ID: 954132355

View in Genome Browser
Species Human (GRCh38)
Location 3:48567135-48567157
Sequence AAGGGTGACCAGGGCGAGAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 4, 3: 12, 4: 201}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954132355_954132365 5 Left 954132355 3:48567135-48567157 CCTTTCTCGCCCTGGTCACCCTT 0: 1
1: 0
2: 4
3: 12
4: 201
Right 954132365 3:48567163-48567185 CTGGCTGCCCGTCAAAGCCTCGG 0: 1
1: 0
2: 2
3: 9
4: 114
954132355_954132369 15 Left 954132355 3:48567135-48567157 CCTTTCTCGCCCTGGTCACCCTT 0: 1
1: 0
2: 4
3: 12
4: 201
Right 954132369 3:48567173-48567195 GTCAAAGCCTCGGTCACCCTGGG 0: 1
1: 0
2: 1
3: 6
4: 82
954132355_954132368 14 Left 954132355 3:48567135-48567157 CCTTTCTCGCCCTGGTCACCCTT 0: 1
1: 0
2: 4
3: 12
4: 201
Right 954132368 3:48567172-48567194 CGTCAAAGCCTCGGTCACCCTGG 0: 1
1: 0
2: 0
3: 3
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954132355 Original CRISPR AAGGGTGACCAGGGCGAGAA AGG (reversed) Exonic
901258992 1:7857275-7857297 AAGGGTGAGTAGGGAGAGGAAGG - Intergenic
901445878 1:9307903-9307925 GAGGGGGACCATGGCGAGGAGGG - Intronic
901643355 1:10704308-10704330 AAGGGGCACCAGGGAGAGAAAGG + Intronic
902540209 1:17149210-17149232 TAGCGTGAGCAGGGTGAGAAAGG + Intergenic
902835310 1:19043425-19043447 AGGGGTGGCCCTGGCGAGAAAGG + Intergenic
903358296 1:22761683-22761705 AAGGGTTGCCAGGGAGAGAGAGG - Intronic
903384653 1:22918448-22918470 TAGGGTGACCAGGGCAGGGATGG - Intergenic
903651928 1:24927778-24927800 GAGGGTGACCAGGGAAAGGAGGG + Intronic
904789777 1:33010726-33010748 AAGGGTGGTCAGGGTGAGGATGG - Intronic
904841319 1:33373659-33373681 GAGGGTGACCAGTGGGAGAAGGG - Intronic
904855918 1:33498246-33498268 AAGGGTGACCAAGTGGAGAGAGG - Intergenic
904929455 1:34074824-34074846 AAGGGTGTCCTGGGCAAGGAAGG + Intronic
905732126 1:40304510-40304532 CAGGGTGACCAAGGCGAGAGGGG - Exonic
907372847 1:54014261-54014283 AATGGTGACCAAGGCGATGAGGG + Exonic
907890298 1:58630738-58630760 AAGGGTGGTCAGGGTGAGGATGG - Intergenic
910870339 1:91827545-91827567 AAGGATGAGCAGGGAGAGACAGG + Intronic
912688049 1:111782402-111782424 AAGGGGGACCTGGGAGAGAAAGG + Intronic
913083474 1:115412236-115412258 AAGGGTGACAAGTGTAAGAAGGG - Intergenic
915588282 1:156856854-156856876 AAGAGAGTCCAGGGAGAGAAAGG - Intronic
915860392 1:159437920-159437942 TAGGGTGACCAAGGTGAGCAAGG - Intergenic
916322825 1:163523607-163523629 AAAGGGGGGCAGGGCGAGAAGGG - Intergenic
916561130 1:165934887-165934909 AAGGGGCAACAGGGAGAGAAAGG + Intergenic
916746031 1:167685481-167685503 AAGGTAGACCTGGGCCAGAATGG + Exonic
918139585 1:181709265-181709287 AAGAGTGACCAGGGCCAGTGAGG - Intronic
919851616 1:201676692-201676714 AAGGTTCGCCAGGGCCAGAAAGG - Intronic
