ID: 954129781

View in Genome Browser
Species Human (GRCh38)
Location 3:48554521-48554543
Sequence TGTGGCTCTGGCCTGAGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 522
Summary {0: 1, 1: 1, 2: 6, 3: 49, 4: 465}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954129781_954129787 25 Left 954129781 3:48554521-48554543 CCTCAGCTCAGGCCAGAGCCACA 0: 1
1: 1
2: 6
3: 49
4: 465
Right 954129787 3:48554569-48554591 AGAAACACAAGCCCTGCCTCAGG 0: 1
1: 0
2: 2
3: 49
4: 276
954129781_954129784 2 Left 954129781 3:48554521-48554543 CCTCAGCTCAGGCCAGAGCCACA 0: 1
1: 1
2: 6
3: 49
4: 465
Right 954129784 3:48554546-48554568 TCAGTTCCACACTTAGAGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954129781 Original CRISPR TGTGGCTCTGGCCTGAGCTG AGG (reversed) Intronic
900149499 1:1171903-1171925 TGTCCCTGGGGCCTGAGCTGTGG - Intergenic
900196379 1:1378059-1378081 TCAGGCTCTGCCCTGAGCTGAGG - Intergenic
900372170 1:2336930-2336952 TGTGGCTCTGGCCAGGGCAGCGG + Intronic
900417957 1:2543639-2543661 TGTGGCTCCTGCGTGAGGTGGGG + Intergenic
900911504 1:5599907-5599929 TGTGGCTTTGGCAAGACCTGAGG - Intergenic
901629400 1:10640923-10640945 TGTGCCTCTGGCAGGAGCTGGGG - Intronic
901815016 1:11788941-11788963 GGTGGGCCTGGCCTGAGCTGGGG - Exonic
902379035 1:16044014-16044036 TGCCTCTGTGGCCTGAGCTGGGG + Intronic
902870309 1:19310288-19310310 TGTGCCTCAGGCCTGGCCTGAGG + Intronic
902992249 1:20196453-20196475 TGAGGCCCAGGCCTCAGCTGGGG - Intergenic
903449353 1:23442401-23442423 TGTGGCCAGGACCTGAGCTGAGG + Intronic
905017314 1:34786489-34786511 TGTGGCTGTGGCTGCAGCTGGGG + Intronic
905172019 1:36115109-36115131 AGGGGCTCCGGCCTCAGCTGGGG + Intronic
905809164 1:40899354-40899376 GGAGGCTCTGGCCTGAGAAGAGG - Intergenic
906034428 1:42741501-42741523 TGCAGCTCTGGCCAGAGATGGGG + Intergenic
907238603 1:53068205-53068227 CTTGGCTCTGGCCTCAGCTCTGG - Intronic
908562362 1:65319429-65319451 TGTGGCTCTGGGCTGAGTCCAGG + Intronic
909179099 1:72397987-72398009 TATGGTTCTGGATTGAGCTGTGG - Intergenic
909759595 1:79271289-79271311 GGAGGCTCTGCCCTGAGATGAGG - Intergenic
910273250 1:85420028-85420050 TGGAGCTGTGGTCTGAGCTGCGG + Intronic
910397774 1:86808951-86808973 TGTACTTCTGGGCTGAGCTGAGG - Intergenic
911298713 1:96148652-96148674 TGTACTTCTGGGCTGAGCTGAGG + Intergenic
914329193 1:146650059-146650081 CATGGCTCTGGGCTGACCTGGGG + Intergenic
915510159 1:156382569-156382591 TGTGGGCCTGGCTTGAGCAGTGG + Intronic
915725379 1:158013651-158013673 TGTGGCTCTGGTCACTGCTGTGG - Intronic
915893726 1:159794856-159794878 TGTCTCTCTGGCCTGCCCTGAGG - Intergenic
917468821 1:175308310-175308332 TGTGGGGCTGGCCTCAGATGTGG + Intergenic
918750413 1:188262908-188262930 TGTACTTCTGGGCTGAGCTGAGG - Intergenic
919453597 1:197799179-197799201 TGAGCTGCTGGCCTGAGCTGGGG + Intergenic
920398920 1:205665099-205665121 TTTGGCTCTGGAGTGTGCTGAGG - Intronic
920944107 1:210512198-210512220 TCTGGGTCTGCCCTGAGCAGGGG - Intronic
922587592 1:226746811-226746833 TGTTGCTCGTGCCTGAGTTGGGG - Intergenic
922612462 1:226940442-226940464 TCTGGCTGCGGCCAGAGCTGGGG + Intronic
922707247 1:227795889-227795911 TGGGGCTCTGGTCTGAGGGGGGG + Intergenic
923085065 1:230696880-230696902 TGTGGCTCTGGCCCCAGTTTGGG + Intergenic
924920908 1:248628142-248628164 TTTGGCTCTGGCCTCAGTTCTGG - Intergenic
1062958210 10:1554053-1554075 TCTGTCTCTGCCCTGGGCTGTGG - Intronic
1063100500 10:2945717-2945739 CGGGGCTCTGGCATGAGCTTGGG + Intergenic
1064603813 10:17018026-17018048 TGTACTTCTGGGCTGAGCTGAGG - Intronic
1067497487 10:46773654-46773676 TGGGGCTCTGGCAGGAGTTGGGG + Intergenic
1067509251 10:46881735-46881757 AGTGGCTCTGGGCAGGGCTGGGG + Intergenic
1067521342 10:47009020-47009042 TTTGGCTCTGTCCAGAGCTTAGG - Intergenic
1067597165 10:47566761-47566783 TGGGGCTCTGGCAGGAGTTGGGG - Intergenic
1067653001 10:48170120-48170142 AGTGGCTCTGGGCAGGGCTGGGG - Intronic
1068248757 10:54408808-54408830 TGTGGTTCTGGTGTTAGCTGTGG + Intronic
1069567750 10:69474825-69474847 GCTGGCAGTGGCCTGAGCTGGGG + Intronic
1069643086 10:69968992-69969014 TGTGTCACAGGCCTGTGCTGAGG - Intergenic
1070140516 10:73734372-73734394 TGGGGCTCTGGCAGGAGTTGGGG - Intergenic
1070178775 10:73995476-73995498 TGGGGTTCTGGCTTGAGCTCTGG + Intergenic
1070272956 10:74975831-74975853 TGGGGCTCTGACCGGAGATGGGG - Exonic
1071857116 10:89636831-89636853 TGTGGCTCAGGCCACAGCTTTGG - Intronic
1074334287 10:112553629-112553651 TTTGGCTCTGCCCTGCCCTGGGG + Intronic
1074742880 10:116501601-116501623 TGTACTTCTGGGCTGAGCTGAGG - Intergenic
1075175911 10:120160874-120160896 TGACCCTCTGGGCTGAGCTGGGG - Intergenic
1075444341 10:122503384-122503406 TCTGGCTTTGGAATGAGCTGAGG + Intronic
1075480529 10:122777761-122777783 GGTGGCTCTGGCCGGTGCTCAGG + Intergenic
