ID: 954127961

View in Genome Browser
Species Human (GRCh38)
Location 3:48543322-48543344
Sequence CAAGAATACAAGCATCCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 256}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954127958_954127961 -3 Left 954127958 3:48543302-48543324 CCTGTAACTTCTGGGGTGGCCAA 0: 1
1: 0
2: 0
3: 8
4: 76
Right 954127961 3:48543322-48543344 CAAGAATACAAGCATCCAGAGGG 0: 1
1: 0
2: 1
3: 26
4: 256
954127955_954127961 4 Left 954127955 3:48543295-48543317 CCTGATACCTGTAACTTCTGGGG 0: 1
1: 0
2: 0
3: 8
4: 94
Right 954127961 3:48543322-48543344 CAAGAATACAAGCATCCAGAGGG 0: 1
1: 0
2: 1
3: 26
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954127961 Original CRISPR CAAGAATACAAGCATCCAGA GGG Intronic
902284924 1:15401509-15401531 CACGAATCCAAGGATCCACATGG - Intergenic
903270998 1:22188197-22188219 CAGGAAGACAAGGATCCAGAAGG - Intergenic
904261921 1:29292442-29292464 CAAGGAAACAGACATCCAGAGGG - Intronic
904926971 1:34057153-34057175 CAAGACTCCAAGCAGCCACAGGG - Intronic
906974319 1:50552979-50553001 CAAGGGTACAGGCATACAGAAGG + Intronic
907658631 1:56371079-56371101 GAAGAATACATGCTTCTAGATGG - Intergenic
907659088 1:56375359-56375381 CAAAAATAGAACCATCCAGCCGG + Intergenic
908508039 1:64825482-64825504 AAAGAATATAAGCATCTAGCAGG - Intronic
908636261 1:66168992-66169014 CAGGATTATCAGCATCCAGAAGG + Intronic
908877826 1:68697875-68697897 CATGAATTCAAGCCTCCAGGAGG + Intergenic
909650245 1:77967063-77967085 GAAGAATACAAAGTTCCAGATGG - Exonic
910350164 1:86287517-86287539 CTAGAATGAAAGCATCAAGAGGG + Intergenic
912901268 1:113652254-113652276 CAAGAATATAAGCCTCATGAAGG + Intronic
914323634 1:146589516-146589538 GAAGGATACAAGCATGCAGGGGG + Intergenic
914826031 1:151138501-151138523 CCAGAATGCAAGGGTCCAGAGGG - Intronic
915091216 1:153427729-153427751 CATGAAAAGAAGCTTCCAGAAGG + Intergenic
915093897 1:153445562-153445584 CATGAAAAGAAGCTTCCAGAAGG - Intergenic
916545338 1:165798761-165798783 AAAGAAAACAATCATGCAGATGG + Intronic
917075377 1:171199381-171199403 CGCCAATACAAGCATCCAGATGG + Exonic
917088856 1:171331675-171331697 CAAGAGTACAAGATCCCAGAAGG + Exonic
917747520 1:178025192-178025214 CAAAAACACAATTATCCAGAAGG + Intergenic
920492733 1:206429988-206430010 CAAAAATACAACCACCCACATGG - Intronic
920719564 1:208374647-208374669 CAAGAACACAGGTCTCCAGAGGG - Intergenic
920858010 1:209678841-209678863 CAGGACTGCAAGCATCTAGAGGG + Intergenic
921533301 1:216311835-216311857 CAACAATACAAGACACCAGAGGG - Intronic
922409998 1:225363656-225363678 CAAGAATTCCAGTATCCACAGGG - Intronic
922453839 1:225758287-225758309 CAGGAAAACAAGCAGCCTGAGGG + Intergenic
923029813 1:230239574-230239596 CCAGAATAAAAGCAGACAGAAGG - Intronic
923825416 1:237494426-237494448 CTAGAATAAAAGCAGACAGAGGG - Intronic
1063282057 10:4640567-4640589 CAATAATACCAGCATACAGTGGG - Intergenic
1067926710 10:50515783-50515805 CAAGAATACAAGGACACAGTTGG + Intronic
1068026725 10:51654889-51654911 CAAGAAGACATGCACCCAGTAGG - Intronic