924265472 1:242277209-242277231 AGGGGAGACCAAGGCAAGAAAGG + Intronic
1066453294 10:35550514-35550536 CAGGGAGGCCAGGGAGAGAAGGG - Intronic
1066459875 10:35603733-35603755 AAAGGTGACCAGGATGAGAAGGG + Intergenic
1066719355 10:38321267-38321289 AGGGGAGACCAAGGCAAGAAAGG - Intergenic
1067785126 10:49240222-49240244 AAGGGAGAACATGGCAAGAAGGG - Intergenic
1069315573 10:67096701-67096723 AAGCATGACCATGGTGAGAAGGG - Intronic
1069530542 10:69215556-69215578 GAGGGTGACTCGGGTGAGAAAGG - Intergenic
1069900199 10:71702525-71702547 TGGGAAGACCAGGGCGAGAAGGG - Intronic
1070407639 10:76111206-76111228 AAAGGTGACAAGGGCTAGGAAGG - Intronic
1070743907 10:78920963-78920985 TAGGGAGTCCAGGGCTAGAAGGG - Intergenic
1071602051 10:86963099-86963121 AAGGGTGGCCAGGGAGACGAGGG - Exonic
1071986516 10:91056674-91056696 AAGTGTGACCAGGGTGATAATGG - Intergenic
1073036104 10:100565173-100565195 AAGGGTGGCCAGGGTGAGGCTGG + Intergenic
1073243978 10:102076517-102076539 AGGGGTGACCAGGGCTTGACAGG - Intergenic
1073512247 10:104050106-104050128 TTAGGTGACCAGGGTGAGAAAGG - Exonic
1073547453 10:104362996-104363018 AAAGTTGACCATGGGGAGAATGG - Intronic
1075343948 10:121668694-121668716 AAGGGAGGCCAGGGGGAGAGGGG + Intergenic
1075609129 10:123837064-123837086 AAGGAAGACCAGGACAAGAAAGG - Intronic
1077477734 11:2798251-2798273 AAAGGTGACCAGGAGGGGAAGGG - Intronic
1077501475 11:2911484-2911506 CAGGGTGGCCAGGGTGAGGAAGG + Intronic
1078411305 11:11121712-11121734 AAGAGGGACCAGGGCTAAAATGG - Intergenic
1081492923 11:43581170-43581192 AAGTGTGTGGAGGGCGAGAAGGG - Intronic
1081838591 11:46178178-46178200 AAGAGGGCCCAGGGCAAGAAAGG + Intergenic
1084734067 11:71093173-71093195 AATGTTGACCAGGCCGAGGAAGG - Intronic
1089212388 11:116814285-116814307 AGTGGTGACCAGGGAGATAATGG + Intergenic
1091303303 11:134521621-134521643 AGGGGTGGCCAGGGAGAGGAGGG - Intergenic
1095117498 12:38372436-38372458 AAGAGTGACCAAGGCTATAAGGG - Intergenic
1096157380 12:49348019-49348041 AAGTGGGAGCAGGGCGAGACGGG + Exonic
1096567143 12:52491444-52491466 TTGGGTGACCAGGGCCAGAAGGG - Intronic
1099277856 12:80600992-80601014 AAGAGTGTCCAGGAGGAGAATGG - Intronic
1099293481 12:80801823-80801845 AAGGGTGATCGGGGAAAGAAAGG - Intronic
1109507891 13:63331009-63331031 AAGGGTGGGAAGGGTGAGAAGGG - Intergenic
1110749387 13:79095060-79095082 AAGGGGGACAAGGCAGAGAAGGG - Intergenic
1112514927 13:100045117-100045139 AAGGGTGAACAGGCCTAGCAGGG + Intergenic
1113421820 13:110176884-110176906 AAAGGAGACCAAGGAGAGAAAGG - Exonic
1113450852 13:110408229-110408251 AAGGGTCCCCAGGGCGGGGAGGG + Intronic
1114254303 14:20988744-20988766 ATGGGTGGACAGGGGGAGAAGGG - Intergenic
1117483351 14:56170361-56170383 AAGGGAAACCAGAGCAAGAAGGG - Intronic