1075481740 10:122788231-122788253 GGTGGCTCTGGCCAGTGCTCAGG + Intergenic
1075744586 10:124717923-124717945 TGTGTCTGTAGCCTGGGCTGGGG - Intronic
1075898230 10:126016792-126016814 CTTGGCTCTGGCCTGAGATGGGG + Exonic
1075903760 10:126063609-126063631 GGGGTCTCTGGCCTGGGCTGAGG + Intronic
1076064108 10:127435083-127435105 TGTGGCTCTGGCATTAGCTCAGG + Intronic
1076143129 10:128095607-128095629 TGTGGGACTTGCCTGAGATGGGG + Intergenic
1077153556 11:1081848-1081870 TGGGGTTCTCGCCTGCGCTGAGG + Intergenic
1077216999 11:1399106-1399128 TGTGGCTCTGGCCTGGGGCGGGG - Intronic
1077249757 11:1555738-1555760 TGGGGCTCTGGCAGGAGTTGGGG + Exonic
1077466033 11:2734208-2734230 TCTGCCTCTGGCCTGTGCTTTGG - Intronic
1077496270 11:2887984-2888006 TGTGTCCCTGGCTTGGGCTGGGG - Exonic
1077584353 11:3439402-3439424 TGTGGCTCTGGCCTGGCCAGAGG + Intergenic
1078017933 11:7631196-7631218 TGAGGCTCTGGCCTGTGCTCTGG + Intronic
1078827875 11:14948718-14948740 TATAGCTCTGGCCTGAGCGTTGG + Intronic
1079348598 11:19674083-19674105 AGTGCCTCTGGCCTGGGTTGTGG + Intronic
1080013683 11:27483090-27483112 TGTGGGTCTGGCCCCAGGTGAGG + Intergenic
1081145766 11:39561508-39561530 TGTACTTCTGGGCTGAGCTGAGG + Intergenic
1081343696 11:41956921-41956943 TGTACTGCTGGCCTGAGCTGGGG - Intergenic
1081730831 11:45370556-45370578 TCTGGCTCTGGGCTGAGCTTTGG + Intergenic
1081867351 11:46367027-46367049 TGTGGGTCTGGCCTGGGCATGGG + Intronic
1082944184 11:58740647-58740669 TGGGGCTCTGGCAGCAGCTGTGG - Intergenic
1083002674 11:59309879-59309901 TTTGGCTCTGCCTTCAGCTGAGG + Intergenic
1083571152 11:63762985-63763007 TCTGGCTCTGGCCCTGGCTGGGG - Exonic
1083820939 11:65171089-65171111 TGTTACTCTGGCCTGTCCTGGGG + Intronic
1084179312 11:67438608-67438630 TGTGGCCCTGGCCTGCTGTGTGG - Intronic
1084241258 11:67822053-67822075 TGTGGCTCTGGCCTGGCCAGAGG + Intergenic
1084277473 11:68061560-68061582 GGTGGCTCCTGCCTGTGCTGTGG - Intronic
1084483753 11:69436440-69436462 TCTGGCCCTGCCCTTAGCTGTGG - Intergenic
1084831186 11:71770580-71770602 TGTGGCTCTGGCCTGGCCAGAGG - Intergenic
1084889331 11:72228953-72228975 TCTGCCTCTGGGCTGAGGTGGGG - Intronic
1084940290 11:72608835-72608857 TCGGGCTCTGGACTAAGCTGGGG - Intronic
1085193386 11:74649025-74649047 TCTGGCTCTTGCCTGAGCCATGG + Intronic
1087130472 11:94665475-94665497 TGAGGGTCTGCACTGAGCTGAGG + Intergenic
1088706000 11:112465302-112465324 TGAAGCTGTGGCCTGGGCTGTGG + Intergenic
1088884831 11:113998588-113998610 TGGGGCTCTGGTCTCAGCTGAGG - Intergenic
1088884833 11:113998606-113998628 TGGGTCTCTGGTCTCAGCTGGGG - Intergenic
1089010351 11:115127152-115127174 TGTTGTTCTTGCCAGAGCTGTGG - Intergenic
1089526872 11:119102683-119102705 TGAGGCTCTGGAAAGAGCTGAGG + Intronic
1089616761 11:119699264-119699286 TGGAGCTTTGACCTGAGCTGAGG + Intronic
1090333035 11:125946005-125946027 TGAGGCTCCTGCCTGACCTGTGG - Intergenic
1091310917 11:134574634-134574656 TGTGGCCCTGGCCCCCGCTGGGG + Intergenic
1092411501 12:8256686-8256708 TGTAGCTCTGGCCTGGCCAGAGG + Intergenic
1092750879 12:11718254-11718276 TGAGGCTTTGGGCTGAGGTGTGG - Intronic
1093483422 12:19628191-19628213 TGTGCCTGTGGTCTCAGCTGAGG + Intronic
1095982386 12:47980863-47980885 TGTGGAACTGGCCTGAGTGGAGG + Intronic
1096231405 12:49898827-49898849 TCTGACTCTGGCTTGTGCTGAGG + Intronic
1096493861 12:52027775-52027797 TGTGGCTCTGCCCTCTGCAGTGG - Intronic
1097287639 12:57889930-57889952 TGTGGCTGGGGCCAGAGATGTGG + Intergenic
1098641157 12:72839590-72839612 TGTGCCTCTGGCCTGACCTGGGG - Intergenic
1098707295 12:73706734-73706756 GGTTGCCCTGGCCAGAGCTGAGG - Intergenic
1099332313 12:81304992-81305014 GGTTGCTTTGTCCTGAGCTGTGG + Intronic
1099577115 12:84394882-84394904 TGTACTTCTGGGCTGAGCTGAGG - Intergenic
1100862317 12:98819312-98819334 TGTTGATCTGCCCAGAGCTGGGG + Intronic
1101755442 12:107617564-107617586 GGTCGCTCTGGCCAGACCTGGGG - Intronic
1102203482 12:111074597-111074619 GCAGGCTCTGGGCTGAGCTGAGG - Intronic
1102953434 12:117045069-117045091 TGTGCATGCGGCCTGAGCTGGGG - Intronic
1104053025 12:125209114-125209136 TGTGGCTCTTGCCTGGGAAGCGG + Intronic
1104635091 12:130433474-130433496 AGAGGCTCTGGCATGTGCTGAGG - Intronic
1104916967 12:132270680-132270702 TGTGGCTGTGGCCATGGCTGTGG - Intronic
1104920575 12:132288544-132288566 TGGGGCTCAGGCCTCAGGTGGGG + Intronic
1106162444 13:27213423-27213445 TGTACTTCTGGGCTGAGCTGAGG + Intergenic
1107491150 13:40880744-40880766 GGTGGCTCAGGCCTGCCCTGTGG - Intergenic
1107544057 13:41420550-41420572 TCTCCCTCTGGCCAGAGCTGGGG - Intergenic
1108686955 13:52827965-52827987 TGTGGGCCTGCCCTGGGCTGAGG + Intergenic
1108848367 13:54701111-54701133 TGTACTTCTGGGCTGAGCTGAGG + Intergenic
