAAGGAGGAGG + Intronic
1124428609 15:29586292-29586314 CTGTCAGGGCTGGAAGGAGGAGG + Intergenic
1125388538 15:39165988-39166010 CATTCAGAGCTGATAGGAAGAGG + Intergenic
1125450301 15:39800755-39800777 CTTTCAGAGCTCACAGGAGCAGG - Exonic
1126662874 15:51049339-51049361 GTTTCAAAGCTGAAAAGGGTGGG + Intergenic
1127799606 15:62466471-62466493 CTGTCACACCTGAAAGGGGGTGG - Intronic
1127805237 15:62513215-62513237 CCTGCAAAGCAGTAAGGAGGGGG - Intronic
1128450853 15:67805170-67805192 CTGTCAGAGCTGCGAGGAGGAGG - Intronic
1129272846 15:74428578-74428600 CTTTCTGGGCAGAAAGGAGGAGG + Intronic
1129912090 15:79236289-79236311 CTCACAAAGCTGAAAACAGGAGG - Intergenic
1129936389 15:79453711-79453733 TTATCAAAACTGAAAGTAGGAGG - Intronic
1130942065 15:88519094-88519116 CTTTCAAAGGTAAAATGATGGGG + Intronic
1131076091 15:89495904-89495926 CTCTCCAAGCTAAAAGGGGGTGG + Intronic
1131114162 15:89784017-89784039 CATCCAAGGCTGAGAGGAGGGGG - Intergenic
1131202803 15:90414511-90414533 CTTTCAATGCTGCAGAGAGGCGG - Intronic
1131348758 15:91677067-91677089 CTGTCAGAGATGAAGGGAGGAGG - Intergenic
1132087766 15:98922141-98922163 CTTGCAGACCTGAAAGGAAGCGG + Exonic
1136563212 16:31053479-31053501 CTTTCTAAACTGAAAGAGGGTGG - Intergenic
1139818321 16:69695893-69695915 CTATCACAGCTGAAGGGAGCTGG - Intronic
1140739137 16:77925847-77925869 CTTTCAAAGCCAGAAGCAGGGGG - Intronic
1141577759 16:84975494-84975516 CTTTAAAAAATGAAAGCAGGAGG + Intronic
1143517896 17:7429176-7429198 CTTCCAGAGCTGAAGGGAGTGGG - Intergenic
1147253567 17:39167748-39167770 CTTTCAATTCTGCAAAGAGGAGG - Intergenic
1149244111 17:54685081-54685103 CTTTTAAAGGAGAAAAGAGGGGG - Intergenic
1149368392 17:55968150-55968172 TTTTCAAAGCTGATAGTTGGTGG - Intergenic
1150736824 17:67747795-67747817 CTTTCATAGCTGAAGGAAGGAGG + Intergenic
1153113658 18:1626799-1626821 TGTTCAAAACAGAAAGGAGGGGG - Intergenic
1153275512 18:3363555-3363577 CTTTCAAAGCAACAAGGAGTTGG - Intergenic
1154488747 18:14902609-14902631 GTTTAACAGGTGAAAGGAGGAGG - Intergenic
1155184881 18:23379036-23379058 CCTCAAGAGCTGAAAGGAGGAGG + Intronic
1156001940 18:32394863-32394885 ATTTCACAGGTGAAAGAAGGAGG - Intronic
1156008015 18:32466605-32466627 CTATCCAAGATGAAATGAGGAGG + Intronic
1157312702 18:46564062-46564084 TTTTGAAGGCTGGAAGGAGGGGG + Intronic
1157807896 18:50672014-50672036 CTCTCCAAGCTGAAACTAGGAGG + Intronic
1158123196 18:54073061-54073083 TTTTCAAATTTGAAAGGAAGGGG - Intergenic
1159449218 18:68578269-68578291 GTTTCAAAGATGGATGGAGGAGG - Intergenic
1163090936 19:15020062-15020084 CTTTGGAAGGTCAAAGGAGGAGG + Intronic
1164549983 19:29202023-29202045 TCTTCAAAGCTAACAGGAGGGGG + Intergenic
1164564913 19:29318810-29318832 CTTGCAAAGGTGGCAGGAGGTGG - Intergenic
1165656146 19:37533908-37533930 CTTACAGAGCTGAAGGGAGAGGG - Intronic
