ID: 954129777

View in Genome Browser
Species Human (GRCh38)
Location 3:48554504-48554526
Sequence CTGAGGGGCTCGTGCCATCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 106}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954129777_954129784 19 Left 954129777 3:48554504-48554526 CCGTGATGGCACGAGCCCCTCAG 0: 1
1: 0
2: 0
3: 17
4: 106
Right 954129784 3:48554546-48554568 TCAGTTCCACACTTAGAGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954129777 Original CRISPR CTGAGGGGCTCGTGCCATCA CGG (reversed) Intronic
900868756 1:5287062-5287084 CTGATGGGCTCCTGCTATTAGGG + Intergenic
903700988 1:25247886-25247908 CTGACGGGCTGGTGCCCACAGGG + Intronic
909394532 1:75155031-75155053 CTGATTGCCTTGTGCCATCAAGG + Intronic
912710957 1:111949452-111949474 CTGAGAGGCTCTTGCCTGCAGGG - Intronic
914943139 1:152040182-152040204 CTGAAGGGCTGGAGCCAGCAAGG + Intronic
915321858 1:155060810-155060832 CTTAGTGCCTCGTGCCAGCAGGG - Exonic
917279492 1:173367653-173367675 CTAAGGAGCTCATGCCATGAAGG + Intergenic
920372817 1:205490207-205490229 CTGTTGGGCTGGTGGCATCAGGG + Intergenic
922726911 1:227926929-227926951 CTGAGGGGCACCTGCCTCCAGGG + Intronic
924497714 1:244606365-244606387 CTGAGGGCCTCCTGTCATGATGG + Intronic
1065302474 10:24335510-24335532 TTCACAGGCTCGTGCCATCATGG - Intronic
1067721118 10:48728400-48728422 CAGAGGAGCTTGGGCCATCAAGG - Intronic
1069990243 10:72310753-72310775 CTGAGGAGCAAGTGCCAGCATGG + Intergenic
1070639065 10:78153302-78153324 CAGAGGGGCTTGGGCCATCTGGG - Intergenic
1077017529 11:403545-403567 CTGAGGGGGTCCTGCCACAATGG - Intronic
1081546993 11:44078651-44078673 CTGAGGGTCTCCTGCCCTAACGG + Intronic
1083768268 11:64852647-64852669 CTGAGGGGGTGATGCCAGCAGGG - Exonic
1083954868 11:65977680-65977702 CTGAGGGGCCTGTGCCAGCTTGG + Intronic
1084155643 11:67311219-67311241 CTCAGGGGCTGGTGCCGGCACGG + Intronic
1092247277 12:6870716-6870738 CTGAGGGGATCTTGGCCTCACGG - Exonic
1097157970 12:57026567-57026589 CTGAGGGGCACAAGCCATCCTGG - Intronic
1100293923 12:93243054-93243076 CTGAGGGGTCCATGCCAGCAGGG - Intergenic
1104588819 12:130068321-130068343 CCGAGGGGCTCGTGGCAGGAGGG + Intergenic
1107822595 13:44299838-44299860 CTCAGAGGCTCCTGCCATCTTGG - Intergenic
1109732337 13:66430602-66430624 GTGAGAGGGTCCTGCCATCAAGG + Intronic
1113666115 13:112143113-112143135 AGCAGGGGCTCCTGCCATCATGG + Intergenic
1121422263 14:93824266-93824288 CTGAGGGCCCCCTGCCTTCAGGG - Intergenic
1123696846 15:22884750-22884772 CTGTGGGGGTGGAGCCATCATGG - Intronic
1127274091 15:57427026-57427048 CTGAGGGGCTGGTGAGAGCAAGG + Intronic
1134769241 16:16791869-16791891 GTGAGGGGTTTGTGCCTTCAAGG + Intergenic
1135197337 16:20405167-20405189 GTGAGGGGCTCCTGCCTTCTAGG - Intergenic
1141506874 16:84483701-84483723 CTGGGGGGCCTCTGCCATCAGGG + Intronic
1141513955 16:84530660-84530682 CTGATGGGCGTATGCCATCAGGG - Intronic
1141908384 16:87042349-87042371 CGGAGGGGCTCACCCCATCATGG - Intergenic
1144668340 17:17117046-17117068 CTGAGGAGCTCTGGGCATCATGG - Intronic
1148047277 17:44751852-44751874 CTGAGGGGCTGCTGCGACCAAGG - Exonic