1070507835 10:77130993-77131015 GAAGAAAACAACCATCCAAAAGG + Intronic
1071277454 10:84068685-84068707 CAAGACTAAAAGCTTCCTGAGGG + Intergenic
1073591043 10:104757937-104757959 CAAGAATACAATCAAAGAGAAGG - Intronic
1074227229 10:111496423-111496445 CAAGAATACAATCTCCCTGAGGG - Intergenic
1074371580 10:112904873-112904895 CAATCATAGAAACATCCAGAAGG + Intergenic
1077049253 11:559399-559421 CATGGATACCAGCACCCAGAAGG + Intronic
1080134568 11:28839739-28839761 CCAAAATACACACATCCAGATGG - Intergenic
1080421111 11:32111303-32111325 AAAGCATTCAAGAATCCAGATGG + Intergenic
1082663334 11:55942716-55942738 TAAGAATACAGGGAACCAGATGG + Intergenic
1083600075 11:63941530-63941552 AAAGAAAAGAAACATCCAGATGG - Intronic
1084229807 11:67743420-67743442 CTAGAATGCAAGCTTCCTGAGGG + Intergenic
1087339200 11:96881156-96881178 TAAGGATACAAGCAACCAAATGG + Intergenic
1087773317 11:102234967-102234989 CAAGAAAACAGTCTTCCAGAGGG + Intergenic
1087992901 11:104768404-104768426 CAAGAATCCAAGTGACCAGAGGG - Intergenic
1088762920 11:112949314-112949336 GAAAATTACAAGCATGCAGAAGG + Intergenic
1089695799 11:120215723-120215745 CAAGAATACCAGCTTCCAGGAGG - Intronic
1090810830 11:130240765-130240787 CTTGAATACAAGTATCCATAAGG + Intronic
1091297459 11:134483799-134483821 CAAGAAGAAAAGTGTCCAGATGG + Intergenic
1092126779 12:6080139-6080161 CAAGAATAGAGGCCCCCAGAGGG - Intronic
1092210677 12:6644434-6644456 CAAGAACACAAGCAGGAAGAGGG - Exonic
1092222003 12:6720375-6720397 CAAGAATACAAGTAGCAAGAAGG + Intergenic
1094086655 12:26600590-26600612 CAAGAATAGAAGCAGCATGATGG - Intronic
1095391208 12:41708768-41708790 CAGGAATAAAAACATGCAGAAGG + Intergenic
1095477962 12:42605156-42605178 GAGGAAACCAAGCATCCAGAGGG - Intergenic
1095508414 12:42923174-42923196 CAAGAGTACAGGCCTTCAGATGG - Intergenic
1095820475 12:46472991-46473013 GAAGAAAACTGGCATCCAGAGGG + Intergenic
1097924571 12:65113005-65113027 CTAGAGTACAAGCTCCCAGAGGG + Intronic
1099017146 12:77357963-77357985 CAAGAATACAACGATCAAGAAGG - Intergenic
1100268066 12:92997464-92997486 AAAGAATACATGCAGACAGAAGG + Intergenic
1102213251 12:111142476-111142498 CAAGGATACAGGCAGACAGACGG - Intronic
1104931158 12:132340157-132340179 CAAGAATACAAAAGTCCAGGAGG + Intergenic
1105658543 13:22467722-22467744 CAAGAACAGGAGCAACCAGAAGG + Intergenic
1108037566 13:46307415-46307437 CAAGAATAAAAGAACCCAGTTGG - Intergenic
1108928321 13:55781413-55781435 TAAGAATACTGGCATACAGAAGG - Intergenic
1110820890 13:79914950-79914972 CAAGGAGACAAGCATAGAGAAGG - Intergenic
1111984332 13:95050390-95050412 AAAGAATACAAGCACCCAGAAGG + Intronic
1114562976 14:23606788-23606810 CAAGAATATAAGCACCTTGAAGG + Intergenic
1117146969 14:52845542-52845564 TAAAAATACAAGCATTCAGCTGG + Intergenic
1120230071 14:81832470-81832492 CTAGAATACAAGATTCAAGAGGG - Intergenic
1120364346 14:83546406-83546428 AAAGAATACAATTATCCAGGTGG - Intergenic
1120969939 14:90198796-90198818 CAAGACTGCAAGACTCCAGAAGG + Intergenic
