ID: 954129784

View in Genome Browser
Species Human (GRCh38)
Location 3:48554546-48554568
Sequence TCAGTTCCACACTTAGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 110}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954129777_954129784 19 Left 954129777 3:48554504-48554526 CCGTGATGGCACGAGCCCCTCAG 0: 1
1: 0
2: 0
3: 17
4: 106
Right 954129784 3:48554546-48554568 TCAGTTCCACACTTAGAGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 110
954129776_954129784 28 Left 954129776 3:48554495-48554517 CCTGAGACACCGTGATGGCACGA 0: 1
1: 0
2: 0
3: 2
4: 37
Right 954129784 3:48554546-48554568 TCAGTTCCACACTTAGAGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 110
954129775_954129784 29 Left 954129775 3:48554494-48554516 CCCTGAGACACCGTGATGGCACG 0: 1
1: 0
2: 0
3: 3
4: 32
Right 954129784 3:48554546-48554568 TCAGTTCCACACTTAGAGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 110
954129781_954129784 2 Left 954129781 3:48554521-48554543 CCTCAGCTCAGGCCAGAGCCACA 0: 1
1: 1
2: 6
3: 49
4: 465
Right 954129784 3:48554546-48554568 TCAGTTCCACACTTAGAGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 110
954129779_954129784 4 Left 954129779 3:48554519-48554541 CCCCTCAGCTCAGGCCAGAGCCA 0: 1
1: 0
2: 6
3: 32
4: 337
Right 954129784 3:48554546-48554568 TCAGTTCCACACTTAGAGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 110
954129782_954129784 -10 Left 954129782 3:48554533-48554555 CCAGAGCCACATTTCAGTTCCAC 0: 1
1: 0
2: 0
3: 8
4: 211
Right 954129784 3:48554546-48554568 TCAGTTCCACACTTAGAGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 110
954129780_954129784 3 Left 954129780 3:48554520-48554542 CCCTCAGCTCAGGCCAGAGCCAC 0: 1
1: 0
2: 4
3: 35
4: 327
Right 954129784 3:48554546-48554568 TCAGTTCCACACTTAGAGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954129784 Original CRISPR TCAGTTCCACACTTAGAGCC TGG Intronic
900112336 1:1013693-1013715 TCAGGAGCACACTTAGAACCTGG - Intronic
900469958 1:2848894-2848916 TCAGTTCCACACTCCCACCCAGG - Intergenic
900470190 1:2849720-2849742 TCAATTCCACACTTCCACCCAGG - Intergenic
907834938 1:58099807-58099829 TCAGTTCCACACTTATTTTCTGG - Intronic
908081399 1:60582685-60582707 TCAGTTACACACTTAAAGATGGG + Intergenic
910761251 1:90733857-90733879 TTAAATCCACACTTAGAGACAGG - Intergenic
912250570 1:108008238-108008260 TCAGATCCACAGATAGTGCCAGG + Intergenic
920728625 1:208461732-208461754 TCAGATTCATACTTGGAGCCAGG + Intergenic
921677343 1:217990900-217990922 TCAGTTCTGCCCTTAGACCCAGG - Intergenic
1063692557 10:8300882-8300904 TAAATTCAACACTTACAGCCAGG - Intergenic
1068947736 10:62746585-62746607 ACAGTACCACCCTTAGATCCAGG + Intergenic
1078490571 11:11764212-11764234 TAAGCTTCACACTCAGAGCCTGG + Intergenic
1079321332 11:19454069-19454091 TAAGTTGCAGACTCAGAGCCCGG - Intronic
1086433691 11:86760420-86760442 TCAAATCCAAACTTAGGGCCGGG - Intergenic
1089661013 11:119985263-119985285 TCAGTTTCCCACTCAGAGCCAGG - Intergenic
1091109631 11:132953744-132953766 GCAGGTCCAGATTTAGAGCCTGG - Intronic
1091519043 12:1217538-1217560 TCTGTTCCACATTTAGAGGCAGG - Intronic
1093117333 12:15226937-15226959 TCAGATCCACCCTTAGTCCCAGG - Intronic
1093775015 12:23063705-23063727 TCAATTTTACACCTAGAGCCTGG + Intergenic
1094126191 12:27024434-27024456 TGAATTCAACACTTAGAGGCTGG - Intronic
1094493660 12:30976566-30976588 TCAGTACCACACGCAGACCCAGG + Intronic
1096478160 12:51921218-51921240 CCAGTCCCAGACTCAGAGCCCGG + Intronic
