ID: 954129775

View in Genome Browser
Species Human (GRCh38)
Location 3:48554494-48554516
Sequence CGTGCCATCACGGTGTCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 32}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954129775_954129784 29 Left 954129775 3:48554494-48554516 CCCTGAGACACCGTGATGGCACG 0: 1
1: 0
2: 0
3: 3
4: 32
Right 954129784 3:48554546-48554568 TCAGTTCCACACTTAGAGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 110
954129775_954129778 -7 Left 954129775 3:48554494-48554516 CCCTGAGACACCGTGATGGCACG 0: 1
1: 0
2: 0
3: 3
4: 32
Right 954129778 3:48554510-48554532 TGGCACGAGCCCCTCAGCTCAGG 0: 1
1: 0
2: 0
3: 15
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954129775 Original CRISPR CGTGCCATCACGGTGTCTCA GGG (reversed) Intronic
910481109 1:87659361-87659383 CGTGTCAGCACCCTGTCTCATGG + Intergenic
915296547 1:154925416-154925438 CCTGCCATCACAGTGTTTCAGGG - Intronic
924817393 1:247454600-247454622 CTTGGCATCACGGTGACTGAAGG - Intergenic
1070897395 10:79996393-79996415 CCTGCCATCAGGGTTTCTCCTGG + Intergenic
1073481511 10:103788909-103788931 GCTGCCATCCCTGTGTCTCAGGG - Intronic
1074986949 10:118667277-118667299 CATGCCATCACGGGAGCTCAGGG + Intergenic
1076379716 10:130016630-130016652 GGTGCCAGCACGGGGTCCCAGGG + Intergenic
1081816860 11:45950232-45950254 CTTGCCTTCATGGTGTCTCTAGG - Exonic
1087086211 11:94221147-94221169 CGTGTCAGCACTGTGTCTCCGGG - Intergenic
1089367153 11:117928003-117928025 CGCCCCATCACCCTGTCTCAGGG + Intronic
1096910162 12:54975410-54975432 AGTGCCATCATTGTGTCTCTTGG - Intronic
1118590180 14:67395272-67395294 GGTGCCACCACGGTGCTTCAGGG - Intronic
1121279448 14:92688449-92688471 CATGCCGTCTCGGTGTCTCAGGG - Exonic
1138078326 16:54064803-54064825 CTTGCCATCACGGGGTGACAGGG + Intronic
1141901990 16:86996959-86996981 CGTGCCACCACTGTGTCAAATGG - Intergenic
1155586069 18:27366910-27366932 CCACCCATTACGGTGTCTCAAGG + Intergenic
1157025119 18:43833243-43833265 CGTGACTTCACTGTGTCTCCGGG + Intergenic
1164714347 19:30380455-30380477 CGTGGCCTCACAGTGTCTCAGGG - Intronic
937362526 2:121238983-121239005 AGAGCCATCACGGTGACCCATGG + Intronic
944281641 2:197904595-197904617 TGTGCCATCACAGAGTGTCATGG + Intronic
950902388 3:16509926-16509948 CATCCCATCAAGGTGTCCCAGGG - Intronic
952969565 3:38642125-38642147 TGTGCCATGACGGTGTTTCCTGG - Intronic
954129775 3:48554494-48554516 CGTGCCATCACGGTGTCTCAGGG - Intronic
970945780 4:21689954-21689976 AGTGACATCAGGATGTCTCAAGG - Intronic
974990342 4:69079183-69079205 CATGCCATCAGGGTGTTTCCTGG + Intronic
979883578 4:125994291-125994313 CTGGCCACCTCGGTGTCTCACGG - Intergenic
981751503 4:148096527-148096549 GGTGAGATCAAGGTGTCTCAAGG + Intronic
988803610 5:34719589-34719611 CGTGCAACCACGGTAACTCAGGG - Intronic
1008793104 6:55263756-55263778 CATGGCACCACTGTGTCTCATGG + Exonic
1011612017 6:89161548-89161570 CCTGCCCTCACCTTGTCTCACGG - Intronic
1018992691 6:168686214-168686236 CGTGCCATTTCGGAGTCTCGGGG - Intergenic
1037492237 8:19407392-19407414 CGTGCCCTCAGGGTGTGGCATGG - Intronic
1039262783 8:35790575-35790597 CTGGCCATCACTCTGTCTCATGG - Exonic
1058957967 9:109966925-109966947 AGTTCCATCACGGTGTTTCTAGG + Intronic
1059819781 9:117958894-117958916 TGTGCTATCAAGGTGACTCATGG - Intergenic
1192011528 X:67278142-67278164 GGTGCCTTCTCTGTGTCTCATGG - Intergenic