1123578730 15:21697192-21697214 CCACAATACAAGCAGCCACATGG + Intergenic
1123615357 15:22139674-22139696 CCACAATACAAGCAGCCACATGG + Intergenic
1124006948 15:25802144-25802166 TAAGAAGAAAAGCGTCCAGACGG - Intronic
1124370164 15:29099982-29100004 CCAGAATCCAAAGATCCAGAAGG - Intronic
1124449682 15:29775568-29775590 CAAGAATTCAGGCATCCACTGGG + Intronic
1127114967 15:55717477-55717499 GAAGAATAAAAGCTTTCAGATGG - Intronic
1128774792 15:70311945-70311967 AAGGAAGACAAGCATCTAGAAGG - Intergenic
1128890661 15:71329110-71329132 CAAGCAGACTTGCATCCAGAGGG - Intronic
1130024023 15:80255605-80255627 CCAGAATAAATGCATCCATAGGG + Intergenic
1130876252 15:88017327-88017349 CTAGGATACAAGGATGCAGAAGG + Intronic
1132403758 15:101529980-101530002 CAAAATAAAAAGCATCCAGAAGG - Intergenic
1202987600 15_KI270727v1_random:431437-431459 CCACAATACAAGCAGCCACATGG + Intergenic
1133882349 16:9794748-9794770 AAACAGTAAAAGCATCCAGATGG - Intronic
1135348966 16:21712903-21712925 GTAGAATCCATGCATCCAGAAGG + Intronic
1137000057 16:35221824-35221846 CAGGCATACAAGCGGCCAGAAGG - Intergenic
1137761002 16:50940322-50940344 CAACAAAAGCAGCATCCAGATGG - Intergenic
1137784246 16:51124825-51124847 CAAGAGTATAAGCAACCTGAGGG + Intergenic
1138541200 16:57688864-57688886 CAAGGTTACAGGCAGCCAGAAGG - Exonic
1138866369 16:60825529-60825551 CAAGAAAACAAGCCTCCAGGGGG + Intergenic
1140009929 16:71121333-71121355 GAAGGATACAAGCATGCAGGGGG - Intronic
1140726896 16:77821684-77821706 CAATAATAAAAGCAACCATAAGG + Intronic
1146233507 17:31134768-31134790 CCACATTACAAGCAGCCAGATGG - Intronic
1147811748 17:43175313-43175335 CAAGAATACAAGTTCCCTGAGGG + Intronic
1151371746 17:73651173-73651195 CTAGAATACAAGCAGCTTGAAGG + Intergenic
1151826927 17:76528992-76529014 CGAGAATACGAGAATACAGATGG - Intronic
1153086245 18:1291844-1291866 CAAGAAAACAAACAACAAGAGGG - Intergenic
1155025912 18:21940878-21940900 CAAGAATAAAAGTCTCCAAAGGG + Intergenic
1155977873 18:32151043-32151065 CAAGAAAACAAGCAACAAAATGG - Intronic
1156347360 18:36269761-36269783 GAAAAATACAACCATCCAGGGGG - Exonic
1157507312 18:48237404-48237426 CAACCATAGAAGCATCCAAAGGG + Intronic
1158758030 18:60349925-60349947 CTAGAATTCTATCATCCAGAAGG + Intergenic
1159864702 18:73690367-73690389 CAAGGAGAAAAGCATCCAGGCGG + Intergenic
1162186772 19:8911382-8911404 CAAGAATACAAGCTCACTGAGGG + Intronic
1166627512 19:44372444-44372466 CAAGATGACAAGAATCCACAAGG + Intronic
1167406713 19:49314280-49314302 CAAGAATCCATGAATCCACAGGG + Intronic
925491837 2:4403722-4403744 CAAGAGGACAGGCCTCCAGATGG - Intergenic
927000495 2:18789719-18789741 CAAGAATAAAAGCACACAGAGGG - Intergenic
927036599 2:19184398-19184420 CAAAAAAAAAAGCATTCAGAAGG - Intergenic
927328827 2:21838605-21838627 CAAGACTACAAGCATCATGGGGG - Intergenic
929052326 2:37848371-37848393 CAAGAGCACAAGCATGGAGAGGG - Intergenic
930035120 2:47080379-47080401 AAAGAAGACAAGCACCTAGAAGG - Intronic
930313274 2:49769227-49769249 CACAATTACAAGTATCCAGAAGG - Intergenic