1102019425 12:109671403-109671425 TCACTTCTGGACTTAGAGCCTGG - Intergenic
1108249906 13:48553965-48553987 TCATTTCCCCACTTAGAACCAGG - Intergenic
1108317427 13:49250444-49250466 TCACTTCCCCATATAGAGCCTGG - Intronic
1108417409 13:50212292-50212314 GCAGTTGCACAATTAGAACCTGG - Intronic
1110073654 13:71211140-71211162 TTCTTTCCACACTTAGAGCTGGG + Intergenic
1110274889 13:73632359-73632381 TCAGTACCACTCCTAGACCCAGG + Intergenic
1110937857 13:81315999-81316021 TCAGATGCAAACTTAGAGACAGG - Intergenic
1117498332 14:56327809-56327831 TCATTCCCACACTTGGAGCCAGG + Intergenic
1118854846 14:69612483-69612505 TCAGATCCACACTCATAGCTGGG - Intronic
1119766962 14:77196280-77196302 CCAGCTCCCCACTTTGAGCCTGG + Intronic
1125172476 15:36781435-36781457 TCAGGGTCACACTTGGAGCCTGG + Intronic
1135161457 16:20100359-20100381 TGAGTACCACACTTAGATCTGGG - Intergenic
1135510883 16:23081887-23081909 TCAGATACAAACTAAGAGCCAGG + Intronic
1136031336 16:27505461-27505483 TCAGTGCCACACTTAGGGAGGGG - Intronic
1136559710 16:31032000-31032022 GGAGATCCACACTTAGAGACAGG + Intergenic
1137768011 16:50992690-50992712 CCTGTTCCACACTCAGAGCCAGG - Intergenic
1138203607 16:55108034-55108056 ACAGCTCCAAAGTTAGAGCCAGG - Intergenic
1140122253 16:72093837-72093859 ACCGTTCCACACTTGGATCCAGG + Exonic
1148397221 17:47318792-47318814 GCAGTTCTACACTCAAAGCCTGG + Intronic
1156123137 18:33869492-33869514 TCATTTACAAACTTAGAGCCTGG - Intronic
1161216364 19:3096848-3096870 TCAGTGCCACGCAGAGAGCCGGG + Intronic
1161516665 19:4700221-4700243 TGAGTTCCAGACTGACAGCCAGG - Exonic
1163130265 19:15268057-15268079 TCAGTTCTAAACTGAGAGCCTGG + Intronic
1163635910 19:18437215-18437237 TCAGTTCCAGGCTCACAGCCAGG + Intronic
1164112198 19:22177501-22177523 TTAGTACATCACTTAGAGCCAGG + Intergenic
1164625197 19:29723258-29723280 GCAGTTCCAGACTCTGAGCCTGG - Intergenic
1165570821 19:36773212-36773234 TGAGTTCCAAACTAACAGCCAGG - Exonic
925866713 2:8234545-8234567 TCAGCTCCACACTGAGAGGAAGG + Intergenic
928268469 2:29832752-29832774 GCAGTGCCTCACTCAGAGCCTGG - Intronic
936572279 2:113627077-113627099 TCAGTACCACACCCACAGCCAGG + Intergenic
944004496 2:194887066-194887088 TGATTTCCAAACTTAGAGTCTGG + Intergenic
945724081 2:213453697-213453719 TCAGTGCCACACTCACTGCCTGG - Intronic
946342523 2:219080086-219080108 TAGGTTCCACATTTAGACCCAGG - Intronic
948266945 2:236642037-236642059 ACAGTTCCACCCTGAGAGCAAGG - Intergenic
948483951 2:238268212-238268234 ACAGTTCCCAACTTAGAGCGTGG - Intronic
1170676859 20:18490206-18490228 TCAGTTCTAGACTTACAGCTTGG + Intronic
1171252010 20:23655928-23655950 TCACTTCCTCACTGAGAGACTGG + Intergenic
1172333051 20:34089327-34089349 TCAGTTTCTCAGTCAGAGCCCGG + Exonic
1172675761 20:36670502-36670524 TCAGCTCCACACTTACAATCTGG + Intronic
1173072826 20:39785925-39785947 TCATTTCCATACTTACAGGCTGG - Intergenic
1173363568 20:42365947-42365969 TCCCTTCCACACTGAGTGCCAGG + Intronic
1173821710 20:46023846-46023868 TGAGTTCCAGACCCAGAGCCTGG + Intronic
1175642426 20:60642243-60642265 TTTGTTGCACACTTTGAGCCAGG - Intergenic
1176942467 21:14940534-14940556 TCAGTGCCACAGTAACAGCCAGG + Intergenic
1178114265 21:29401168-29401190 TCTATTCCACACTTGGAGCAAGG - Intronic
1184381052 22:44145179-44145201 TTAGTTCCACACCAAGAGCGAGG + Intronic
1184996024 22:48208220-48208242 TTATTTCCACACCTCGAGCCTGG + Intergenic
1185419454 22:50727415-50727437 TCATTGCCACACACAGAGCCTGG - Intergenic
954129784 3:48554546-48554568 TCAGTTCCACACTTAGAGCCTGG + Intronic