1166833059 19:45649694-45649716 CTTTCAAAGGCCAAAGAAGGGGG + Intergenic
1167128436 19:47568146-47568168 TTTTCAAAGAGGAAAAGAGGTGG - Intergenic
925018774 2:552521-552543 CTTTCAGAGCTGTATAGAGGAGG + Intergenic
925528289 2:4829533-4829555 TTGACAAAGGTGAAAGGAGGGGG - Intergenic
925724506 2:6859917-6859939 CTGTGAAAGCAGCAAGGAGGGGG + Intronic
926163272 2:10502663-10502685 CATTCAGGGCTTAAAGGAGGAGG - Intergenic
926827643 2:16923337-16923359 CTTCCAAAGGTGAAAGGAAATGG - Intergenic
927176896 2:20416144-20416166 CTTTCAAAGCTAAAAGAATGCGG - Intergenic
928345595 2:30491609-30491631 ATTTAAAAGCTTAAAGCAGGTGG + Intronic
929890666 2:45916487-45916509 CTTTGAAAGATCAAAGCAGGAGG - Intronic
931201671 2:60103587-60103609 CTTCCCAAGCTGTAAGGCGGGGG + Intergenic
934703998 2:96463561-96463583 GTATGAAAGCTGAAAGAAGGCGG + Intergenic
934969761 2:98753761-98753783 CCTTCAGAGCTGACAGAAGGAGG - Intergenic
937003830 2:118493082-118493104 CTTTCCAATCTGAAAAGAAGAGG + Intergenic
937126705 2:119479186-119479208 CTTGCAAAGCTTATAGGAGAGGG - Intronic
939901372 2:147854435-147854457 TTTTCAAAGCTTAAAGTAGCTGG - Intronic
940805254 2:158180100-158180122 CTTTCAATGATGAAAGGCAGAGG - Intronic
942314527 2:174685183-174685205 CTTTCAATGATGAAATGAAGGGG - Intergenic
942406841 2:175665230-175665252 TTCTCAATGCTGAGAGGAGGAGG - Intergenic
942779627 2:179626331-179626353 CTTTTAAAGATCAAAGGAGATGG + Intronic
942813460 2:180023682-180023704 TTTGCAAAGGAGAAAGGAGGCGG - Intergenic
944901970 2:204224308-204224330 TTCTCAGAGCTGTAAGGAGGTGG + Intergenic
946185835 2:217979904-217979926 GGTTCAAAGCTGGAAGGGGGTGG - Intronic
946733762 2:222733983-222734005 CTTTCATTGCTGAGAGGGGGTGG + Intergenic
1169198123 20:3694151-3694173 CTTTAAAAGAGGAGAGGAGGTGG - Intronic
1170029343 20:11928795-11928817 CTTTCAAAGCTTGAAGCAGAGGG + Intergenic
1170948918 20:20916626-20916648 CTTTGAAAGGAAAAAGGAGGAGG + Intergenic
1171354068 20:24530136-24530158 CTTACAAAGCTAAAGGGAGTTGG + Intronic
1172706659 20:36887166-36887188 CTTCCAAAGCTGGAGGGAGGAGG - Intronic
1172994413 20:39059440-39059462 CATTCTAAGCTGGAGGGAGGAGG - Intergenic
1173295273 20:41749914-41749936 CTGTCAAAGGTGAGAGTAGGTGG + Intergenic
1174145652 20:48450777-48450799 CTTGCAAAGCTGAGACGATGGGG + Intergenic
1174868849 20:54164741-54164763 CCTTCAATATTGAAAGGAGGTGG - Intronic
1175287078 20:57844186-57844208 CATGGAAAGCTGAAAGGGGGTGG + Intergenic
1175308517 20:57994765-57994787 CTCTCAAAGCTTAAACGGGGGGG + Intergenic
1175785194 20:61707831-61707853 CTTGCTAATCTGACAGGAGGCGG + Intronic
1176063535 20:63182605-63182627 GTTGCAAAGCTGAGAAGAGGAGG - Intergenic
1177299000 21:19215651-19215673 TTGTCAAAGGTGAAAAGAGGGGG + Intergenic
1178819624 21:35963361-35963383 ACATCAAAGCTGCAAGGAGGTGG - Intronic