1109538911 13:63747014-63747036 TATGGCTCTGGCTACAGCTGTGG + Intergenic
1109544932 13:63832818-63832840 TATGGCTCTGGCTACAGCTGTGG - Intergenic
1109559706 13:64030474-64030496 TGTGTCTCTGGTTTCAGCTGGGG - Intergenic
1110783100 13:79489933-79489955 TGGGGCCCTGGCCTGTGATGAGG + Intronic
1111051261 13:82885141-82885163 TGTGCCCCTGTCCTGAGGTGGGG - Intergenic
1113964385 13:114144432-114144454 TGTGGCTCTGTCAAGGGCTGGGG + Intergenic
1114181505 14:20371937-20371959 TGTGGGCCTGACCTGGGCTGTGG - Intronic
1114182192 14:20376487-20376509 TGTGTTCCCGGCCTGAGCTGTGG - Intronic
1114209032 14:20600307-20600329 TGTGGCTGCAGCATGAGCTGTGG + Intronic
1114566495 14:23636992-23637014 TGTACTTCTGGGCTGAGCTGAGG + Intronic
1115681980 14:35750663-35750685 TGTGGCTTTGGTCTCATCTGCGG + Exonic
1115773495 14:36690042-36690064 TCTGGCTTTGGACTGAGCTAAGG - Intronic
1115875055 14:37851983-37852005 TGTGGCTCTGTCCTTATATGCGG - Intronic
1115911097 14:38256516-38256538 TGTGTTTCTGTCCGGAGCTGTGG + Intergenic
1117048216 14:51834384-51834406 TGTGGCTCTGACCTCGGCAGGGG - Intronic
1117589799 14:57255603-57255625 GGTGGCTCAGGCCGGAGCTCAGG + Intronic
1118355788 14:65012508-65012530 TGTGGCTCTGGCAGGAGGTAGGG + Intronic
1120107655 14:80515293-80515315 TCTGGATCTGCCCTGGGCTGGGG - Intronic
1121184865 14:91958054-91958076 TGTGGTTGTGACCTGAGCCGGGG - Intergenic
1121329764 14:93042580-93042602 TGGGGCACTGGCCTGAGTTTTGG - Intronic
1121342853 14:93115587-93115609 TGTGGCTCGGGCCCGCGCGGCGG - Intronic
1121719179 14:96097387-96097409 CCTGGCTCTGGCCTGGGCAGTGG + Intergenic
1122284079 14:100640553-100640575 TGTGGCTCACGCCTGCACTGTGG + Intergenic
1122428239 14:101623935-101623957 GGTGGCTCAGACCAGAGCTGTGG - Intergenic
1122631082 14:103108057-103108079 GAGGGCTCTGGCCTGAGGTGGGG - Intronic
1122774982 14:104113135-104113157 TGTGGCCCTGGCCTGAGAGGGGG - Exonic
1122917155 14:104864666-104864688 GGGCGCTCTGGGCTGAGCTGGGG - Intergenic
1122980869 14:105191901-105191923 CGAGGCTCTGGCCTGGGCCGCGG + Intergenic
1123108180 14:105852632-105852654 TGTGGCCCTGCCCTGTGCTGTGG + Intergenic
1123159154 14:106260565-106260587 TGTGGCTCTGGGATGACCTGGGG + Intergenic
1123160270 14:106271403-106271425 TGTGGCTCTGGCCTGACCTAGGG + Intergenic
1123944121 15:25230760-25230782 TGGCGCCCTGGACTGAGCTGTGG + Intergenic
1125743831 15:41985888-41985910 TTTCGCTCTGGCCTGAGGAGGGG + Exonic
1127238319 15:57081394-57081416 TGTGCCTCTTGCCTCATCTGTGG + Intronic
1128285912 15:66436939-66436961 GGTGGCTCTGGCCTAATCTTTGG + Intronic
1129152561 15:73698118-73698140 TGCAGGTCAGGCCTGAGCTGGGG - Intronic
1129226048 15:74171049-74171071 TTGGGCTCAGGCCTGAGATGGGG - Intergenic
1129680531 15:77656227-77656249 TTTGGCCCTGGACTGAGCTTTGG + Intronic
1129771760 15:78207272-78207294 CAGGGATCTGGCCTGAGCTGTGG - Intronic
1129782177 15:78279830-78279852 TGAGACTCTGGCCTGTGCTCTGG - Intronic
1129895828 15:79105177-79105199 TGTCCCTCTGGCCAGAGCTCAGG + Intergenic
1131367893 15:91854625-91854647 TGTGGCCCTGGCCTGAGCCGGGG + Intronic
1131410942 15:92207936-92207958 TGTACTTCTGGGCTGAGCTGAGG + Intergenic
1133112399 16:3556385-3556407 TGTGTGTGTGGCCTGAGCAGGGG - Intronic
1133352747 16:5112986-5113008 TGTGGCTCTGGCCTGGCCAGAGG + Intergenic
1133393290 16:5426494-5426516 CGTGGCTCTGTGCTGACCTGAGG - Intergenic
1133501035 16:6367065-6367087 TGTAGCTCCTGCCTGAGCTTTGG + Intronic
1135909706 16:26548304-26548326 TGTGGCCCTGTCTTAAGCTGAGG - Intergenic
1136290084 16:29266493-29266515 TGCTGCTCTGGCCTGTGCTCGGG + Intergenic
1137411207 16:48229820-48229842 TGTGGGTGTGGCATGAGGTGAGG - Intronic
1137549158 16:49425106-49425128 TGTGGCTCTGTCCTGGTCAGGGG + Intergenic
1138007966 16:53355213-53355235 GGTGTCTGTGGCCTGAGCAGTGG + Intergenic
1138268903 16:55680737-55680759 TGTGGGTCTGGCCTGGGATGTGG + Intronic
1138402782 16:56761173-56761195 TTTAGCTTTGGCCTGATCTGGGG + Intronic
1138598480 16:58041761-58041783 TGTGGCTCGGGGCTGGACTGGGG - Exonic
1139061910 16:63263344-63263366 TGAGATGCTGGCCTGAGCTGAGG + Intergenic
1140004371 16:71060874-71060896 CATGGCTCTGGGCTGACCTGGGG - Intronic
1140628861 16:76828022-76828044 TGAGGCTCTGGAATGGGCTGTGG + Intergenic
1141002984 16:80325424-80325446 TGTGGCTCTGTAATGGGCTGCGG - Intergenic
1141573772 16:84951149-84951171 TGTGGCTACTCCCTGAGCTGGGG - Intergenic
1141916978 16:87105170-87105192 TGTGGCACTGGCGTGAGGGGAGG - Intronic
1142000331 16:87660627-87660649 TGCGGCTTTGCCCCGAGCTGTGG - Intronic
1142095967 16:88240015-88240037 TGCTGCTCTGGCCTGTGCTCGGG + Intergenic
1142139779 16:88467730-88467752 TGTGGCTGGGACCTGAGATGGGG + Intronic
1142471978 17:169787-169809 TGGGGCTCTGGGCTGGGGTGTGG - Intronic
1143102052 17:4509896-4509918 GGTGGGCTTGGCCTGAGCTGTGG + Intronic
1143385135 17:6524647-6524669 TGTGGATCAGGCTTAAGCTGAGG - Intronic