932772014 2:74505736-74505758 CAAGAATAAAAGCGTCCTGCAGG - Exonic
937384717 2:121418450-121418472 CCAAAATTCAAGCATGCAGAGGG + Intronic
937414095 2:121700417-121700439 AAATAATAGAAGCATCCAGAAGG + Intergenic
939701824 2:145401692-145401714 CAAAAATAGAAGCCACCAGATGG + Intergenic
942018774 2:171845243-171845265 CATGAAGACAAGCTGCCAGAGGG - Intronic
943235154 2:185308346-185308368 CATGGATACAAGTATTCAGAAGG + Intergenic
943266133 2:185735541-185735563 CAAGACTTCCAGCATCAAGAGGG - Intergenic
943831079 2:192463061-192463083 CCAGAATAAAAGCAGGCAGAAGG + Intergenic
944265470 2:197720311-197720333 GAAGAATGCAAGCATCAAGGAGG + Intronic
944309137 2:198213577-198213599 CCAGAATTCCAGCAGCCAGAAGG - Intronic
944477458 2:200122058-200122080 CAAGAATAAAAGAATCAACAAGG + Intergenic
945159544 2:206875101-206875123 AAAGACTATAAGCATCCTGAGGG - Intergenic
946580549 2:221123764-221123786 CAACAATGAAAGCAGCCAGAAGG - Intergenic
1173332006 20:42083216-42083238 CAAGAATAACAGCGTCCAAAAGG + Intronic
1174321232 20:49743203-49743225 CAAGAATCCAACAATCCAGAGGG - Intergenic
1174486068 20:50862070-50862092 CAGGAATTCAAGAATCCAGCCGG - Intronic
1175946297 20:62560658-62560680 AAACAAAAAAAGCATCCAGATGG + Intronic
1177594601 21:23221665-23221687 TAAGAATATCACCATCCAGATGG - Intergenic
1178429867 21:32509636-32509658 CTAGAATGCAAGCTTCCTGAGGG - Intronic
1183380971 22:37490330-37490352 CAGGGATACAAGCAAGCAGAAGG + Intergenic
949782057 3:7700959-7700981 ACAGAAAGCAAGCATCCAGAAGG + Intronic
952681862 3:36102975-36102997 CAAGAATACATACAACCACAGGG - Intergenic
953663367 3:44907179-44907201 TATGAGTACAAGTATCCAGAAGG + Exonic
954033826 3:47839592-47839614 TAAGAATATAAGAATCCTGAAGG - Intronic
954127961 3:48543322-48543344 CAAGAATACAAGCATCCAGAGGG + Intronic
954886095 3:53875316-53875338 GAAGAATGAAAGCATCCTGAGGG + Intronic
955134424 3:56201885-56201907 CCAGAAAACAGGCTTCCAGAAGG - Intronic
956524225 3:70139709-70139731 CAAGAATTCAAACACCCAGGGGG - Intergenic
957046373 3:75378266-75378288 CTAGAATACAAGCTCCCTGAGGG + Intergenic
957570706 3:81944893-81944915 CAAGGATACAAGGATCATGAAGG - Intergenic
958098997 3:88984617-88984639 CTAGAATACAAGAAACCATATGG + Intergenic
959545830 3:107595132-107595154 CTAGAACTCAAGCCTCCAGATGG - Intronic
959761193 3:109967312-109967334 CAAGAATACAAGCAATCAAGTGG + Intergenic
961188620 3:124938209-124938231 CAAGAAGGTAAGGATCCAGAAGG + Intronic
961309907 3:125990155-125990177 CAAGAACAAAATCATCCAAAAGG + Intergenic
961857185 3:129883903-129883925 GAAAAATAAAAGCAGCCAGAAGG + Intronic
962450415 3:135510566-135510588 AAAGAATAAAAACATCCAGATGG + Intergenic
962972007 3:140409624-140409646 CAAGACTACAAGTATCACGAAGG + Intronic
963181232 3:142358780-142358802 CAATAATAATAGCATCCTGAAGG + Intronic
963501337 3:146131023-146131045 CAAAATTTCAAGCACCCAGAAGG - Intronic
963729922 3:148961343-148961365 AAAGAATATAACCATCCTGAAGG - Intergenic
964256406 3:154779302-154779324 CTAGAATACAGGCTTCAAGAGGG + Intergenic