1118636010 14:67749452-67749474 TGGGGAGACCAGGGCCAGAAAGG - Intronic
1118794770 14:69131896-69131918 AATGGTGTCTAGGGGGAGAATGG - Intronic
1122587287 14:102817625-102817647 AAGGGTGACAAGGGGGAAAGAGG + Intronic
1125719843 15:41840090-41840112 AAGGGTGACAGGGGCCACAAAGG - Intronic
1127230264 15:56984295-56984317 AAGGGTGGAGAGGGAGAGAAAGG + Intronic
1127982307 15:64044373-64044395 CAGGATCACCAGGGTGAGAAGGG + Intronic
1128576059 15:68775950-68775972 AAGGGTGAGCAGGCCAAGGAGGG - Intergenic
1128757552 15:70193825-70193847 GAGGGGGAGCAGGGGGAGAAGGG + Intergenic
1128791238 15:70435425-70435447 CAGGGTGACGAGGGTGGGAAAGG + Intergenic
1131599250 15:93830037-93830059 AAGGGAGAAGAGGGGGAGAAAGG - Intergenic
1133125567 16:3643649-3643671 AAAGGGGACCAGGGGAAGAAAGG + Intronic
1134684595 16:16149898-16149920 CAGGGTGGACAGGGCGAGATGGG + Exonic
1135674305 16:24402286-24402308 AAGGGAGGCCAGGGCAAGCAAGG + Intergenic
1137569619 16:49557143-49557165 GAGAGTGACCAGGGCGTGCAGGG + Intronic
1139258208 16:65563754-65563776 AAGGGTGATGAGGGTGAGGAGGG - Intergenic
1139418877 16:66836017-66836039 AATGAGGACCAGGGTGAGAAGGG - Intronic
1139625694 16:68187045-68187067 AAGGGTGAGCAGAGTGGGAAGGG + Intronic
1141226290 16:82119229-82119251 AAGACTCACCAGGGCAAGAAAGG - Intergenic
1143562329 17:7703424-7703446 GATGATCACCAGGGCGAGAAAGG + Exonic
1146955225 17:36933355-36933377 AAGAGTGACAAGGCCGTGAAAGG - Intergenic
1147185299 17:38710175-38710197 ATGGGTGAGCAGCGGGAGAATGG + Intronic
1147570263 17:41566167-41566189 AAGGGAGATGAGGGGGAGAAGGG + Intronic
1147611313 17:41803286-41803308 AAGGGTGACGAGGCCGAGGCTGG - Exonic
1148698480 17:49575038-49575060 AGGGGTCACCAGGCCGAGAGTGG - Intergenic
1148731612 17:49840129-49840151 AAGGGAGAGCAGAGGGAGAATGG - Intronic
1151501808 17:74494823-74494845 GAGGATGCCCAGGGAGAGAATGG - Intergenic
1152528482 17:80903113-80903135 AAGGGAGGGGAGGGCGAGAAAGG + Intronic
1152572006 17:81125040-81125062 CAGGGTGAGCAGGGTGAGCAGGG + Intronic
1152631328 17:81411855-81411877 AAGAGTGACCAGGGTGTGGAGGG - Intronic
1153632603 18:7086440-7086462 AAGGATGAATAGGGCGTGAATGG - Intronic
1154196850 18:12273156-12273178 AAGGCTGGCCACGGCGAGGAGGG + Intronic
1154388833 18:13919113-13919135 GAGGGTGACCTTGGCCAGAATGG + Intergenic
1155399210 18:25419774-25419796 TATGGTGACCAGGGAGGGAAGGG - Intergenic
1158345935 18:56517286-56517308 AAGGGTGACCATGGAGAGAATGG - Intergenic
1161165181 19:2783035-2783057 AAGGGAGATCAGGGCTCGAAGGG + Intronic
1163827870 19:19533621-19533643 AGGGGTGAGGAGGGAGAGAATGG - Intronic
1166231502 19:41427698-41427720 TAGAGTGACCAGGGCGAGGCAGG + Intronic
1166317806 19:41998648-41998670 GAGGGTGCCGCGGGCGAGAAGGG - Exonic
1166547093 19:43640014-43640036 AGGGGTGAGGAGGGCGGGAAGGG + Intergenic