1143500753 17:7337119-7337141 TCCTGCTCTGGCCTGGGCTGTGG + Intronic
1144729003 17:17516009-17516031 TGTGCCTCTGGCCTGGTGTGTGG - Intronic
1145014568 17:19387826-19387848 AGGGGCCCTGGCCTGAGCTGGGG - Intergenic
1145989360 17:29069624-29069646 TGGAACTCTGGCCTGAGCTGAGG - Intergenic
1148054860 17:44787849-44787871 CGTGGCTGTGGCCAGAGCTCTGG + Intergenic
1148205980 17:45780372-45780394 TGTGGCTGAGGCGTGAGCTGTGG - Intergenic
1148462749 17:47847748-47847770 AGACGGTCTGGCCTGAGCTGCGG + Exonic
1148755495 17:49970975-49970997 TGTGGCTGTCTCCTGGGCTGCGG + Intronic
1149223305 17:54439944-54439966 TGTACTTCTGGGCTGAGCTGAGG + Intergenic
1149692282 17:58587979-58588001 TGTGGCTTTGGCTTGGGCAGTGG + Exonic
1151540896 17:74764077-74764099 TTTGGCTCGGGCCTGGGCAGGGG - Intronic
1151651945 17:75475640-75475662 TGATGCTCTGGCATGTGCTGAGG + Intronic
1151766308 17:76135162-76135184 TGTGCCCCAGGCCTGTGCTGGGG - Intergenic
1151963316 17:77418857-77418879 GGTGCTTCTGGTCTGAGCTGAGG + Intronic
1152412313 17:80133710-80133732 GCTGGCACTGGCCAGAGCTGTGG + Intergenic
1152844641 17:82592271-82592293 TGTGCTCCTGGGCTGAGCTGCGG + Intronic
1152888546 17:82866795-82866817 TGTGGCTCTGTCCACAGCTGGGG + Intronic
1152938886 17:83155304-83155326 GCTGGCTCAGGTCTGAGCTGGGG - Intergenic
1156233458 18:35178423-35178445 TGTGGGTCTAGCCCCAGCTGAGG - Intergenic
1156516475 18:37684655-37684677 TGTGTCACGGGCCTGAACTGAGG - Intergenic
1158194248 18:54866715-54866737 TGTGGCTCTTGTCTGACCTGTGG + Intronic
1159369533 18:67513407-67513429 GGTGGCTGTGGTGTGAGCTGGGG + Exonic
1160412452 18:78684164-78684186 TGTGGCCATGGCCGGACCTGTGG - Intergenic
1160945963 19:1644251-1644273 TGTGGCGCTGGCCCCAGGTGTGG - Intronic
1161515498 19:4693929-4693951 TGTGGCTCTGCCCAGAGCCGTGG + Intronic
1161727615 19:5939335-5939357 TGGGGATCTGGCGTGAGATGAGG - Intronic
1162362790 19:10230045-10230067 TTTGGGTCTGGGCTGAGCTTAGG - Intronic
1162923996 19:13920576-13920598 TGGGGCTTTGGGCTGGGCTGTGG - Exonic
1163002787 19:14379210-14379232 TGTGGGGGTGGCCTGGGCTGTGG - Intergenic
1163063963 19:14779529-14779551 TGTGGGGGTGGCCTGGGCTGTGG + Intergenic
1163102901 19:15108434-15108456 GGGGGGTCTGGCCTGGGCTGAGG + Intronic
1163719397 19:18891517-18891539 AGTGGATGTGGCCTGAGCTCCGG - Intronic
1164830587 19:31317208-31317230 TGTGGCTCTGGCTGGGGCTGGGG - Intronic
1165103825 19:33456976-33456998 TGTGTCTCTGACCAGGGCTGGGG - Intronic
1165153800 19:33775667-33775689 TGGGTGTCTGGCCTGTGCTGTGG + Intergenic
1165153831 19:33775878-33775900 TGTGTGTCTGGCCTGTGATGTGG + Intergenic
1165153848 19:33776004-33776026 TGTGTCTCTGGCCTGTGCTGTGG + Intergenic
1165153855 19:33776073-33776095 TGTATGTCTGGCCTGTGCTGTGG + Intergenic
1165153878 19:33776245-33776267 TGGGTGTCTGGCCTGTGCTGTGG + Intergenic
1165161691 19:33820395-33820417 TGTGGCTCTGCCGAGAACTGGGG + Intergenic
1165354993 19:35299159-35299181 TGTGGCTCTGGCGTCAGCGTGGG - Intronic
1166499943 19:43332916-43332938 TGTGTCTGTTGGCTGAGCTGTGG + Intergenic
1166620956 19:44299690-44299712 TGTGGCTGTGGCCTTCACTGAGG - Exonic
1166656476 19:44615701-44615723 TGTGACACCTGCCTGAGCTGGGG - Intronic
1166732589 19:45067472-45067494 TGCGGCTCTGGCTGGGGCTGGGG - Exonic
1167156735 19:47743279-47743301 GGTGACTCAGGCCTGGGCTGGGG + Intergenic
1167611323 19:50509031-50509053 AGAGGGTCAGGCCTGAGCTGGGG + Intronic
1167710501 19:51107692-51107714 TGAGGTTCTGGCCTGAGCATTGG + Intronic
925444384 2:3915314-3915336 TGTGGCTCTGTCCTGAGTACAGG + Intergenic
925833954 2:7924611-7924633 TGCAGCTGTGGCCTCAGCTGTGG - Intergenic
925950163 2:8902066-8902088 TGTACCTCTGGGCTGAGCTGAGG - Intronic
926039490 2:9661534-9661556 TGTGGCCCTGGCCAAGGCTGTGG - Intergenic
927511573 2:23647324-23647346 TGTGCCTCTGGCCTGAGTGTGGG - Intronic
929350835 2:40952450-40952472 TGTGGTTTTGGCCTGAGCTTAGG + Intergenic
930071469 2:47369606-47369628 TGTGGAGCTGGGCTGGGCTGGGG + Intronic
930411588 2:51031996-51032018 TCAGGCTCTGGCTCGAGCTGAGG - Exonic
930554844 2:52882869-52882891 TGTGGCTGTGGCTGTAGCTGTGG + Intergenic
931276243 2:60746215-60746237 TGTGGCCGTGGCATGGGCTGTGG - Intergenic
931321600 2:61178171-61178193 TGCGCCTCTGGCCGGGGCTGTGG + Exonic
931686700 2:64800108-64800130 TGAGTCACTGGGCTGAGCTGTGG + Intergenic
931890249 2:66663422-66663444 TGTGGGTCTGGCCCCAGATGTGG - Intergenic
932180550 2:69642985-69643007 GGCGGCTCTGGCCTGGGCTCCGG - Exonic
932300490 2:70663601-70663623 TCTGGCTCAGGCCTTTGCTGAGG + Exonic
932307116 2:70711907-70711929 TGTGGCTGGTGCCTGAGGTGGGG + Intronic
933341909 2:81035987-81036009 TGTACTTCTGGGCTGAGCTGAGG + Intergenic
933838291 2:86263851-86263873 TGCGTCTCTGGCCTGAGGTGAGG + Intronic
933972857 2:87484122-87484144 TGTGGCCCTGGGCTGATGTGGGG - Intergenic
