ID: 954129782

View in Genome Browser
Species Human (GRCh38)
Location 3:48554533-48554555
Sequence GTGGAACTGAAATGTGGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 211}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954129782_954129787 13 Left 954129782 3:48554533-48554555 CCAGAGCCACATTTCAGTTCCAC 0: 1
1: 0
2: 0
3: 8
4: 211
Right 954129787 3:48554569-48554591 AGAAACACAAGCCCTGCCTCAGG 0: 1
1: 0
2: 2
3: 49
4: 276
954129782_954129784 -10 Left 954129782 3:48554533-48554555 CCAGAGCCACATTTCAGTTCCAC 0: 1
1: 0
2: 0
3: 8
4: 211
Right 954129784 3:48554546-48554568 TCAGTTCCACACTTAGAGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954129782 Original CRISPR GTGGAACTGAAATGTGGCTC TGG (reversed) Intronic
902970832 1:20047324-20047346 GAGGAACTGAGCTGTGGCTTAGG - Intronic
904031484 1:27536176-27536198 GCAGAATTTAAATGTGGCTCTGG - Intronic
906377455 1:45306649-45306671 GAGGAACTGAGCTGTGGCCCAGG - Intergenic
908901836 1:68964683-68964705 GTGGAAATGAAGTGTGTATCAGG + Intergenic
909062930 1:70900007-70900029 GTGTCACTGAAGTGTGGCTGAGG - Intronic
909083727 1:71147053-71147075 GTGGAAGGGAAATGTGGCATTGG + Intergenic
911692517 1:100850593-100850615 GTAGTTCTGAAATGTGGCCCAGG + Intergenic
913173738 1:116255489-116255511 GAGGAGCTGAAGTGTGGCTGGGG - Intergenic
913218091 1:116637265-116637287 TTTGAACTGAAATTGGGCTCAGG + Intronic
913702373 1:121385445-121385467 GTGGATCTGAGAGTTGGCTCAGG + Intronic
914042936 1:144065941-144065963 GTGGATCTGAGAGTTGGCTCAGG + Intergenic
914135150 1:144894547-144894569 GTGGATCTGAGAGTTGGCTCAGG - Intronic
916018658 1:160774073-160774095 GCGGAACTGAAATGTCCATCAGG + Intergenic
916246037 1:162689124-162689146 GTGGATCTGGACTGTGGCTCGGG + Intronic
916549424 1:165835731-165835753 GTGGAACTGAAATATGATTGAGG - Intronic
917439245 1:175052190-175052212 GTGGGACTGAAGTGTGAGTCTGG + Intergenic
920489800 1:206404187-206404209 GTGGATCTGAGAGTTGGCTCAGG + Intronic
920838783 1:209536439-209536461 GTCTCACTGAAATGTGGATCTGG - Intergenic
924273579 1:242361327-242361349 GTGGAAATTAAATGAGGCTAAGG - Intronic
1065866665 10:29920621-29920643 CTAGAACTCAAATATGGCTCCGG - Intergenic
1066711139 10:38235329-38235351 GTGGAAATTAAATGAGGCTAAGG + Intergenic
1068092661 10:52452061-52452083 ATGGAACTGGAATGTGCTTCAGG + Intergenic
1070018712 10:72562084-72562106 GTGGAACTGAAACTTCGCTGAGG + Intronic
1076648508 10:131971075-131971097 GAGGCACTGACATGTGCCTCTGG - Intronic
1077510028 11:2954447-2954469 GTGGCCCTGAATTGTGGCTTAGG - Intronic
1080151478 11:29056986-29057008 GTGGAAGGGAAATGTGGCGTTGG + Intergenic
1080924480 11:36741941-36741963 GTGCCCCTGAAATGTGGCTAAGG + Intergenic
1087831703 11:102826086-102826108 GTGGAAGTGAAATGTGGGGTTGG - Intergenic