926706727 2:15842733-15842755 AGGGGTGGCCAGAGCCAGAAGGG - Intergenic
927203675 2:20593705-20593727 AACTGTGACCAGGGTGAGAGCGG - Intronic
929883557 2:45858562-45858584 AAGGGTGCCCAGGGGCTGAAAGG - Intronic
931058867 2:58503919-58503941 CAGGGTGAGCAGGGTGAGCAGGG + Intergenic
933994481 2:87657835-87657857 AAGAGTGACCAGGTGGAGAGAGG + Intergenic
934947130 2:98550171-98550193 AGGGGTGACCAGGCCCAGATTGG - Intronic
936299377 2:111293078-111293100 AAGAGTGACCAGGTGGAGAGAGG - Intergenic
937062639 2:118991854-118991876 AAGGGAGACCAGGGAGTGAAAGG + Exonic
937286534 2:120757692-120757714 GAGGGAGACCAGGGTAAGAAGGG - Intronic
943731381 2:191306689-191306711 AAGGGGGATCAGAGGGAGAAAGG + Intronic
944088435 2:195876169-195876191 AAGTGTGATTAGGGTGAGAAGGG + Intronic
944606273 2:201354443-201354465 AAAGGAGTCCAGGGCTAGAAAGG + Intronic
945949061 2:216021579-216021601 AGGGGTGACTAGGGTGAGAGGGG - Intronic
948375121 2:237516123-237516145 AAGGGTGTCCAGGGGCAGCAAGG + Intronic
1172169597 20:32920979-32921001 AGGGGTGTCCAGGGTCAGAAAGG - Intronic
1172391177 20:34566477-34566499 AGGGGTGACCAGGGACAGACAGG + Intronic
1173033342 20:39382538-39382560 AAGGATGACAAGGGCAAAAAGGG - Intergenic
1174230323 20:49040961-49040983 AAGGGTGACTTGGGTCAGAAAGG - Intergenic
1174353477 20:49983652-49983674 TTGGGTGACCTGGGCGAGGAGGG + Intronic
1175431577 20:58908411-58908433 CAGGATGGCTAGGGCGAGAAGGG + Intronic
1175807505 20:61838011-61838033 AACGGTGAGCAGGCAGAGAAAGG - Intronic
1175999950 20:62827238-62827260 CAGGGTGACCGAGGCGAGAGGGG + Exonic
1176723564 21:10412585-10412607 GAGGGTGGCCAGTGGGAGAAGGG - Intergenic
1179797545 21:43794189-43794211 AGTGGAGACCAGGGCGGGAAAGG + Intronic
1180147306 21:45928595-45928617 AGGGGTGGCCAGGGCAAGCATGG + Intronic
1180304723 22:11065357-11065379 GAGGGTGGCCAGTGGGAGAAGGG - Intergenic
1180796710 22:18609328-18609350 GAGGGTGACCAGGCCGACACTGG + Exonic
1181225014 22:21385943-21385965 GAGGGTGACCAGGCCGACACTGG - Exonic
1181253618 22:21548870-21548892 GAGGGTGACCAGGCCGACACTGG + Exonic
1181387917 22:22558391-22558413 AAGGCGGGCCAGGGCGGGAATGG + Intronic
1182554091 22:31119658-31119680 CAGGGTGACCAGGGAGAGAAAGG + Intronic
1182718601 22:32379028-32379050 ATGGCTGACCAGGGAGAGAGGGG + Intronic
1183324168 22:37182627-37182649 AAGGGTGACAAGGGGGAGATGGG - Exonic
1184889962 22:47373624-47373646 AAGGGAGGCCAGGAGGAGAAGGG + Intergenic
1184889968 22:47373642-47373664 AAGGGAGGCCAGGAGGAGAAGGG + Intergenic
1185171544 22:49297422-49297444 AAGGGTGACGAGGGCGAGGCGGG + Intergenic
949877173 3:8633962-8633984 ACGGGTGCCCAGCGTGAGAACGG + Intronic
950543658 3:13626656-13626678 AAGGGTGGCCAGGGCAGGACAGG - Intronic
950550152 3:13661402-13661424 ACGGGTGACTAGGGGGTGAAGGG + Intergenic