934866865 2:97821895-97821917 TGTACTTCTGGGCTGAGCTGAGG + Intronic
935218889 2:100995241-100995263 GGTGGCTCTGGCAAGACCTGGGG - Intronic
936091427 2:109503992-109504014 CGTGGGTCTGGCCAGAGCTCTGG + Intronic
936170942 2:110173204-110173226 GGTGGCTCACGCCTGTGCTGAGG - Intronic
936481040 2:112885030-112885052 GGTGGCCCTGGCCTGACCCGGGG + Intergenic
937340371 2:121087172-121087194 TGTTCTTCTGGCCAGAGCTGGGG + Intergenic
938137391 2:128770441-128770463 TGTGGGCCAGGCCAGAGCTGTGG + Intergenic
938593705 2:132765561-132765583 GGTGGCTCATGCCTGTGCTGAGG - Intronic
940273531 2:151916012-151916034 TGTGGCTCTCAGCTGGGCTGCGG + Intronic
940901273 2:159128624-159128646 TTTGTCTCTTGCCTGAGTTGAGG - Intronic
942307699 2:174624987-174625009 TAAGGCTCTGGCCTGAGCTCAGG - Intronic
946177459 2:217930299-217930321 TGTGGTCCTGGGCAGAGCTGAGG - Intronic
946204234 2:218091949-218091971 TGTGGCTCTGACCAGAGCTCTGG + Intergenic
947639183 2:231696749-231696771 TGGGGCTCTGGAGTCAGCTGGGG + Intergenic
948374558 2:237512845-237512867 AGCAGCTCTGGGCTGAGCTGTGG - Intronic
948467625 2:238159790-238159812 TGTGGCCCAGGCCTGAGGAGGGG + Intronic
948525103 2:238566592-238566614 TGTGCGTCAGGCCTGAGCTGAGG + Intergenic
948727968 2:239946274-239946296 TGGGGCTGGGGCCGGAGCTGTGG - Intronic
948873170 2:240813683-240813705 AGTGGTTCTGACCAGAGCTGGGG - Intronic
948889075 2:240898051-240898073 AGAGGCTCTGACCTCAGCTGGGG - Intergenic
1169038911 20:2476522-2476544 TATGGCAGTGGCCTGGGCTGGGG + Intronic
1169186120 20:3618687-3618709 TGGGGCTCTGACCAGAGCTTGGG + Intronic
1169554478 20:6735057-6735079 TGTGGCTCTGCCCTCCTCTGGGG - Intergenic
1170539007 20:17369588-17369610 TTTGCTTGTGGCCTGAGCTGTGG - Intronic
1170868908 20:20186934-20186956 TGAGGCTCTGGCCTGGTGTGGGG + Intronic
1171044689 20:21798774-21798796 TGTGTCACTGGCCAGAGGTGGGG + Intergenic
1171217495 20:23362591-23362613 TGTGGCCGTGGACTGGGCTGCGG + Intronic
1171261265 20:23736648-23736670 TGTACTTCTGGGCTGAGCTGGGG + Intergenic
1171270396 20:23812539-23812561 TGTACTTCTGGGCTGAGCTGGGG + Intergenic
1171342352 20:24440306-24440328 TGTGGTTCTGGACTTAGCTGGGG + Intergenic
1172593210 20:36131994-36132016 TGGGGAACAGGCCTGAGCTGGGG - Intronic
1174929031 20:54793607-54793629 TGTGGCTCTGAGGTGAGCTCAGG + Intergenic
1175354716 20:58355292-58355314 GCTGGGCCTGGCCTGAGCTGGGG - Intronic
1175367864 20:58467765-58467787 AGGGGCCCAGGCCTGAGCTGAGG - Intronic
1175413155 20:58784733-58784755 TGTGACTTTTGCTTGAGCTGGGG + Intergenic
1175734110 20:61373308-61373330 CCTGGCTCTCCCCTGAGCTGGGG - Intronic
1176180595 20:63747668-63747690 TGTGGCTCTGATAGGAGCTGGGG - Intronic
1177355403 21:19999640-19999662 AGTGGCTTTGGCCTGCCCTGTGG - Intergenic
1179156256 21:38853612-38853634 TGTGCCTGTGGCCTGGGCTTGGG + Intergenic
1179403821 21:41108956-41108978 AGAGGCGCTGGCCTGAGATGTGG - Intergenic
1179907127 21:44428373-44428395 TGTGGCTCCTCCCTGAGGTGTGG + Intronic
1179907157 21:44428467-44428489 TGTGGCTCCTCCCTGAGGTGTGG + Intronic
1179907168 21:44428504-44428526 TGTGGCTCCTCCCTGAGGTGTGG + Intronic
1179907207 21:44428634-44428656 TGTGGCTCCTCCCTGAGGTGTGG + Intronic
1179907228 21:44428708-44428730 TGTGGCTCCTCCCTGAGGTGTGG + Intronic
1179907239 21:44428745-44428767 TGTGGCTCTTCCCTGAGGTGTGG + Intronic
1179907243 21:44428763-44428785 TGTGGCTCCTCCCTGAGGTGTGG + Intronic
1179949686 21:44702771-44702793 TGGGCTTCTGGCCTGAGCAGAGG - Intronic
1180521970 22:16217089-16217111 TGTGAATCTGGACAGAGCTGGGG + Intergenic
1180559500 22:16603170-16603192 TGTGGCTCTCGCGTGTGCCGTGG + Intergenic
1180869255 22:19137236-19137258 TGTGGCTCAGGACTGAGCACTGG - Intronic
1180878681 22:19188040-19188062 TGTGGCTCTGGACTGACCGCAGG + Exonic
1181010455 22:20037260-20037282 TGTGGGTGGGTCCTGAGCTGAGG + Intronic
1181430523 22:22878873-22878895 TGTGACTCAGGCCTGATCAGTGG - Intronic
1181435320 22:22907014-22907036 TGTGGGACTGGTCTGAGCTGAGG - Intergenic
1181566900 22:23744333-23744355 GCTGGCTCAGGCCTGAGCTCTGG + Exonic
1181626164 22:24123623-24123645 TGTGGCTCTGCCCAGACCTGGGG + Intronic
1183398814 22:37589029-37589051 TGTGGCCCAGGGCAGAGCTGGGG - Intergenic
1183745031 22:39687181-39687203 TGGGGCTCTGGCCCCAGGTGAGG + Exonic
1183752013 22:39726534-39726556 TGTGGCTCTGCCATGTGCTCGGG + Intergenic
1183752026 22:39726612-39726634 TGTGGCTCTGCCATGTGCTCGGG + Intergenic
1184274281 22:43401319-43401341 GGTGGCCCTGGCCTGGCCTGAGG + Intergenic
1184280252 22:43433373-43433395 TGTGGCCCTGCGCTGAGCTCAGG + Intronic
1184493009 22:44820861-44820883 GCTGGCGCTGGACTGAGCTGTGG + Intronic
1184596551 22:45517451-45517473 TGGGGCTGTAGCCTGGGCTGGGG + Intronic
1185021725 22:48380381-48380403 TCTGGGTCTGGCCTGGGCAGGGG + Intergenic