1088331560 11:108659280-108659302 GGGAAACTGAAATCTGGTTCTGG + Intergenic
1088783203 11:113156049-113156071 CTGGAATTGGAAAGTGGCTCTGG + Intronic
1089051796 11:115552094-115552116 GTGGCTCTGAAATGTGGCCACGG - Intergenic
1089126337 11:116179081-116179103 GTGGACCTGAATTGTGGAGCTGG - Intergenic
1090333380 11:125947757-125947779 GTGGAGCTGGCCTGTGGCTCAGG + Intergenic
1096972930 12:55681996-55682018 GTAGAACTGAAAGTTGGCTCCGG - Exonic
1097688692 12:62714181-62714203 GAGCAACTGAGATGTGGCTAGGG + Intronic
1098761014 12:74425219-74425241 CTGGAACTGAATAGTGTCTCAGG + Intergenic
1099838505 12:87937389-87937411 GTGGAAGGGAAATGTGGAGCTGG + Intergenic
1099890959 12:88587715-88587737 GTGGTACTGAAATCTGCTTCTGG + Intergenic
1101054452 12:100897712-100897734 GAGGAACTGAAATGTGTCAAGGG + Intronic
1101214073 12:102563352-102563374 GTGGGACTGCAAAGTGACTCTGG - Intergenic
1101723647 12:107372420-107372442 GTTGAATTGAATTTTGGCTCAGG - Intronic
1101785731 12:107881723-107881745 CTGAAACTGAAATGTTCCTCTGG + Intergenic
1103463169 12:121121404-121121426 AAGGTACTGGAATGTGGCTCAGG - Intergenic
1109865659 13:68260321-68260343 TTGGAACAAAAATGTGTCTCAGG - Intergenic
1111903567 13:94229700-94229722 GTGGAACTGCAAGGTTGCACAGG - Intronic
1112872683 13:103994127-103994149 GTAGATCTGAAATGGGACTCCGG + Intergenic
1113007986 13:105729546-105729568 GTGCAACTGAGATGTGTCCCTGG - Intergenic
1115573922 14:34692962-34692984 GTGGAACTCAAATCTGTCCCTGG - Intergenic
1116246720 14:42424688-42424710 GTGGATCTGGAATGCAGCTCAGG + Intergenic
1116419254 14:44713968-44713990 AAGGAACTCAAATGTGGCCCAGG + Intergenic
1121445437 14:93975681-93975703 TGGAAAGTGAAATGTGGCTCTGG - Intronic
1123215967 14:106809729-106809751 CTGGAACTCAGGTGTGGCTCTGG - Intergenic
1125225342 15:37389523-37389545 GTGGAGGTGAAATGTGGGTTTGG - Intergenic
1125335935 15:38626327-38626349 TTTGTACTGAAATGTAGCTCAGG + Intergenic
1126431125 15:48586255-48586277 GAGCAACTGAAATGTGGGTGGGG + Intronic
1126474492 15:49051687-49051709 GTGGAAGGGAAATGTGGGGCGGG - Intergenic
1126857614 15:52854181-52854203 TCAGAACTGAAAGGTGGCTCTGG + Intergenic
1129296706 15:74603869-74603891 GGGTAACTCAAATGTGGCACAGG + Intronic
1129668402 15:77592601-77592623 GAGGAAATGACATGAGGCTCAGG + Intergenic
1130824761 15:87532717-87532739 GTGGAAGGGAAATGTGGGTTTGG - Intergenic
1134096455 16:11422021-11422043 GGAGAACTGAAATGTGTCACTGG - Intronic
1137918115 16:52455261-52455283 GTGGTACTGACATTTGGGTCTGG + Intronic
1138110301 16:54318509-54318531 GGGGAAGGGAACTGTGGCTCAGG + Intergenic
1139972893 16:70787254-70787276 GTGGTCCTGAAATGTGACTGAGG + Intronic
1140323518 16:73977489-73977511 GAGCACCTGAAATGTGGCTAGGG + Intergenic
1141237792 16:82235356-82235378 GTTGAACTGTAATGTAGGTCTGG + Intergenic