955193784 3:56786090-56786112 ACATGTCCACACTTAGAACCAGG + Intronic
961056044 3:123789579-123789601 TCATTTCCACCTTTAGACCCAGG - Intronic
962841072 3:139233091-139233113 TCAGTTTCCCACTTAGAACATGG + Intronic
963729454 3:148957363-148957385 TAACTTCCACACATAGAGCAGGG + Intergenic
964824665 3:160811947-160811969 TCAGTGCCACACCAAGTGCCTGG - Intronic
965319685 3:167237508-167237530 TCAGTTCCATAGTTAGAACCAGG + Intergenic
967018540 3:185502855-185502877 ACAGTCCCACATTTATAGCCTGG + Intergenic
973553141 4:52055262-52055284 TCAGTTCTACACTTATAACGTGG + Intronic
978476540 4:109137541-109137563 TCATTTCCCCACCTAGAGTCTGG + Intronic
978661345 4:111130445-111130467 TAAGTTCCACACTTTCAGGCAGG - Intergenic
981856883 4:149305487-149305509 TCACTTCCACTTTTAGAGACTGG - Intergenic
983914327 4:173275348-173275370 TCAGTTCCCCACTCAGAGCTCGG - Intronic
987348170 5:16997247-16997269 GCAGTTCCACACCCAGAGGCAGG - Intergenic
987421742 5:17728867-17728889 CCAGATCCAGACCTAGAGCCTGG - Intergenic
995603534 5:113825509-113825531 TCAGAACCACACCTAGTGCCTGG - Intergenic
999528919 5:152440085-152440107 TCAGTTTCAAACTGAGAGACAGG - Intergenic
1003030747 6:2598444-2598466 TTAATTCTACACTTAGAGCAAGG + Intergenic
1003153973 6:3575710-3575732 TCAGTACCACTCTTTGATCCAGG + Intergenic
1003198818 6:3939868-3939890 TCAGCTCCACAGATGGAGCCTGG - Intergenic
1003495756 6:6661849-6661871 CCTGTTACACAATTAGAGCCTGG - Intergenic
1006391826 6:33763145-33763167 TGAGGTCCTCACTCAGAGCCTGG + Intergenic
1006454199 6:34122687-34122709 TCAGTTCCACACCAAGGCCCCGG + Intronic
1010042498 6:71402280-71402302 TCAGTTCCAGACCCAGGGCCTGG + Intergenic
1012369323 6:98483563-98483585 TCATTCCCACACTCATAGCCAGG + Intergenic
1016280650 6:142414464-142414486 TCCGCACCACCCTTAGAGCCTGG + Intronic
1018473981 6:164122361-164122383 GCATTTCCACACTTTGAGGCGGG - Intergenic
1028857558 7:95608849-95608871 TCAGTCCCACACCCACAGCCTGG + Intergenic
1031174763 7:118336471-118336493 TGAGTACCAGACTTGGAGCCAGG - Intergenic
1031454348 7:121960989-121961011 TCAGTACCTTTCTTAGAGCCTGG - Intronic
1037252418 8:16912102-16912124 TCAGTTGTATACTCAGAGCCTGG + Intergenic
1037598202 8:20372312-20372334 GCAGTTCCACACTCTGAGCAGGG + Intergenic
1042188112 8:66157011-66157033 TCAGATCCACAATTAGGTCCTGG - Intronic
1042620789 8:70701451-70701473 TCTGTTTCTCTCTTAGAGCCAGG + Intronic
1049264067 8:141657462-141657484 TCAGGGCCACACATACAGCCTGG + Intergenic
1049833981 8:144721231-144721253 TCTGTACCACACTTGGAGGCAGG + Exonic
1053437157 9:38083545-38083567 TCATTTGCACACTTTGAGTCAGG + Intergenic
1055689189 9:78811158-78811180 GCAGTACTACACTTAGAGCATGG - Intergenic
1057339703 9:94188963-94188985 TCAGGTCAAAACTCAGAGCCAGG + Intergenic
1057367536 9:94437074-94437096 TCCATCCCACACTTGGAGCCTGG - Intronic
1057655792 9:96950979-96951001 TCCATCCCACACTTGGAGCCTGG + Intronic
1061814688 9:133187662-133187684 TCAGCTCCAGAGGTAGAGCCCGG - Intergenic
1061895670 9:133646054-133646076 TCACTTCAAAACTTGGAGCCGGG - Intronic
1187988458 X:24841777-24841799 TCAGTTCCACATGTAGGGCATGG - Exonic
1192493643 X:71598385-71598407 TCATTCCCACACATAGAGCGGGG - Intronic
1194268158 X:91779732-91779754 TGAGGTCCACACTTAGTGCGCGG + Intronic
1197807970 X:130415648-130415670 CCAGTTACACACTTAGGGCTAGG + Intergenic
1198579753 X:138049990-138050012 TCATTTCCACCCTTTCAGCCTGG - Intergenic
1199440356 X:147860894-147860916 TCAGTTCAACTCTGAAAGCCTGG - Intergenic
1200585359 Y:5000653-5000675 TGAGGTCCACACTTAGTGCGCGG + Intronic