950335354 3:12188750-12188772 GGTGCCACTGGCCCGAGCTGGGG - Intronic
950494542 3:13325848-13325870 TGTGGCTGTGGCCCGGGCCGTGG - Exonic
950653778 3:14424211-14424233 TGTGGTTCAGGCCCCAGCTGGGG + Intronic
953242887 3:41165475-41165497 CTTGGCTCTGGCCTGAGCTCTGG - Intergenic
953352957 3:42229826-42229848 GCTGGCACTGGCCAGAGCTGCGG - Intergenic
954129781 3:48554521-48554543 TGTGGCTCTGGCCTGAGCTGAGG - Intronic
954430558 3:50468698-50468720 AGTGGCTGAGGCCAGAGCTGAGG - Intronic
954598671 3:51850878-51850900 TGTACTTCTGGGCTGAGCTGAGG + Intergenic
954664815 3:52246068-52246090 TCAGGCCCGGGCCTGAGCTGGGG - Intronic
954877447 3:53811424-53811446 ACTGGCTCTGGCCTCAGGTGGGG + Exonic
955243417 3:57201753-57201775 AGTTGCTCTGGCATGCGCTGTGG - Intronic
957056727 3:75448959-75448981 TGTGGCTCTGGCCTGGCCAGAGG + Intergenic
959515654 3:107263869-107263891 TGGGACTCAGGCCTCAGCTGTGG - Intergenic
959934262 3:112013176-112013198 TCTGGCCCTAGCCTGAGCTGTGG - Intronic
961297669 3:125899898-125899920 TGTGGCTCTGGCCTGGCCAGAGG - Intergenic
961951186 3:130751102-130751124 TGTGGCTCTGGCATTAACTAGGG - Intergenic
962317149 3:134366030-134366052 TGGGGCCCTGAGCTGAGCTGGGG - Intronic
962344842 3:134611322-134611344 TGAGGCCCAGGCCTGGGCTGTGG + Intronic
962786088 3:138769126-138769148 TGTGGAGCTGGCGGGAGCTGGGG - Intronic
962806925 3:138934303-138934325 TGTTGTTCTGGCATTAGCTGTGG - Intergenic
962835585 3:139185736-139185758 TGAGACTGGGGCCTGAGCTGGGG - Intronic
963409463 3:144909019-144909041 TGTACTTCTGGGCTGAGCTGAGG - Intergenic
963992546 3:151670154-151670176 TGTACTTCTGGGCTGAGCTGTGG - Intergenic
965743661 3:171902971-171902993 TTTGGATCTGGTCTGAGGTGGGG - Intronic
966401122 3:179547714-179547736 AGTGGATCTTGCCTGAGCTCAGG + Intergenic
967460822 3:189744141-189744163 TGTGGCTCTTGCCTCAGCCTTGG - Intronic
967807528 3:193728926-193728948 TGGGGCTGTGGACTGGGCTGTGG - Intergenic
968611284 4:1558265-1558287 TGTGGCTCCGGGCTGTTCTGAGG - Intergenic
968817317 4:2828794-2828816 TGTGGCTCAGGACTGAGCGCTGG - Intronic
968960990 4:3743583-3743605 TCCTGCTGTGGCCTGAGCTGCGG + Intergenic
968999546 4:3969242-3969264 TGTAGCTCTGGCCTGGCCAGAGG + Intergenic
969297077 4:6276525-6276547 TGTGGCTTGGGCCTGGGGTGGGG + Intronic
969637809 4:8379450-8379472 GGTGACCCTGGGCTGAGCTGTGG - Intronic
969754462 4:9139391-9139413 TGTAGCTCTGGCCTGGCCAGAGG - Intergenic
969814354 4:9675677-9675699 TGTAGCTCTGGCCTGGCCAGAGG - Intergenic
971154440 4:24066190-24066212 TGTCGCTGTGCCCTGAGCTCAGG + Intergenic
971351139 4:25857290-25857312 TGTGGCTCTGGCCAGCTCTCAGG - Intronic
972282013 4:37611643-37611665 GGTAGCTCTGGGGTGAGCTGTGG - Intronic
974187047 4:58458898-58458920 TGTACTTCTGGGCTGAGCTGAGG + Intergenic
977883825 4:102236042-102236064 TGTGCTTCTGGGCTGAGCCGAGG + Intergenic
979649548 4:123114414-123114436 TGAGGCTCTGGGCTGGCCTGTGG - Intronic
980541375 4:134201170-134201192 TGAGGGTGTTGCCTGAGCTGGGG - Exonic
980904845 4:138938170-138938192 TGAGGCTCTGTCCTTTGCTGAGG + Intergenic
980972702 4:139581734-139581756 TGTGTCTGTGCCCTGTGCTGGGG + Intronic
981030127 4:140116635-140116657 TCTGGATGTGGCCAGAGCTGTGG - Intronic
981170985 4:141623122-141623144 TGTGGCTCTGCCCTGAGCTCAGG - Intergenic
983806983 4:172006215-172006237 TGTGGCTCTGCCATGGACTGTGG + Intronic
984048661 4:174835904-174835926 TGTGGTTCTGACCAAAGCTGTGG - Intronic
984112732 4:175640146-175640168 TGTGGCACTTGCTGGAGCTGGGG - Exonic
985693381 5:1325950-1325972 CAGCGCTCTGGCCTGAGCTGTGG - Intronic
985701636 5:1377030-1377052 TGTGGTCCTGGACTGGGCTGTGG - Intergenic
985879741 5:2629182-2629204 TATGGGTCTGGTCTGACCTGGGG - Intergenic
985908655 5:2862397-2862419 TGTGGCTGTGGCTGGTGCTGTGG - Intergenic
985908724 5:2862929-2862951 TGTGGCTGTGGCTGGTGCTGTGG - Intergenic
985908762 5:2863210-2863232 TGTGGCTGTGGCTGGTGCTGTGG - Intergenic
986211650 5:5679117-5679139 TGTGGGGCTGGCCTGCACTGTGG + Intergenic
986444318 5:7807985-7808007 TGTGTCTCTGGGGTGGGCTGGGG + Intronic
986883780 5:12208611-12208633 TGAGGCTCTGGGGTGAGCTCAGG + Intergenic
987125296 5:14806548-14806570 TGTGGCTGTGGCTGTAGCTGTGG + Intronic
987391317 5:17378038-17378060 AGTGGAAGTGGCCTGAGCTGGGG + Intergenic
987545510 5:19306645-19306667 TGTACTTCTGGGCTGAGCTGAGG - Intergenic
990125514 5:52512410-52512432 TTTGGCTTTGGCCTCACCTGGGG - Intergenic
990338652 5:54800906-54800928 TCTGGCTCCAGCCTTAGCTGTGG - Intergenic
991005386 5:61823338-61823360 TATGGCTCGGACCGGAGCTGTGG + Intergenic
995746199 5:115406757-115406779 TGTTGCTCTGGACTGTCCTGTGG + Intergenic
996099506 5:119432099-119432121 TGTACTTCTGGGCTGAGCTGAGG - Intergenic
996580519 5:125027688-125027710 AATGGCTCTGACCTCAGCTGGGG - Intergenic
997011734 5:129886294-129886316 TGTGGTTTTGGCTTCAGCTGGGG - Intergenic