1141574115 16:84953191-84953213 GTGGAAGGGAAATGGGGCTTTGG - Intergenic
1143041878 17:4044257-4044279 GTGAATCTGAAATTTGGGTCTGG + Exonic
1144257211 17:13480860-13480882 ATGGAACTGGAGTGGGGCTCTGG - Intergenic
1144870126 17:18364204-18364226 GTGGTCCTGACATGTGGCCCCGG - Intergenic
1147054609 17:37824757-37824779 GTGGCACTGAACTGTGGCGCAGG + Intergenic
1151322932 17:73362329-73362351 GTGGAGCTGGAGTGGGGCTCAGG - Intronic
1153354242 18:4118281-4118303 GTGGAACAGAAGTGCTGCTCAGG - Intronic
1157943809 18:51956736-51956758 GTGGAACAGAGCTATGGCTCTGG + Intergenic
1159962392 18:74565864-74565886 GTGGAAGGGAAATGTGGCGTTGG - Intronic
1160736401 19:664453-664475 GTGGAACTCAAGGGTGACTCTGG + Intergenic
1161536728 19:4823966-4823988 GGGCACCTGAAATGTGGCTGTGG + Intronic
1162999319 19:14356197-14356219 GTGGAAATGAGGTGTGGCTGGGG + Intergenic
1163064812 19:14785155-14785177 GTGGAAATGAGGTGTGGCTGGGG - Intergenic
1163722938 19:18906830-18906852 GTGGTGCTGAAATGAGGCCCTGG - Intronic
1163834765 19:19566427-19566449 GGGATACTGAAATGTGGCCCTGG - Intronic
1165231527 19:34390275-34390297 GGGGAACAGAAATGTAGCTGTGG + Intronic
1165315365 19:35052093-35052115 GCAGAACTGAAATCTGCCTCTGG - Intronic
1165318334 19:35070763-35070785 GTGGAGCAGAAATGAGGCTGGGG - Intergenic
1166487885 19:43229307-43229329 TTGGAACTAAAATTTGGCTATGG + Intronic
925808154 2:7672865-7672887 GTGGAACTCAAAGGTGACTAAGG + Intergenic
926088816 2:10036843-10036865 GTGGCACTGCAGTGTGGTTCGGG + Intergenic
931092770 2:58903984-58904006 GTGGAAAAGAACTGTGGCACAGG + Intergenic
935332146 2:101985204-101985226 CTGGACCTGAGATGTGGCCCTGG + Intergenic
936736210 2:115446308-115446330 GTGGAAGGGAAATGTGGATTTGG + Intronic
937020351 2:118644905-118644927 CTGTAACTGAAATGTGGATAAGG - Intergenic
939829104 2:147051125-147051147 GAGGAACTAGAATGTGGCACAGG - Intergenic
941297099 2:163752948-163752970 GTGCAAATGAAATGTGACACTGG + Intergenic
942553799 2:177150176-177150198 GTGGAACTGAAATTTGAACCTGG + Intergenic
944529883 2:200656894-200656916 GTGGAATTGAAATGGGGCAGGGG + Exonic
945756767 2:213856481-213856503 GTGGAAGGGAAATGTGGGTTTGG - Intronic
1169803543 20:9536000-9536022 GTGGAACCAAAATGAGACTCAGG - Intergenic
1169959308 20:11141282-11141304 GTGGAACAGAACTTTGACTCTGG + Intergenic
1170760656 20:19247615-19247637 GTGGAATTGACATGTGCCTTAGG + Intronic
1172056811 20:32159854-32159876 GTGGGCCTGGCATGTGGCTCTGG - Intronic
1172396898 20:34613885-34613907 GTGGCACTGCAAACTGGCTCAGG + Intronic
1172874564 20:38156372-38156394 GTGGAACTGAGCCTTGGCTCTGG - Intronic
1173228487 20:41175998-41176020 GTGGAACTGGAAAGGGGCTCTGG - Intronic
1175189159 20:57199552-57199574 GTGGGTCTGAAATGGAGCTCAGG + Intronic
