ID: 954129776

View in Genome Browser
Species Human (GRCh38)
Location 3:48554495-48554517
Sequence TCGTGCCATCACGGTGTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 37}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954129776_954129778 -8 Left 954129776 3:48554495-48554517 CCTGAGACACCGTGATGGCACGA 0: 1
1: 0
2: 0
3: 2
4: 37
Right 954129778 3:48554510-48554532 TGGCACGAGCCCCTCAGCTCAGG 0: 1
1: 0
2: 0
3: 15
4: 163
954129776_954129784 28 Left 954129776 3:48554495-48554517 CCTGAGACACCGTGATGGCACGA 0: 1
1: 0
2: 0
3: 2
4: 37
Right 954129784 3:48554546-48554568 TCAGTTCCACACTTAGAGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954129776 Original CRISPR TCGTGCCATCACGGTGTCTC AGG (reversed) Intronic
915296549 1:154925417-154925439 ACCTGCCATCACAGTGTTTCAGG - Intronic
918046588 1:180945269-180945291 TTTTGCCCTCACTGTGTCTCTGG + Intronic
1063365801 10:5489646-5489668 TCGTGCCATCACAGTGCATGTGG + Intergenic
1073481512 10:103788910-103788932 TGCTGCCATCCCTGTGTCTCAGG - Intronic
1074765687 10:116698564-116698586 CCGTGCCAGCTCCGTGTCTCGGG - Intronic
1075815487 10:125261535-125261557 TGGTGCCATCCCAGTGGCTCTGG + Intergenic
1076921921 10:133458717-133458739 TCGTGCCCTAAAGGTGCCTCTGG + Intergenic
1080064320 11:27992689-27992711 TGGTGCCAGCACGGTGGCTCAGG + Intergenic
1087086212 11:94221148-94221170 ACGTGTCAGCACTGTGTCTCCGG - Intergenic
1089367152 11:117928002-117928024 TCGCCCCATCACCCTGTCTCAGG + Intronic
1094846146 12:34362242-34362264 TCGTGCCTTCAGGGGGCCTCGGG - Intergenic
1094871483 12:34601493-34601515 TCGTGCCTACAGAGTGTCTCAGG + Intergenic
1101421361 12:104554015-104554037 TCTTGCCATGTTGGTGTCTCTGG + Intronic
1113315852 13:109178196-109178218 TCCTGCCACCACAGTGTCTAAGG + Intronic
1118590181 14:67395273-67395295 TGGTGCCACCACGGTGCTTCAGG - Intronic
1121008881 14:90508334-90508356 TCCTGCCATCACGGCGGCTGGGG - Intergenic
1121279449 14:92688450-92688472 ACATGCCGTCTCGGTGTCTCAGG - Exonic
1133188994 16:4119523-4119545 TGGTGCCAGCACTGTGTGTCAGG + Intergenic
1148105475 17:45116543-45116565 TCGTGCCACCTCTGTGGCTCAGG - Intronic
1157025118 18:43833242-43833264 GCGTGACTTCACTGTGTCTCCGG + Intergenic
1164714348 19:30380456-30380478 ACGTGGCCTCACAGTGTCTCAGG - Intronic
1173886687 20:46465414-46465436 TCCAGCCAGCACGGTGGCTCAGG + Intergenic
950707264 3:14790677-14790699 CCATGCCATCAAGGAGTCTCAGG + Intergenic
952252229 3:31665916-31665938 TGGTCCCATCACCCTGTCTCTGG - Intronic
954129776 3:48554495-48554517 TCGTGCCATCACGGTGTCTCAGG - Intronic
963259325 3:143177175-143177197 GTGTGGCATCACCGTGTCTCAGG + Intergenic
969255876 4:6001439-6001461 TCCTGCAATCACGGTCTCTTGGG + Intergenic
974711240 4:65598524-65598546 TCCTGCCATCAAGGTGTATGTGG + Intronic
975694941 4:77003118-77003140 TCATGCCATCACGCTGTGTGGGG + Intronic
1002956475 6:1870108-1870130 GTCTGCCAGCACGGTGTCTCTGG + Intronic
1006187081 6:32187646-32187668 GTGTGGCATCACCGTGTCTCAGG - Exonic
1007293124 6:40801954-40801976 TGGTGCCATGACGGGGCCTCTGG + Intergenic
1007716602 6:43859717-43859739 TCGGGCCATCCCTGTGTTTCTGG - Intergenic
1008574370 6:52845922-52845944 TCGTGCCATCTTGGTGTGTTTGG - Intronic
1017646971 6:156548206-156548228 TGGTGCCATCATAGTGTTTCAGG - Intergenic
1018992692 6:168686215-168686237 TCGTGCCATTTCGGAGTCTCGGG - Intergenic
1021129435 7:16893457-16893479 TCGTGACATCAATATGTCTCTGG - Intergenic
1026894669 7:74003176-74003198 TCGTGTCATCACAGTGTGGCCGG + Intergenic
1061324934 9:129857982-129858004 TGGTGTCAACACAGTGTCTCTGG - Intronic
1192372827 X:70529247-70529269 TCATGCCATCACCGTGGGTCTGG - Intronic