1178855127 21:36244371-36244393 CTTTCAAAGCCATAAGGATGTGG - Intronic
1179613370 21:42566357-42566379 CTGACAAAGCTGGGAGGAGGTGG - Intronic
1182873182 22:33666542-33666564 CCTACAAAACAGAAAGGAGGTGG + Intronic
1184409300 22:44317403-44317425 CTTTCAAAGGTGGTAGGAAGTGG + Intergenic
1185224116 22:49643392-49643414 CTTGCACAGCTGAAATGGGGAGG + Intronic
950593051 3:13952814-13952836 CCTTCATAGCTGACAGAAGGAGG + Intronic
950994378 3:17479985-17480007 CTTTCAAAGCTGCAGGGACAAGG - Intronic
951903926 3:27684992-27685014 CTATCAAAGCAGAAAAGAGTGGG + Intergenic
953510837 3:43537317-43537339 ATTTCACAGCAAAAAGGAGGTGG - Intronic
954117395 3:48474740-48474762 CTTTCAAAGCTGAAAGGAGGGGG - Intronic
955511812 3:59688629-59688651 CTCTAAAACTTGAAAGGAGGTGG + Intergenic
955985205 3:64566542-64566564 CTTACAAAGCTGAAATGATTAGG - Intronic
956033995 3:65070524-65070546 GTTTCAAAGCTGGAAAGAGATGG - Intergenic
956937102 3:74115448-74115470 ATTTTAAAGCTGAAAGAAAGGGG - Intergenic
958081742 3:88754520-88754542 CTAGCAAAGGAGAAAGGAGGTGG - Intergenic
959483702 3:106903903-106903925 CTTTCATAGCTAAAAGTAGAAGG + Intergenic
959636838 3:108584405-108584427 CCCTCAAAGCTGAAAAGATGAGG + Intronic
960529859 3:118751797-118751819 CTTTAAAAGATGAAAGCAGAAGG + Intergenic
960743974 3:120865874-120865896 CTTTTAAAACTGAAAGAAGGAGG + Intergenic
961690733 3:128667618-128667640 CCTTCATAGCTGACAGAAGGAGG - Intronic
962486332 3:135846294-135846316 CTTTCATAGCTGAAAATATGTGG - Intergenic
965841873 3:172915383-172915405 CTTAAAAAGCTCAAAGGGGGAGG + Intronic
966653064 3:182323154-182323176 CTATGAAAGTTGAAAGGAGGAGG + Intergenic
967614948 3:191553853-191553875 CTTTTAGAGCTGAAATGATGGGG + Intergenic
967662224 3:192126986-192127008 ATTTCAAACCTGAAAGGAGTTGG + Intergenic
968126792 3:196166011-196166033 TTTTCAAAGCAGGAAGAAGGCGG + Intergenic
968670748 4:1849857-1849879 CTTTTAAGTCTGAAAGAAGGCGG + Intronic
970419157 4:15888860-15888882 CAATGGAAGCTGAAAGGAGGTGG + Intergenic
971457644 4:26859759-26859781 CTTTTAAATTTGAAGGGAGGTGG + Intronic
972432501 4:38996530-38996552 CTGTCAAAGCTGAAATGCAGTGG - Intronic
972879554 4:43407025-43407047 CTCTGAAAGCAGCAAGGAGGGGG + Intergenic
972954346 4:44370610-44370632 CTTTCAAAGCAGAAATAAGGAGG + Intronic
974779193 4:66529186-66529208 CTGTAAAAGCAGACAGGAGGAGG + Intergenic
974817533 4:67024526-67024548 CTTTCAAAGCTGAAGGGCAGTGG - Intergenic
975413745 4:74084683-74084705 CCTTCATAGCTGAGAGAAGGAGG - Intergenic
976041678 4:80892908-80892930 CTTCCAAATCAGAAAGGAAGAGG + Intronic
979871690 4:125831055-125831077 TTTTCAAAGGTAAAATGAGGTGG + Intergenic
980592316 4:134906172-134906194 CATTAAAAGCTGAAATGATGGGG + Intergenic
980613386 4:135186123-135186145 CTTTGAGAGCCGAAGGGAGGAGG - Intergenic
981316745 4:143348050-143348072 CTAACAAAGATGAAAAGAGGAGG - Intronic