1175551547 20:59821207-59821229 GTGGAGCTGAGATGTGACCCAGG + Intronic
1176783431 21:13226836-13226858 GTGGAAGGGAAATGTGGGGCTGG + Intergenic
1179531083 21:42020178-42020200 GTGGAACTGATATTTGGGTGGGG - Intergenic
1179678169 21:42998984-42999006 ATGGAAGGGAAATGTGGCACTGG - Intronic
1180252227 21:46597227-46597249 ATGGAACTGGAAGGTGCCTCTGG + Intergenic
1180667503 22:17525706-17525728 GAGGAATTTAAATGTGGCACTGG - Intronic
1181508144 22:23375593-23375615 GTAGGCCTGGAATGTGGCTCTGG - Intergenic
1181608726 22:23998654-23998676 GTGGAGCTGAATATTGGCTCTGG - Intergenic
1182248824 22:28983281-28983303 CTGGCAATGAAATGTGGCCCAGG + Intronic
1183337129 22:37256272-37256294 CTGGAACTGAAGAGTGGCCCAGG - Intergenic
1183434230 22:37783991-37784013 GAGCAGCTGGAATGTGGCTCTGG - Intergenic
1183782219 22:40006310-40006332 GGGGAGCTGAGATGTGGCTTGGG - Intronic
951162760 3:19445827-19445849 ATGGAACTGCAATGTGCCTCTGG - Intronic
952637181 3:35546180-35546202 TTGGGACTAAAATGTGTCTCGGG + Intergenic
953519105 3:43624182-43624204 GGGGTATTGAAATGTGGCTAAGG - Intronic
953606837 3:44417950-44417972 ATGGAACTGAAATCTGCCCCTGG + Intergenic
954129782 3:48554533-48554555 GTGGAACTGAAATGTGGCTCTGG - Intronic
954865945 3:53729714-53729736 CTGGAACTGCAATGAGCCTCGGG + Intronic
956127115 3:66021191-66021213 GTGTACCTGTAATGTGGCTGAGG - Intronic
956657455 3:71566351-71566373 GGGGAACGAGAATGTGGCTCAGG - Intronic
956902460 3:73730813-73730835 TAGGAACTGAAAGGTGGCCCTGG + Intergenic
958160119 3:89808505-89808527 GTGGAAGGGAAATGTGGGGCTGG - Intergenic
960019456 3:112932703-112932725 ATGGAACTGATATGTAGGTCTGG - Intronic
960587231 3:119331226-119331248 GTGCTACAGAAATGTGACTCGGG - Intronic
961979235 3:131059059-131059081 GTGTAACTGATCTGTGGTTCAGG + Intronic
963174055 3:142280354-142280376 TTGGAACTAAAATTTGGTTCTGG - Intergenic
963433714 3:145241782-145241804 GTGGAAAGGAAATGTGGATTAGG - Intergenic
964320948 3:155496612-155496634 GTGGAACCGAAATGTAAATCAGG - Intronic
967861684 3:194156820-194156842 GAGCACCTGAAATGTGGCTAGGG - Intergenic
968561359 4:1284768-1284790 GAGGACCTGACCTGTGGCTCAGG - Intergenic
969618304 4:8266346-8266368 ATGGAACAGCAGTGTGGCTCTGG + Intergenic
970362163 4:15321047-15321069 GTGGTCCTGATATGGGGCTCTGG - Intergenic
970758114 4:19450818-19450840 GTGGAAGGGAAATGTGGCGTTGG - Intergenic
972033666 4:34493829-34493851 GTGGAAGGGAAATGTGGGACTGG + Intergenic
972071037 4:35019681-35019703 GTGGCAATGAGATGTGGCTGTGG + Intergenic
974213299 4:58811134-58811156 GTGGAACTGACCAGTGCCTCAGG + Intergenic
975614293 4:76231029-76231051 TTGGAACAAAAATGTGTCTCAGG + Intronic
976672912 4:87673877-87673899 GTGGAAGGGAAATGTGGGTTTGG - Intergenic
976963881 4:91011854-91011876 GTGGAACACAATTGTGGCTTGGG + Intronic