951202424 3:19890242-19890264 AAGGGTGCAGAGGGAGAGAATGG - Intronic
952278721 3:31902871-31902893 AAGGGTGAGCAGGGTGAAACAGG - Intronic
954114702 3:48459973-48459995 CAGGCTGGCCAGGGCCAGAAAGG - Intronic
954132355 3:48567135-48567157 AAGGGTGACCAGGGCGAGAAAGG - Exonic
957521005 3:81318344-81318366 AAGGGTCCCCAGGGCAAGTAGGG + Intergenic
959992199 3:112642062-112642084 AAATGTGACCAGGGCAAGATGGG - Intronic
960476310 3:118133237-118133259 AGGGGTGAGCAGGAAGAGAAGGG + Intergenic
961382600 3:126505573-126505595 AAGGGTGGCCTGGGCAAGGAAGG + Intronic
962595250 3:136935625-136935647 AAGAGTGACCATAGTGAGAAGGG + Intronic
968206561 3:196807505-196807527 AAGTGTGACCAGGTCTAAAATGG - Intronic
969134828 4:5021149-5021171 AATGGAGGCCAGGTCGAGAAGGG - Intergenic
971266411 4:25099833-25099855 AAGGGTGTCTATGGGGAGAAGGG - Intergenic
974699530 4:65422440-65422462 AAGGTTGAGCAGGCAGAGAATGG - Intronic
974831993 4:67201119-67201141 AATGGTGGCCTGGGCCAGAAAGG - Intergenic
984634635 4:182097635-182097657 CAGGGTGACCCAGGAGAGAAGGG - Intergenic
985147001 4:186903621-186903643 TAGGGAGAGCAGGGCGGGAAGGG - Intergenic
986796926 5:11221831-11221853 AAGTGTCACCAGGAGGAGAAAGG + Intronic
987142448 5:14960001-14960023 AGGGGTGGCTTGGGCGAGAAGGG + Intergenic
988737097 5:34033386-34033408 AAAGGTGAGAAGGGCGACAAAGG - Exonic
999545273 5:152622500-152622522 AAGGGTGACCAGGATGATGATGG - Intergenic
1000186669 5:158865180-158865202 AAGGGTGAACAGGATGGGAAGGG - Intronic
1002965363 6:1960776-1960798 TAGGGTGACCGGGGATAGAAAGG + Exonic
1005882116 6:30069821-30069843 AAGGGTTAGCAGGAGGAGAAGGG - Exonic
1006295101 6:33166772-33166794 CCGGGTGAGCAGGGAGAGAAGGG - Exonic
1006295594 6:33168722-33168744 AAGGGTGACCGAGGCGAGGATGG - Exonic
1006301625 6:33196465-33196487 AAGAGTGACCAGGGCGTTGAGGG - Exonic
1010110136 6:72217911-72217933 AAGGGAAACAAGGGCCAGAAGGG - Intronic
1010750285 6:79609753-79609775 AAAGGTGACCAGGCTGAGACAGG - Intergenic
1011837904 6:91456826-91456848 AAGGAAGACCAGGGGAAGAATGG - Intergenic
1011919556 6:92555676-92555698 AAGGGAGACCAGAACAAGAAAGG - Intergenic
1013210681 6:107983976-107983998 AAGGGGGAGCAGACCGAGAAAGG + Intergenic
1017052613 6:150407779-150407801 AAAGGTGAAGAGGGAGAGAATGG + Intergenic
1019415081 7:923366-923388 AGGGGTGATCAGGGCGAGTGAGG - Intronic
1020371849 7:7440842-7440864 TAGGGTGACGAAGGCAAGAAAGG - Exonic
1020839844 7:13202377-13202399 AAGGGTCTCCAGGGGAAGAAAGG - Intergenic
1030130019 7:106191558-106191580 AAGGATGACCAGAGAAAGAAAGG - Intergenic
1033551477 7:142451819-142451841 CAGGGTCACCAGGGAGAGACGGG - Intergenic
1034679199 7:152915789-152915811 GAGGGTGAGAAGGGGGAGAAGGG - Intergenic
1036623347 8:10443862-10443884 CAGGGTGGCCAGAGAGAGAAAGG + Intergenic