1152900476 17:82938168-82938190 CTGAGGGGCTTGTGTCCACACGG - Intronic
1153941995 18:9986572-9986594 GTGAGGGTCTCAGGCCATCAGGG + Intergenic
1159798656 18:72870067-72870089 GTGAGGTGCTCGTGCCAGCGCGG + Intergenic
1159870626 18:73756814-73756836 GCGAGGGGCTCGGCCCATCAGGG + Intergenic
1160414621 18:78699642-78699664 CCCAGGTGCTCGTGCCATCGTGG + Intergenic
1161734909 19:5985825-5985847 GTCAGGGGTTCCTGCCATCATGG - Intergenic
1162195281 19:8979932-8979954 CTGAAGTGCTGGTGCCACCAAGG + Exonic
1162271465 19:9619493-9619515 CTGAGGTGATCTTGGCATCAAGG - Exonic
1163838874 19:19593517-19593539 CTGAGGTGTTCCTGACATCAAGG + Intronic
1165321988 19:35091148-35091170 GTGAGGGGGTCGGCCCATCATGG + Intergenic
929118665 2:38465858-38465880 CTGAGGGGCCTGTGCCACCAAGG + Intergenic
931188150 2:59973685-59973707 CTGTGTGGCTTGTGCCATCCTGG + Intergenic
931658292 2:64530504-64530526 CAGAAGGGTTCCTGCCATCATGG - Intronic
931721555 2:65070801-65070823 CTGAGGAGCTGGTGCTATGAGGG + Intronic
935389575 2:102536272-102536294 CTGAGATGCTGGTGCCATTAAGG + Intergenic
937433738 2:121862786-121862808 CTGAGAGGCTCTTGGCATCATGG - Intergenic
937886583 2:126903282-126903304 CTGGGGAGCTGGTGCCATCCAGG + Intergenic
946156209 2:217808319-217808341 CTGAGGGGCTCTCCCCATCATGG + Intronic
948482457 2:238258800-238258822 CTGTGGTGCTCGTGCCCACAGGG - Intronic
948930064 2:241126331-241126353 CTGATGGGCACGTGTCCTCAGGG + Exonic
1168861083 20:1046446-1046468 CTGAGGGGCTGGGCCCATCCAGG + Intergenic
1171293153 20:23994096-23994118 CTGAGGGGCTCATGCCAGAGCGG + Intergenic
1175414977 20:58795155-58795177 CTGAGGGTCTTGGGCCATCCCGG + Intergenic
1175489354 20:59368966-59368988 GAGAGGGGCTGGTGCCACCATGG + Intergenic
1175916196 20:62427154-62427176 CTGAGGGGCTTGGGGCATCAGGG - Intronic
1175979309 20:62729054-62729076 CTGAGGGGCTCGTGCCCTGCAGG + Intronic
1175994701 20:62806876-62806898 CTGAAGGGCTTGGGGCATCAAGG + Intronic
1179271132 21:39851837-39851859 CAGAGAGGATGGTGCCATCATGG + Intergenic
1179902552 21:44401584-44401606 CTGAGGGGCACGGGGGATCACGG + Intronic
1180705411 22:17807008-17807030 TTGAGGTGGTGGTGCCATCAAGG - Intronic
1180824211 22:18851812-18851834 CTGAGGGGCTCGTGCCAGAGCGG + Intronic
1181124639 22:20694966-20694988 CTGAGGGGCTCGTGCCAGAGCGG + Intergenic
1181188525 22:21122736-21122758 CTGAGGGGCTCGTGCCAGAGCGG - Intergenic
1181210675 22:21287757-21287779 CTGAGGGGCTCATGCCAGAGCGG + Intergenic
1181398834 22:22639131-22639153 CTGAGGGGCTCGTGCCAGAGCGG - Intergenic
1181501567 22:23318483-23318505 CTGAGGGGCTCGTGCCAGAGCGG - Intergenic
1181650587 22:24256928-24256950 CTGAGGGGCTCGTGCCAGAGCGG + Intergenic
1181706794 22:24653810-24653832 CTGAGGGGCTCATGCCAGAGCGG - Intergenic
1182485520 22:30636474-30636496 CTGAGGTCATCCTGCCATCATGG - Exonic
1183536049 22:38402004-38402026 CTGAGGGGCTCGGGCTCTCCGGG + Intergenic
1184105378 22:42364682-42364704 CTGATGGGCTTATGACATCATGG - Intergenic
1184723669 22:46330575-46330597 CTGAGGGACTGGGGCCAGCACGG + Exonic
1184951034 22:47842721-47842743 GTGAGGGGCTCCTGCAAACATGG + Intergenic
1203216272 22_KI270731v1_random:7673-7695 CTGAGGGGCTCGTGCCAGAGCGG - Intergenic