981496047 4:145394062-145394084 CATTCAATACTAAAAGGAGGTGG + Intergenic
981955115 4:150462279-150462301 CTTTCAAAGCTGAAAAAAATAGG - Intronic
982376069 4:154692321-154692343 CTGTGAAATCTGAAGGGAGGTGG - Intronic
982633543 4:157863965-157863987 CTTGGAAAGAGGAAAGGAGGTGG + Intergenic
986220411 5:5763827-5763849 TTTACAAAGCTGCAGGGAGGAGG - Intergenic
986225422 5:5807463-5807485 TTTTGGAAGCTGGAAGGAGGCGG - Intergenic
987576033 5:19730023-19730045 CATCCAAAGCAGAAAGAAGGTGG - Intronic
987791239 5:22571037-22571059 CTTTGAAGGCTGAGAGAAGGAGG - Intronic
988113943 5:26858420-26858442 CTTTCAAAGCACACAGGAAGTGG + Intergenic
988552555 5:32209916-32209938 CTTTCAGAGGTCAAGGGAGGAGG - Intergenic
988554294 5:32222969-32222991 CTTTCAAAGGTGCAATGAGTGGG - Intergenic
988977152 5:36526816-36526838 GTTTCACAGCTTAAAGGGGGTGG - Intergenic
990339085 5:54804759-54804781 TTTTCAAAGCTGATAGGGGAAGG - Intergenic
990616218 5:57511200-57511222 CTTTGAGTGGTGAAAGGAGGAGG + Intergenic
990757155 5:59086306-59086328 CTGACAGAGCAGAAAGGAGGAGG - Intronic
991979435 5:72215955-72215977 CTGTGAAAAATGAAAGGAGGTGG - Intergenic
993071569 5:83170808-83170830 CACTCACACCTGAAAGGAGGGGG + Intronic
994636007 5:102344914-102344936 CCTTCAAAGCTGACAGAAGGAGG + Intergenic
995210594 5:109533247-109533269 CTTTTAAAGAGGATAGGAGGTGG + Intergenic
995405964 5:111796280-111796302 CCTTAAAAGATGAAAGAAGGAGG - Intronic
995970633 5:117966156-117966178 CTTTCAAAACTGTCAGGAAGGGG + Intergenic
998523871 5:142825052-142825074 CTTTCCAAGCTTGAAGGAGAGGG - Intronic
998566484 5:143220431-143220453 CTTGCAAATATGAAAGGAGCTGG - Intronic
999013576 5:148070987-148071009 CTTTCTGAGCTGCAAGGAGTTGG - Intronic
999130535 5:149279767-149279789 TATTCAAAGCTGCAAGGAGCAGG - Intronic
999280761 5:150364015-150364037 CTTTAAGAGCTGGAAGGATGCGG + Intronic
999313890 5:150571467-150571489 CACTCAAACCTGAAAGGTGGAGG + Intergenic
999777033 5:154819947-154819969 ATGACAAGGCTGAAAGGAGGGGG - Exonic
1000137174 5:158364262-158364284 CTTTTAGAGATGAAGGGAGGAGG - Intergenic
1000250078 5:159485891-159485913 CTCTCAAAGCACTAAGGAGGGGG + Intergenic
1000252826 5:159511409-159511431 CTTTCACAGCAGAAAGTAGAAGG - Intergenic
1000343703 5:160296836-160296858 CTTAAAAAGCTTCAAGGAGGAGG - Intronic
1000496293 5:161989398-161989420 CTATGAAAGCTGCCAGGAGGGGG - Intergenic
1001622482 5:173099988-173100010 CATTCAAACCTGGGAGGAGGAGG - Intronic
1001970328 5:175950146-175950168 CCTTGAAAGGTGGAAGGAGGAGG - Intronic
1002247111 5:177893615-177893637 CCTTGAAAGGTGGAAGGAGGAGG + Intergenic
1002895150 6:1374757-1374779 CTTTCAAAGCTTAAATTTGGGGG - Intergenic
1003755648 6:9116593-9116615 ATTTCAAAACTGCAAGGTGGGGG - Intergenic
1004853019 6:19719819-19719841 CTTTGCACGCTGAAAGGGGGAGG - Intergenic
1004876613 6:19961848-19961870 CTTGTAAACCTGAAAGGAGAGGG - Intergenic