964419908 3:156490813-156490835 GAAGAACACAAGTCTCCAGATGG + Intronic
964651319 3:159014834-159014856 CAAGCTCACAAACATCCAGAAGG - Intronic
967314502 3:188138488-188138510 TAAGCATCCAAGCATCCAGATGG - Intergenic
968551602 4:1226298-1226320 CAGGAATGCAATCATCCGGATGG - Intronic
970423982 4:15929664-15929686 CAGGAATCCAAGGACCCAGATGG - Intergenic
970551831 4:17189358-17189380 GAAGAATTCAAGGATCCACAAGG + Intergenic
971360061 4:25929521-25929543 TATGAATACAAGCAACCAGTGGG + Exonic
971718017 4:30205745-30205767 CAAGAACAGAAGCTTCAAGAGGG + Intergenic
971724398 4:30290920-30290942 CAAGAATATAAGTTTCAAGAGGG + Intergenic
972666798 4:41172542-41172564 CTAGATTAGGAGCATCCAGAGGG + Intronic
972704295 4:41526580-41526602 CAAGAATATGAGCATAGAGAGGG - Intronic
972811521 4:42592915-42592937 CAAGACTTCAAACATTCAGATGG + Intronic
974023374 4:56711300-56711322 CAAGCATACACGCACCCAGTTGG - Intergenic
974905151 4:68046075-68046097 CAAGAATGCAAGAATGCAGAAGG + Intergenic
975245302 4:72113703-72113725 CAAGAATACAGGCAACCAAGAGG + Intronic
976621760 4:87135489-87135511 CAAAAATTCAAGGTTCCAGAAGG - Intronic
976804608 4:89032619-89032641 CAAAAATAAAAGCATCAACAAGG - Intronic
977130939 4:93236285-93236307 CAAAAATACAAGCAATCAAAGGG + Intronic
977226513 4:94398288-94398310 CATGAATAAAACCATCCAGATGG - Intergenic
977290104 4:95156140-95156162 CATGAATAAAATCATCGAGAAGG + Exonic
977436546 4:97003755-97003777 CAAGGATAGAATGATCCAGAAGG - Intergenic
978108056 4:104928887-104928909 CAAGAAAACAAACTTCCAAAAGG + Intergenic
979270814 4:118759368-118759390 CAAGATGACAAGCTTTCAGATGG - Intronic
979637124 4:122969243-122969265 AAACAATAAAAGCATCAAGAAGG - Intronic
981257688 4:142682011-142682033 CAAGGATACAAACATCCCAAAGG - Intronic
983973380 4:173901595-173901617 CAAACATACAAGCATTAAGAAGG + Intergenic
985555448 5:555803-555825 CAAGAACACAGGCAGGCAGACGG + Intergenic
986179085 5:5376600-5376622 CAAGAAGACAAGCAGCAAGGTGG + Intergenic
986592632 5:9387113-9387135 GTAGAATATAAGCAGCCAGAAGG - Intronic
987040732 5:14059858-14059880 CTAGAATATAAGCTTCCTGAGGG - Intergenic
989574335 5:42975506-42975528 CAAGTATACAGGCATCCATTGGG + Intergenic
989988623 5:50734178-50734200 CAAGAAGATAAACATCCAAATGG - Intronic
992040558 5:72826488-72826510 CAAGAATACAAGCTCCAAGAGGG + Intronic
992158078 5:73974128-73974150 CAGGAAGACAAGCATTAAGAGGG + Intergenic
992501669 5:77349532-77349554 CATCAATACATGCATCAAGAAGG + Exonic
993426259 5:87768214-87768236 CAAGAGAAAAAGCATCCAGGTGG - Intergenic
993925308 5:93858273-93858295 CAAGAATCCAGACTTCCAGAAGG + Intronic
996297400 5:121937883-121937905 CAAGAATACTGGCATGCATAAGG + Intergenic
996678029 5:126198933-126198955 CAAGAAAAATAGCATCTAGATGG + Intergenic
997643275 5:135463771-135463793 CTAGAATGCAAGCTTCCTGAAGG - Intergenic
997850855 5:137331575-137331597 CATGAATAAAAGCCCCCAGAGGG - Intronic
998056002 5:139077973-139077995 CAAGAAGGCACCCATCCAGAGGG + Intronic
999424497 5:151475569-151475591 CAAGAATACAAAGAGCCAGAGGG - Intronic