977042805 4:92035826-92035848 GAGGAACTGAGCTGTGGCACAGG + Intergenic
979071743 4:116216365-116216387 CTGGATCTGAGATTTGGCTCAGG + Intergenic
979645681 4:123065066-123065088 GTTGAACAAAAAAGTGGCTCAGG - Intronic
979841428 4:125446426-125446448 GTGGAACTGGAAAGAGGCTCTGG - Exonic
980313437 4:131164833-131164855 TTGGAACAGAAATGTGGGTGAGG + Intergenic
980661333 4:135862927-135862949 GTGAAACTGAAATCTGTATCAGG - Intergenic
981487509 4:145302568-145302590 CTGGATCTGAAAATTGGCTCAGG + Intergenic
982390894 4:154862826-154862848 GTGGAAGGGAAATGTGGGTTTGG - Intergenic
983285799 4:165737481-165737503 TTGTAACTAAAATCTGGCTCAGG - Intergenic
986062331 5:4203182-4203204 GTGGGGCTGGAATGTGGCTGGGG - Intergenic
987070346 5:14331110-14331132 TTGGAACAGAAATGTGACTTGGG + Intronic
987493342 5:18610579-18610601 GTGGAAGATAAATGTAGCTCAGG + Intergenic
991355729 5:65767163-65767185 GGGGAAGGGAAATGTGGCACAGG - Intronic
993383073 5:87230639-87230661 GTGCAAATGAAATGTATCTCTGG + Intergenic
993887544 5:93433850-93433872 GTGCAACTGAAATGAGGCATAGG - Intergenic
997052428 5:130398579-130398601 GTGGAACGGAAATGTGGGGTTGG + Intergenic
997225880 5:132209081-132209103 GTGGACCTGGACTCTGGCTCTGG - Intronic
999277695 5:150342561-150342583 GTGGAGCTGGAATGTGGTCCTGG - Intergenic
1000385737 5:160673058-160673080 GTGGAAGTGCTCTGTGGCTCTGG + Intronic
1009729339 6:67579388-67579410 GTGGAAAGGAAATGTGGGACCGG + Intergenic
1009814499 6:68714283-68714305 TTGGAACTAAAATGTTGCTTAGG - Intronic
1010138858 6:72588806-72588828 GTGAAACTGAACTGTGGTTTTGG - Intergenic
1012826344 6:104151516-104151538 GTGGAAGGGAAATGTGGGTTTGG - Intergenic
1013549176 6:111190486-111190508 GTGGAAGGGAAATGTGGGACTGG - Intronic
1013701280 6:112773080-112773102 GAGGAATTGAAATGTAGATCAGG + Intergenic
1013915886 6:115336439-115336461 GTGGAAGGGAAATGTGGGGCTGG + Intergenic
1020631821 7:10649350-10649372 GTGGAAGTGAAATGTGGGGTCGG - Intergenic
1021795742 7:24252318-24252340 GTGGAAGTGAAAAGTGGAGCAGG - Intergenic
1021976309 7:26014005-26014027 GTTGAACTGAATTTTGCCTCTGG - Intergenic
1022141011 7:27492685-27492707 GTGAAACTGAGGTGAGGCTCTGG + Intergenic
1023579813 7:41669829-41669851 GTGGACCTAAATTGAGGCTCGGG - Intergenic
1025093782 7:56082632-56082654 ATGGAACAGAAATGGCGCTCGGG + Intronic
1026687090 7:72520349-72520371 GTAGATCTGAGATGAGGCTCTGG + Intergenic
1032329464 7:130964157-130964179 GTGGAAGTGAAATTTGGCAAGGG - Intergenic
1032420636 7:131776266-131776288 GTGGGACCGAGATGTGGCTTAGG - Intergenic
1034116482 7:148588493-148588515 GTGGAACTGAGGTGTGGCTGGGG - Intergenic
1036828790 8:12003328-12003350 GTGAAACAGCAATGTGGCTGTGG + Intergenic
1036834016 8:12043281-12043303 GTGAAACAGCAATGTGGCTGTGG + Intergenic
1036855862 8:12289846-12289868 GTGAAACAGCAATGTGGCTGTGG + Intergenic