997581201 5:135018564-135018586 TGTGGCTGCAGCCTGTGCTGTGG + Intergenic
997941271 5:138159659-138159681 TGTGTCTCTGTCCTGAGGTTTGG - Intronic
998502516 5:142645822-142645844 TTGGGCTGTGGCCTGAGCTCAGG - Intronic
998849284 5:146338626-146338648 GGTAGCCCTGGGCTGAGCTGGGG - Intronic
999475612 5:151895815-151895837 TGTGGCTCTGGTGTGGGCAGAGG + Intronic
999642540 5:153686376-153686398 AGGGACTCTGGCCAGAGCTGAGG + Intronic
999941913 5:156552148-156552170 TGTGTCTGTGGCATGAGCAGTGG - Intronic
1001478013 5:172064696-172064718 TGAGTCCCTGGCCTCAGCTGGGG - Intronic
1001522216 5:172402949-172402971 TGTGGCTCAGGCCCTGGCTGTGG + Intronic
1002820784 6:722813-722835 TGTGGTTCTGAACTGACCTGTGG - Intergenic
1002847019 6:955813-955835 TGTGGCTCTGGGCTGAGCACTGG + Intergenic
1004358516 6:14950699-14950721 TGGTGCTCTGGGCTGAACTGTGG + Intergenic
1006154826 6:32008375-32008397 ACTGGTTCTGGCCTGGGCTGTGG - Intergenic
1006161139 6:32041110-32041132 ACTGGCTCTGGCCCGGGCTGTGG - Exonic
1006221515 6:32495763-32495785 TGTACTTCTGGGCTGAGCTGAGG + Intergenic
1007356508 6:41321685-41321707 TGGGGCCCTGGCCTGATCTTGGG + Intergenic
1007631170 6:43274504-43274526 TGTGGCTCTGACCGGGGATGGGG + Intronic
1009470502 6:64025275-64025297 TGTACTTCTGGGCTGAGCTGAGG + Intronic
1010074695 6:71786370-71786392 TGTACTTCTGGGCTGAGCTGAGG + Intergenic
1013459074 6:110358171-110358193 TGCGGCTCTGCGCAGAGCTGCGG - Exonic
1014009589 6:116460941-116460963 TGTGACTCCAGACTGAGCTGAGG - Intergenic
1017017532 6:150113847-150113869 AGTGTCTCTGCCCTCAGCTGGGG - Intergenic
1017718996 6:157232149-157232171 TGAGGGCCTGGCCAGAGCTGGGG + Intergenic
1018615883 6:165686460-165686482 TGTTGCTCTGGCAGGAGCTGTGG + Intronic
1018885362 6:167930791-167930813 GGTGGGTCTGGACAGAGCTGAGG + Intronic
1019022310 6:168929639-168929661 TATGCCTCCTGCCTGAGCTGAGG + Intergenic
1019211914 6:170413591-170413613 TGTGACTCTGACCTGTGGTGAGG + Intergenic
1019567478 7:1691615-1691637 AGTGGGTCAGGCCTGGGCTGTGG - Intronic
1021757004 7:23861341-23861363 TGTACTTCTGGGCTGAGCTGAGG - Intergenic
1021900592 7:25281193-25281215 TGTGGCTCTGACCTGTGCCCTGG + Intergenic
1022516392 7:30977412-30977434 TGAAGGTGTGGCCTGAGCTGGGG - Intronic
1022993094 7:35727543-35727565 GGTGGCTCTCGCCTGAGAGGGGG - Intergenic
1023078221 7:36503938-36503960 TGTACTTCTGGGCTGAGCTGAGG - Intergenic
1023809503 7:43901246-43901268 AGAGGCTCTCCCCTGAGCTGGGG + Intronic
1024599329 7:50965733-50965755 TGTGAGTTTGCCCTGAGCTGTGG - Intergenic
1025713745 7:63933968-63933990 TCTGGCTCTGCCATGGGCTGTGG - Intergenic
1027190191 7:75992101-75992123 AGTGGCTGTGAACTGAGCTGGGG + Intronic
1027192226 7:76003413-76003435 GGAGGCTCTGGGCTGAGCTCTGG - Intronic
1027233634 7:76285711-76285733 CGTGGCTGTGGCCGGGGCTGGGG - Exonic
1030105223 7:105981648-105981670 TCAGGTTCTGCCCTGAGCTGTGG + Intronic
1031196432 7:118620305-118620327 GCTGGTGCTGGCCTGAGCTGGGG - Intergenic
1031197094 7:118628888-118628910 GCTGGTGCTGGCCTGAGCTGGGG + Intergenic
1032786554 7:135205382-135205404 TGTGGCTCTGCCTAGAGGTGGGG - Intronic
1033260835 7:139842756-139842778 TTTGGCCCTGGCCCGCGCTGTGG + Intronic
1034617736 7:152434651-152434673 TGTGGCTCTCGCGTGTGCCGTGG - Intronic
1034972082 7:155425526-155425548 TGTGGCTCTGGGCTGAGGTGGGG - Intergenic
1035260283 7:157656683-157656705 TGTTGCGCTGGCCTGCCCTGGGG - Intronic
1036185072 8:6615487-6615509 TGTGGCTCAGCCCTGAGTTGGGG + Intronic
1036377689 8:8214720-8214742 TGTAGCTCTGGCCTGGCCAGAGG - Intergenic
1036851874 8:12208429-12208451 TGTAGCTCTGGCCTGGCCAGAGG + Intergenic
1036873240 8:12450947-12450969 TGTAGCTCTGGCCTGGCCAGAGG + Intergenic
1037744593 8:21632647-21632669 TGTGTCTCTAGCCTTTGCTGGGG - Intergenic
1037767954 8:21783320-21783342 TGGGCCTCTGGCTGGAGCTGGGG - Intronic
1037779931 8:21860992-21861014 TGTGGGTGTGCCCTGAGCTGGGG - Intergenic
1038336955 8:26653190-26653212 TGTGGCTGTGGCCTGAGCTGGGG + Intronic
1038356983 8:26838776-26838798 TGTAGCTTTGGCCTTAGATGTGG + Intronic
1038420295 8:27430232-27430254 TGTGGCTCTGGTCTGGGGAGGGG - Intronic
1039275717 8:35932775-35932797 TGTACTTCTGGACTGAGCTGAGG + Intergenic
1039354112 8:36795879-36795901 TGTGCCTCTGGGCTAAGTTGAGG - Intronic
1039429714 8:37516379-37516401 TGTGCCTCTGGTCTGTGCTTTGG - Intergenic
1040358889 8:46645942-46645964 TGTGGATCTGGCCACAGGTGGGG + Intergenic
1040575415 8:48647309-48647331 GGTGGCTGTGGCATGAGGTGTGG + Intergenic
1040628168 8:49175844-49175866 TCTGGATCTGCCCTGGGCTGGGG + Intergenic
1040953112 8:52955453-52955475 TGTGCTTCTGGGCTGAGCCGAGG + Intergenic
1044046326 8:87438653-87438675 TGTGGCTCTAGTGTGAGCTTAGG - Intronic
1044628643 8:94258450-94258472 CCTGGCTCTGGCCTAAGCTCTGG - Intronic
1044781111 8:95744411-95744433 TGTGACTCTGGCATGCTCTGGGG - Intergenic