1000984817 5:167855532-167855554 CCAGAATATAAGCTCCCAGAAGG + Intronic
1001724081 5:173882077-173882099 CAAGAATAAAAGGATGGAGAGGG + Intergenic
1003969735 6:11287721-11287743 CAAGTGCACAAGCTTCCAGATGG + Intronic
1004709927 6:18160075-18160097 CTAGAATACAAGCAACTTGAGGG - Intronic
1004863339 6:19829186-19829208 CAACAATACTGGCATGCAGAGGG - Intergenic
1006819977 6:36885557-36885579 CAAGAGTAGTAGCTTCCAGAAGG + Intronic
1007260005 6:40556782-40556804 CAAGAAATCAGCCATCCAGAAGG - Intronic
1008051810 6:46907957-46907979 CCAGAATGCAACCATCCAGAAGG + Intronic
1008475961 6:51936057-51936079 CCAGAATACATGCTTCCTGAGGG + Intronic
1008808083 6:55456084-55456106 CACGCATATAAGCTTCCAGATGG + Intronic
1009057479 6:58354640-58354662 CAAGTATGCAAGTATACAGATGG + Intergenic
1009676346 6:66827385-66827407 CTAGAATATAAGCATCAAGAGGG + Intergenic
1009875664 6:69501513-69501535 CAAGAAAACAAGCAACAAAATGG + Intergenic
1010910737 6:81552348-81552370 CAAGAATACAAAGAGCCAGTGGG + Intronic
1010989127 6:82459480-82459502 CCAGAATTCAAGCTTCCTGAGGG + Intergenic
1012832663 6:104225211-104225233 AAAGAATAAAAGCATCCAGCTGG + Intergenic
1013730852 6:113165029-113165051 CAAAAATTCACGGATCCAGATGG + Intergenic
1013770317 6:113621080-113621102 CTAGATCACAAGCTTCCAGAAGG + Intergenic
1013989033 6:116231488-116231510 CCAGAATATAAGCATCCTTAGGG + Intronic
1013996220 6:116311298-116311320 CCAGAATATAAGCATCCTGAGGG + Intronic
1015206856 6:130650202-130650224 CAAGGATACAATCATCCTGAGGG - Intergenic
1016442712 6:144100664-144100686 GAAAAATACAAACATCCAGTAGG - Intergenic
1016511459 6:144847985-144848007 CAATAAGACAATCATTCAGAAGG - Intronic
1016863107 6:148741468-148741490 CTAGAAAACAAGCATCTTGAAGG - Intergenic
1017079583 6:150654845-150654867 TAAGAATATAACCATCCAGGGGG + Intronic
1017097193 6:150814808-150814830 CAAGAATACTTGAACCCAGAAGG - Intronic
1017797268 6:157857179-157857201 GAAGAATACAAGCATCAATAGGG - Intronic
1018008695 6:159648096-159648118 CTAGAATACAAGCTTCTTGAGGG + Intergenic
1018425571 6:163677391-163677413 CTAGAATATAAGCAGGCAGAAGG + Intergenic
1020420949 7:8004474-8004496 CAAGACTAAAAGCCTTCAGAGGG + Intronic
1020485066 7:8711236-8711258 CAAATATACAAACATCTAGAAGG - Intronic
1020874860 7:13679896-13679918 CAATAATACAAAGAGCCAGAGGG + Intergenic
1023449992 7:40273664-40273686 CAAGAATACAAGCAATCAAAAGG + Intronic
1024215642 7:47246097-47246119 CTAGACTACAAGCATCCCCAGGG - Intergenic
1024572024 7:50731090-50731112 CAAGAAGACAATTATGCAGAGGG + Intronic
1025886611 7:65600732-65600754 AAAGAATAGAAACATTCAGAGGG - Intergenic
1026982910 7:74537111-74537133 CAAAAATACAAACATGCAGCTGG + Intronic
1029231239 7:99070680-99070702 CTAGAATGTAAGCATCAAGAAGG + Intronic
1029684207 7:102134460-102134482 CAAGAATACAGGCATCTATTTGG - Intronic
1031855813 7:126921209-126921231 AAAGAATAGAAACATTCAGAGGG + Intronic
1032066272 7:128773932-128773954 AAAAAAAAAAAGCATCCAGAGGG - Intronic
1032327525 7:130944976-130944998 GAAGCATACAATCTTCCAGATGG + Intergenic