1203274348 22_KI270734v1_random:77716-77738 CTGAGGGGCTCGTGCCAGAGCGG + Intergenic
952996409 3:38887286-38887308 TGAAGGGGCTGGTGCCATCATGG - Intronic
953848886 3:46450162-46450184 CAGAGGGACTTGTGCCATCTCGG + Intronic
954071190 3:48143998-48144020 CTGTGGGGCTCTTTCCATCGGGG + Intergenic
954129777 3:48554504-48554526 CTGAGGGGCTCGTGCCATCACGG - Intronic
954788034 3:53109258-53109280 GAGAGGGGCTCCTGCCCTCAGGG - Intronic
957923020 3:86771980-86772002 CAGAGGGGCTCGAGGCAGCAGGG - Intergenic
965627752 3:170698761-170698783 CTGAGGGGTTCTAGCCCTCAAGG - Intronic
967083241 3:186070268-186070290 CTGAGCGGCACATGCCATCTCGG - Intronic
969055778 4:4401756-4401778 CTGAGGTGCTTTGGCCATCATGG + Intronic
975260395 4:72290953-72290975 CAGAGCGGTTGGTGCCATCAAGG + Exonic
976922708 4:90457946-90457968 CAGAGGGGCTCGAGACAGCAGGG + Intronic
984575806 4:181446842-181446864 CTGAGGGTCAGGTGCCATCCAGG - Intergenic
985515748 5:343814-343836 CTGAGGGGCCCGGGGCATCGCGG + Intronic
988649436 5:33131929-33131951 CTGAGGGGGTGGGGCCCTCATGG + Intergenic
990344392 5:54857100-54857122 CTGAGGCGATCTTGGCATCAAGG + Intergenic
995396309 5:111690747-111690769 CTTAGGTGCTTTTGCCATCATGG - Intronic
999893812 5:156007160-156007182 CTGGGGGGCTCCTGCCAGCCAGG - Intronic
1000985024 5:167856805-167856827 CTGAGCGGCTCTTGTCAGCAAGG - Intronic
1002043056 5:176528350-176528372 CTGAGGGGCTTGGGCCATACGGG - Exonic
1003033582 6:2623609-2623631 CTGAGGGGTTGGTGCCGACAAGG + Exonic
1006283277 6:33073471-33073493 CCGAGGAGCTGGGGCCATCAAGG - Exonic
1007590720 6:43019182-43019204 CTGAATTGCTCCTGCCATCAAGG + Intronic
1012982225 6:105842915-105842937 CTCTGGGGCGCCTGCCATCATGG - Intergenic
1017496894 6:154991396-154991418 CTGAGGGACACGTGCCAGCAAGG + Intronic
1020244795 7:6421984-6422006 CAGAGCTGGTCGTGCCATCAGGG - Intronic
1022319784 7:29277787-29277809 CTGAGAGGCTGATGCCATCATGG - Intronic
1023965656 7:44962033-44962055 CTGAGGGCCTGGTGCCATGAGGG + Intergenic
1024716132 7:52081520-52081542 CTGAGGGGCCCTGGCCACCAGGG + Intergenic
1034957274 7:155342733-155342755 CTGAGGGGTGGGTGCCAGCATGG - Intergenic
1045029005 8:98117398-98117420 GTGAGGGGCTGGTGCCTTCCAGG + Intronic
1049002953 8:139837753-139837775 CCGAGGGGCTCCTGGCATCTGGG - Intronic
1049500944 8:142965496-142965518 ATGAGGGTCTCTTGCAATCAGGG - Intergenic
1055031322 9:71773555-71773577 GTGAGGGGTTAGGGCCATCAGGG - Intronic
1058110447 9:101027001-101027023 CTGAGGGGAACGTGACAACAAGG + Intergenic
1058193059 9:101941537-101941559 CTGAGGGGGTGGAGCCAACATGG - Intergenic
1059279541 9:113120587-113120609 CTGGGGGGCTCGTGGAAACACGG + Intergenic
1059516964 9:114904976-114904998 TTAAGGGGCTCTTGCCATCTGGG + Intronic
1059544709 9:115164698-115164720 CTGAGGGGCTTAGCCCATCAAGG + Intronic
1061944589 9:133901644-133901666 CTGAGGGGCTCCTGCCGGCCCGG + Intronic
1193936373 X:87627090-87627112 TAAAGGGGCTGGTGCCATCATGG + Intronic
1196033539 X:111117797-111117819 CTGAGGGGCTCTTACCCTCATGG + Intronic
1196167623 X:112552695-112552717 CTGAGGGACTCCTGCCACCCTGG + Intergenic
1199776355 X:151015343-151015365 CTGAGAGGCTCCTGCCTTCCAGG - Intergenic