1037631067 8:20656864-20656886 AAGGGTGAGGAGGGCAGGAAGGG - Intergenic
1037635104 8:20694554-20694576 AGGGGTGAGCAGGAGGAGAAAGG - Intergenic
1041685282 8:60638994-60639016 AGTGGTGACCAGGGCAAGAGGGG + Intergenic
1044958020 8:97502076-97502098 AAGGGTGAGAAGTGGGAGAAGGG + Intergenic
1047835006 8:128679905-128679927 AAGGGTGTCCAGGGAGAGGGAGG - Intergenic
1049348797 8:142153103-142153125 AAGGTTGCCCAGGTAGAGAAAGG - Intergenic
1049795949 8:144497318-144497340 AAGGAGGCCCAGGGCAAGAAGGG + Exonic
1053485921 9:38456211-38456233 AAGGGTGAGGAGGGCAGGAAAGG + Intergenic
1053654050 9:40197578-40197600 GAGGGTGACGAGGAGGAGAAAGG + Intergenic
1054366165 9:64343794-64343816 GAGGGTGACGAGGAGGAGAAAGG + Intergenic
1054673795 9:67833524-67833546 GAGGGTGACGAGGAGGAGAAGGG + Intergenic
1055057482 9:72037199-72037221 AGTGGAGACCAGGGCAAGAAAGG + Intergenic
1059438079 9:114288452-114288474 CAGGGGGAGCAGGGCGAGGACGG + Exonic
1059709863 9:116857705-116857727 AAGGGCTACCAGAGCCAGAAAGG - Intronic
1060119431 9:120974301-120974323 ATGTATGACCAGGGCCAGAAGGG + Intronic
1060763315 9:126274572-126274594 AAGGGTGACCAGGCCGAGACTGG + Intergenic
1061736524 9:132664308-132664330 AAGGGTGACCAAGATGATAAAGG - Intronic
1062118133 9:134820149-134820171 CCGGGTGAACAGGGTGAGAAGGG + Exonic
1062255724 9:135619855-135619877 AAGGGGGAGAAGGGGGAGAAGGG - Intergenic
1062255798 9:135620042-135620064 AAGGGGGAGTAGGGGGAGAAGGG - Intergenic
1062255890 9:135620264-135620286 AAGGGTGAGAAGGGGGAGATGGG - Intergenic
1062255916 9:135620336-135620358 AAGGGAGAGAAGGGGGAGAAGGG - Intergenic
1062273811 9:135721410-135721432 AAAGGGCCCCAGGGCGAGAAGGG - Intronic
1062616369 9:137398348-137398370 AAGGGGGTCCAGGGTGAGCAGGG - Intronic
1062671445 9:137712204-137712226 AGGGGTGACCAGGGAGAGAAGGG - Intronic
1185734337 X:2485725-2485747 AAGGGAGAAAAGGGAGAGAAGGG + Intronic
1185734350 X:2485773-2485795 AAGGGAGAAAAGGGAGAGAAGGG + Intronic
1186606463 X:11097963-11097985 AAGGGTTACCAGGATGAGCAAGG + Intergenic
1186717868 X:12272417-12272439 GAGGGTGACCAGGGAGAGGACGG + Intronic
1188874823 X:35416848-35416870 AAGGGTCACCAGGCAGAGTAGGG + Intergenic
1188953559 X:36407165-36407187 AAGGGTCACCAGGAAGAGTAGGG - Intergenic
1190261564 X:48800970-48800992 AATAGTGCCCAGGGCCAGAATGG - Intergenic
1192496142 X:71617758-71617780 AAGGGAGAGCAGGGAGAGAGAGG - Intronic
1192510211 X:71716896-71716918 GAGGGAGAGGAGGGCGAGAAGGG + Intronic
1192516486 X:71764657-71764679 GAGGGAGAGGAGGGCGAGAAGGG - Intronic
1198264643 X:134998114-134998136 AAGGGTAAGCAGGGGGAAAATGG - Intergenic
1199790381 X:151149144-151149166 AAGGGTGAGTCGGGGGAGAAGGG - Intergenic
1201549927 Y:15209215-15209237 AAGGGGGAGCAGGGAGAGGAGGG + Intergenic