1045064922 8:98436245-98436267 TGTGGCTGTGGACAGAGCTGTGG - Intronic
1046902681 8:119539915-119539937 GGTGGCTATGGCCTGTGCTTTGG - Intergenic
1047368413 8:124234274-124234296 TGCAGCTCTGGTCTGAGCTTTGG - Intergenic
1049062863 8:140289788-140289810 TTTGGCTCTGGCCTTTCCTGTGG - Intronic
1049624792 8:143615152-143615174 TGGGGCCCAGCCCTGAGCTGGGG - Intronic
1049624823 8:143615234-143615256 TCTGGCCCTGGGCTGGGCTGGGG + Intronic
1050878670 9:10673742-10673764 TGTAGCTCTGGGGTGAGCTCAGG + Intergenic
1052769062 9:32670848-32670870 TGTGTCTCAGTTCTGAGCTGGGG - Intergenic
1053043051 9:34891029-34891051 TGTGGCTCTTTCCAGGGCTGTGG - Intergenic
1053122150 9:35555456-35555478 TGTGGCTGTGGGCTGCTCTGGGG - Exonic
1053122345 9:35556460-35556482 AGAGTCCCTGGCCTGAGCTGGGG - Intronic
1053187334 9:36028091-36028113 TGTGCCTGTGGTCTTAGCTGAGG - Intergenic
1053278904 9:36804054-36804076 TGAGTCTCAGGGCTGAGCTGGGG + Intergenic
1053532623 9:38897331-38897353 TGTACTTCTGGGCTGAGCTGAGG - Intergenic
1054204846 9:62121752-62121774 TGTACTTCTGGGCTGAGCTGAGG - Intergenic
1054633512 9:67466606-67466628 TGTACTTCTGGGCTGAGCTGAGG + Intergenic
1055410835 9:76027564-76027586 TGTGCCTCTTGCCTGGGCGGGGG - Intronic
1056536036 9:87528664-87528686 TGTTGCCCAGGCCTGAGCTCAGG - Intronic
1058492892 9:105521061-105521083 TGTGGCTTTGGTCTCATCTGCGG - Intronic
1058679077 9:107425643-107425665 TTTGTCTCTGGCCTGCTCTGCGG - Intergenic
1060409563 9:123391035-123391057 TGTGACAGTGGCCTGAACTGCGG - Intronic
1060553063 9:124494799-124494821 TGTGCCTCTGGCCCCAGGTGGGG - Intronic
1060725224 9:126001908-126001930 TGTGGCTTTGGCCGGGGCTGAGG + Intergenic
1060824503 9:126680156-126680178 TGGGCCTCTGGCCTGGGCTGGGG - Intronic
1061067151 9:128285669-128285691 TGTGACCCTGGCCACAGCTGAGG - Intronic
1061441365 9:130606225-130606247 TGTGTTACTGACCTGAGCTGGGG + Intronic
1061488824 9:130934133-130934155 TGAGGCTCTGGCCTGAGGCAGGG - Intronic
1061872809 9:133529695-133529717 TGTGGCTGTGGCCTGAGGTCAGG - Intergenic
1062307796 9:135919572-135919594 TGCAGCCCTGGCCTGAGCTGAGG - Intergenic
1062479189 9:136743644-136743666 TGTGTCTCTTGCCTGGGCAGGGG - Intergenic
1062567079 9:137168179-137168201 TGTGGCTCAGGCTGGTGCTGCGG - Exonic
1062674383 9:137731874-137731896 TCTGGCTCTGTGCAGAGCTGTGG + Intronic
1062708265 9:137957195-137957217 TCTGGCCCTGACCTGAGCGGTGG - Intronic
1185566583 X:1099661-1099683 TGTGGCCCTGGCCTGGGTTCAGG + Intergenic
1186511971 X:10136234-10136256 TGTGGCTTTGGCAATAGCTGGGG - Intronic
1186676703 X:11824801-11824823 TGTGGCTCAGCCCTGATCTCTGG - Intergenic
1187131277 X:16505487-16505509 CATGGCTCTGCCCTGAGCTTAGG - Intergenic
1187403771 X:18984531-18984553 TGTTTCTCTGGCCTTGGCTGTGG - Exonic
1188002269 X:24994109-24994131 TGTGGCTCTGGCCTGCCGGGAGG + Intronic
1189484700 X:41421197-41421219 GGTGGCACTGGGCAGAGCTGGGG + Intergenic
1190144060 X:47874497-47874519 TGTGGCTCTTGCCTGGGCACAGG + Intronic
1191206233 X:57836279-57836301 TGTACTTCTGGGCTGAGCTGAGG - Intergenic
1191224721 X:58031218-58031240 AGTGGCTCTGAGCTCAGCTGTGG + Intergenic
1192210769 X:69126425-69126447 TGTGTCTCAGGGCTGAGGTGAGG - Intergenic
1192261517 X:69508595-69508617 GGTGGGTCTGGCCTCAGTTGAGG - Intronic
1195208063 X:102624397-102624419 TGTGGCTCTGGGGTGATCTCAGG + Intergenic
1195368687 X:104151563-104151585 TGTGTCTCTGACCTGAAGTGGGG - Intronic
1197513111 X:127395763-127395785 TGTACTTCTGGGCTGAGCTGAGG + Intergenic
1197710467 X:129663173-129663195 TGTGGAGCTGGGCTGGGCTGGGG - Intergenic
1197775565 X:130116716-130116738 TGTGGCCTTGGCCTGTACTGGGG + Intergenic
1200213409 X:154356840-154356862 TGTGGATCTGGCCAGGGCTGGGG + Intronic
1200243292 X:154508723-154508745 TGTGGCTCAGGCCGAGGCTGGGG + Intronic
1200695221 Y:6352634-6352656 TATACCTCTGGGCTGAGCTGGGG - Intergenic
1200928820 Y:8678679-8678701 TGTGGCTCTGGTCAGTTCTGGGG - Intergenic
1200947710 Y:8863291-8863313 GGTGGCTTAGGCCTGACCTGTGG + Intergenic
1201040056 Y:9822076-9822098 TATACCTCTGGGCTGAGCTGGGG + Intergenic
1201568843 Y:15393008-15393030 TGTACTTCTGGGCTGAGCTGAGG - Intergenic
1201649177 Y:16266165-16266187 TGTACTTCTGGGCTGAGCTGAGG - Intergenic
1201653632 Y:16319135-16319157 TGTACTTCTGGGCTGAGCTGAGG + Intergenic
1201716739 Y:17052803-17052825 TCTGCCTCTGGCCAGTGCTGAGG + Intergenic
1201753443 Y:17460023-17460045 TGTTGCTCTGGTCTGTACTGAGG - Intergenic
1201767737 Y:17588319-17588341 TGTGGCTTTGGACTGAGCCTTGG + Intergenic
1201833816 Y:18317666-18317688 TGTGGCTTTGGACTGAGCCTTGG - Intergenic
1201848110 Y:18445960-18445982 TGTTGCTCTGGTCTGTACTGAGG + Intergenic
1201910853 Y:19132322-19132344 TGTACTTCTGGGCTGAGCTGAGG + Intergenic
1201989786 Y:20010750-20010772 TGTACTTCTGGGCTGAGCTGAGG - Intergenic