1033305820 7:140224627-140224649 CTGGAATACAAGGATACAGAAGG + Intergenic
1033991135 7:147288285-147288307 CAAGAATATAAGCTCCCTGAGGG + Intronic
1034626233 7:152494913-152494935 CAAGAATCCAAGCTCCCAAAGGG + Intergenic
1035534152 8:378423-378445 GAAGAATGCAAGTATCCAGGTGG + Intergenic
1035950604 8:4016472-4016494 CAAGAATGCAAGCTTCCTGGAGG + Intronic
1038771413 8:30485278-30485300 TACGAATATAAGCATCCAGATGG + Intronic
1040524401 8:48206821-48206843 CAGAAATACTGGCATCCAGAAGG + Intergenic
1041827730 8:62116355-62116377 CAAGAAAACAAGCAGCAAAATGG - Intergenic
1042814702 8:72865710-72865732 CAGGAAGACAAGAATACAGAAGG - Intronic
1043502047 8:80867986-80868008 TAAGAACACAAGAATCTAGAGGG - Intronic
1043852787 8:85233749-85233771 CAAGACTACAGGTATGCAGAGGG + Intronic
1043880906 8:85541774-85541796 CAAGATTACAAGCAACCTGAAGG - Intergenic
1044107612 8:88230975-88230997 TAAGAATACTAAGATCCAGAAGG - Intronic
1045515638 8:102858113-102858135 CAAGTATACAACTACCCAGAGGG - Exonic
1045831564 8:106467772-106467794 CAGAAATACAAGAATCCAGTGGG - Intronic
1047325406 8:123831008-123831030 CCAGAATAAAAGCAGGCAGATGG + Intergenic
1047607304 8:126488160-126488182 CAAAAATACAACCATCCCTAGGG - Intergenic
1048925946 8:139271441-139271463 CAAAAAAACAAGCAATCAGAAGG - Intergenic
1050747367 9:8891977-8891999 GAAGAAAACAAGCATTCATAAGG - Intronic
1052375462 9:27713620-27713642 GAAGAAGAGAAGAATCCAGAAGG + Intergenic
1056488025 9:87078338-87078360 CAGGAATATAAGCATCAGGAGGG + Intergenic
1057426891 9:94958556-94958578 CAATAATAAAAAAATCCAGAGGG - Intronic
1057731503 9:97612850-97612872 GAAAAATACAAGTATCCAGCTGG - Intronic
1058749031 9:108020888-108020910 CATGATTACAAGCTTCCAGAGGG - Intergenic
1186702115 X:12102314-12102336 CCAGAATACAATCATACAAAAGG + Intergenic
1187079424 X:15971346-15971368 CAAGAAAAGAAGCAGACAGAGGG + Intergenic
1189507407 X:41625748-41625770 CATGCATACAAGTATCCAAAGGG - Intronic
1189518650 X:41742367-41742389 CAAGGATACAGGCAGTCAGAAGG - Intronic
1191183444 X:57586034-57586056 GAAGAAGACAAGCTTGCAGATGG + Intergenic
1191213934 X:57916364-57916386 GAAGAAGACAAGCTTGCAGATGG - Intergenic
1191758429 X:64620647-64620669 CGAGAATACAAGCAACAAAATGG - Intergenic
1192094445 X:68195900-68195922 CAAGAATCAAAGGATGCAGATGG - Intronic
1192301726 X:69911495-69911517 GAATAAAACAAGCATACAGATGG - Intronic
1192565525 X:72160240-72160262 CCAGAAAACATGAATCCAGATGG + Intergenic
1193635406 X:83944050-83944072 CTATGATACAAGGATCCAGAAGG + Intergenic
1195746398 X:108122878-108122900 CAAGATTACACGCATGCATAGGG + Intronic
1197726811 X:129781899-129781921 CCAGAAGCCAAGCTTCCAGAAGG + Intronic
1197748959 X:129952186-129952208 CTAGAGTAAAAGCTTCCAGAAGG + Intergenic
1199020057 X:142868588-142868610 CAAGAAGACAAGCAGACTGATGG - Intergenic
1199037705 X:143072827-143072849 TGACAATACAATCATCCAGAGGG - Intergenic
1199727679 X:150600808-150600830 CAAGAGTACAAGCAGCAAAAGGG - Intronic
1200304569 X:155011016-155011038 CAAAAATACAAGCAACCAAAGGG + Intronic