1005083636 6:21981620-21981642 GTTCCAAAGCAGGAAGGAGGAGG - Intergenic
1005083656 6:21981698-21981720 GTCCCAAAGCAGAAAGGAGGAGG - Intergenic
1006486300 6:34345361-34345383 TTTTAAAAGCTGAAGGGAGTCGG + Intronic
1006528091 6:34625672-34625694 ATTTCTAAACTGAAAGAAGGTGG - Intronic
1007515542 6:42407707-42407729 TTTTAAAAGAAGAAAGGAGGGGG - Intronic
1008453160 6:51676174-51676196 TTTTCAAACGTGAAATGAGGTGG - Intronic
1008623088 6:53291065-53291087 CCTTTAAAGCTAAAAGGGGGAGG - Intronic
1010233851 6:73558836-73558858 ATTTCAAGGTTGAAAGGATGTGG - Intergenic
1012030933 6:94061662-94061684 CTTTCAAAGCTGCAATGAAAAGG + Intergenic
1015248524 6:131102615-131102637 CTATCATACCTGAAAAGAGGAGG + Intergenic
1016486669 6:144547306-144547328 CTTTGAAAGATGAAAGGAGATGG - Intronic
1018949705 6:168371124-168371146 CTTTCAAAGATGACAGAAAGGGG - Intergenic
1020214394 7:6178530-6178552 TGTTCAAGGCAGAAAGGAGGAGG - Intronic
1020588239 7:10099918-10099940 CTCTCGAACCTGGAAGGAGGAGG + Intergenic
1023553624 7:41396647-41396669 CTTCCAAAACTGAAAGCAGCAGG - Intergenic
1024919819 7:54545108-54545130 CTTTCCAGGACGAAAGGAGGGGG + Intronic
1026557067 7:71417783-71417805 CTTTCAAAACTGAAAGGACATGG + Intronic
1026966529 7:74443672-74443694 CTCTCAGAGCTTGAAGGAGGGGG - Intergenic
1028650964 7:93150484-93150506 CCTTCAGAGCTGACAGAAGGAGG - Intergenic
1028914114 7:96240081-96240103 CTTGCAAAGCTGGGGGGAGGAGG - Intronic
1028951226 7:96637326-96637348 GTTTCAGAGCTGAAATGAGAAGG - Intronic
1031756182 7:125645871-125645893 CTTTTATATCTGAAAGGAGTCGG + Intergenic
1032364613 7:131287463-131287485 CTTTAAGAGATAAAAGGAGGAGG - Intronic
1032874735 7:136025767-136025789 TTTTCAAAGCTGTAAGAAAGAGG + Intergenic
1033387474 7:140892470-140892492 GTTTCTAAGCTCAAATGAGGGGG - Intronic
1033974433 7:147082619-147082641 CTTTCAAAGCACAGAAGAGGAGG - Intronic
1035150883 7:156871970-156871992 CATTCAAATCGGAAAGGAAGAGG + Intronic
1035216750 7:157373307-157373329 TTTTGAAAGGTGAAAGGAGGAGG + Intronic
1038251343 8:25907819-25907841 CCTTCAAAGCTCAAGGAAGGGGG + Intronic
1038842761 8:31201387-31201409 CTCTGAAAGGTGAAAGGAGGTGG + Intergenic
1041158050 8:55008103-55008125 CTTTCAAAGCTAACAGGTAGAGG - Intergenic
1043561901 8:81502804-81502826 CTTTCACAGCTGAAAAATGGAGG - Intergenic
1045206125 8:100042973-100042995 CTTTCAAGTCAGAATGGAGGAGG - Intronic
1045494504 8:102697003-102697025 CTTTTGAACCTGAAAGGTGGAGG + Intergenic
1046398352 8:113671253-113671275 CTTTGAAAGATGAAGGAAGGAGG - Intergenic
1048786450 8:138055669-138055691 TTGTAGAAGCTGAAAGGAGGAGG - Intergenic
1049539615 8:143202138-143202160 TATTCAAACCTGAAAGGAGGAGG + Intergenic
1050278616 9:4026913-4026935 CTTACACACCTGAGAGGAGGTGG + Intronic
1050908852 9:11040602-11040624 CTTTCTGATCTGACAGGAGGGGG - Intergenic