1038183231 8:25248426-25248448 GTGGAACTGAAGGGTGACACTGG + Intronic
1040517989 8:48149986-48150008 GAGGCACTAAAATGGGGCTCAGG - Intergenic
1041902474 8:62997064-62997086 GTGGAAAGGAAGTGTGGCGCTGG - Intronic
1043145431 8:76648069-76648091 GTGGAAGTGAAATGTGGAGTTGG + Intergenic
1045993692 8:108339136-108339158 GTGGAAGGGAAATGTGGGGCTGG - Intronic
1046038075 8:108868045-108868067 GTGGGAGTGAGATGGGGCTCAGG - Intergenic
1046400429 8:113697637-113697659 GTGGAAGGAAAATGTGGCTTTGG + Intergenic
1047226644 8:122960676-122960698 GGGGAACTGAAAGGTGGCCATGG + Intronic
1047628354 8:126679309-126679331 GTTGAACTGAGATTTGGCTGTGG - Intergenic
1047679357 8:127238154-127238176 CTGGATTTAAAATGTGGCTCAGG - Intergenic
1048046122 8:130774995-130775017 GTGGAAGTGAAATGTGGGGTTGG + Intergenic
1048260261 8:132939122-132939144 GGGGAGCTGAGATGTGGCCCTGG + Intronic
1051915057 9:22198363-22198385 GTGGAAGGGAAATGTGGAGCTGG + Intergenic
1052150898 9:25114194-25114216 GTGGAACTGACATGGAGCTTGGG - Intergenic
1052929939 9:34048326-34048348 GTAGAACTGAACTGTGACTCCGG + Intronic
1055482808 9:76726446-76726468 TTGGAACTAAAATGGGGCTTTGG - Intronic
1057948632 9:99352055-99352077 GTGGGACTGAAGAGTGGCACAGG + Intergenic
1058101817 9:100925091-100925113 GTGGAAGGGAAATGTGGGGCTGG + Intergenic
1061614746 9:131772427-131772449 GTGGAGCTGACATGGGGCCCTGG + Intergenic
1061987614 9:134138780-134138802 TTGGAACTGAAATCTTGCACAGG - Intronic
1062022065 9:134324579-134324601 GTGGACCTGCAATCTGGCCCAGG + Intronic
1186706487 X:12145493-12145515 GCCCAACTGAATTGTGGCTCAGG + Intronic
1188062468 X:25618110-25618132 GTGGAAGGGAAATGTGGGGCTGG - Intergenic
1189176542 X:38963351-38963373 GTGGAAGAGAAATGTGGGTTTGG - Intergenic
1192439533 X:71164460-71164482 GTGGAAGAGAAATGTTTCTCTGG + Intronic
1193199520 X:78671987-78672009 ATGGAAGTGAAATGAGGCTTGGG + Intergenic
1193556474 X:82960391-82960413 GTGGAACTCAAACCTGCCTCAGG - Intergenic
1194149299 X:90303691-90303713 GTGGAACTGAGCTTTGGCTTAGG + Intergenic
1197151288 X:123222712-123222734 GTGAATCTGAAATGTTGCTAGGG + Intronic
1197594367 X:128449016-128449038 GTGGAAGGGAAATGTGGGTTTGG - Intergenic
1198380276 X:136077145-136077167 CTGCAACTGACATGTGGCTGAGG + Intergenic
1199166377 X:144680041-144680063 GAGGAACTGAACTGTGGCCTAGG - Intergenic
1199523104 X:148759801-148759823 GTGGAAGTGAAATGAAGCACAGG - Intronic
1200495674 Y:3880421-3880443 GTGGAACTGAGCTTTGGCTTAGG + Intergenic
1200900230 Y:8424128-8424150 GTGAAATTTATATGTGGCTCTGG - Intergenic
1202270440 Y:23066995-23067017 TTGGGACAAAAATGTGGCTCAGG + Intergenic
1202295587 Y:23353687-23353709 TTGGGACAAAAATGTGGCTCAGG - Intergenic
1202447355 Y:24969346-24969368 TTGGGACAAAAATGTGGCTCAGG - Intergenic