1051468871 9:17411914-17411936 ATTTCAATGCTGAATGGAGGTGG - Intronic
1051939024 9:22482278-22482300 CTTTAAAAGTTGACAGGAAGGGG - Intergenic
1052155256 9:25179500-25179522 CTTTCACAGCAGAAGGGAGAGGG + Intergenic
1052307950 9:27032232-27032254 TTTTGGAAGCTGAAAGGAGATGG - Intronic
1056097112 9:83266629-83266651 CTTTCAACAATGAAAGGAGGGGG + Intronic
1056870290 9:90271043-90271065 CTTTAAAAGCTGCTAGAAGGTGG + Intergenic
1057244235 9:93440746-93440768 ATATCAAAGCTGAAAGGGGCTGG - Intergenic
1057965609 9:99499759-99499781 CTTTGACAGCTGAAAGAAGAAGG + Intergenic
1058091655 9:100812742-100812764 GCTTCAAAGATGAAGGGAGGCGG + Intergenic
1058505154 9:105659310-105659332 CTTCCAAAACTGAAAGGGGTGGG - Intergenic
1058681034 9:107440422-107440444 CTTTAAAAGAGGAAAGGAGAGGG + Intergenic
1058747139 9:108002793-108002815 CTCTAAAAGCTGAAAGAATGAGG + Intergenic
1059033798 9:110731476-110731498 CTTTCAATACTGAAAAAAGGGGG + Intronic
1059147219 9:111910988-111911010 CTTTCAAAGGTGGAGGCAGGTGG - Intronic
1059527515 9:115006271-115006293 CTTTCAAAGCTGTAAGGGAAAGG - Intergenic
1060009392 9:120030284-120030306 CTCTAGAAGCTGAAAGGGGGAGG - Intergenic
1060116399 9:120944788-120944810 CCTTTAGAGGTGAAAGGAGGAGG + Intergenic
1060608824 9:124941762-124941784 CTTCCTAAGCAGAAAGGAGACGG - Intronic
1060835353 9:126751563-126751585 CTGTGAAAGGAGAAAGGAGGAGG - Intergenic
1061429823 9:130523912-130523934 CTTTCAGAGCTCAGAGTAGGGGG - Intergenic
1062578149 9:137218014-137218036 CCTTCCAACCTGGAAGGAGGAGG + Intergenic
1062663734 9:137655080-137655102 CTTTTGAACCTGAGAGGAGGAGG - Intronic
1186055066 X:5641591-5641613 CCTTCTAAGCTGAAGGCAGGAGG - Intergenic
1188153671 X:26713616-26713638 CCTTCAAAACAGGAAGGAGGAGG - Intergenic
1189161546 X:38814137-38814159 CTTTAAAAGATGGAAGTAGGAGG + Intergenic
1192175387 X:68881803-68881825 CTTTCAAAGCCCAAAGCAGTTGG + Intergenic
1193467273 X:81865398-81865420 CTGTGAAAGCTGCCAGGAGGAGG - Intergenic
1193864293 X:86711002-86711024 CTTTCATGGCTAGAAGGAGGTGG + Intronic
1194018222 X:88652940-88652962 CTTTCAAAGCTGAAAAGAAAAGG + Intergenic
1194443315 X:93959100-93959122 CTTTCCCAGCTGAAATGAGTAGG - Intergenic
1194631385 X:96289466-96289488 TTTTCAGGGCTGAATGGAGGGGG - Intergenic
1195021157 X:100830074-100830096 CTTTTAATGCTGAAAGGAGATGG + Intronic
1195070842 X:101277711-101277733 CTTCCCAACCTGAAAGGAGTGGG + Exonic
1195494862 X:105519354-105519376 CTGTCAAAGCTTCGAGGAGGTGG - Intronic
1195814946 X:108874647-108874669 CTTTCTAAGGAGACAGGAGGAGG - Intergenic
1196193932 X:112820896-112820918 CTTTGAAAGCTGCACAGAGGAGG + Intronic
1198023513 X:132682368-132682390 CCTTCAGATCTGAAAGGAGAAGG + Intronic
1198868788 X:141154301-141154323 GTTTCCAAGCTGGAAGGAGGAGG + Intergenic
1200812020 Y:7495574-7495596 CTTTGGAAGGTGAAAGCAGGAGG + Intergenic