ID: 954133135

View in Genome Browser
Species Human (GRCh38)
Location 3:48570118-48570140
Sequence ACTCACGGTGGGTCCCGCTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 55}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954133135_954133145 -1 Left 954133135 3:48570118-48570140 CCCCAGCGGGACCCACCGTGAGT 0: 1
1: 0
2: 0
3: 3
4: 55
Right 954133145 3:48570140-48570162 TCCTCGGGGTCCCTCCTGGCCGG 0: 1
1: 0
2: 4
3: 25
4: 173
954133135_954133147 0 Left 954133135 3:48570118-48570140 CCCCAGCGGGACCCACCGTGAGT 0: 1
1: 0
2: 0
3: 3
4: 55
Right 954133147 3:48570141-48570163 CCTCGGGGTCCCTCCTGGCCGGG 0: 1
1: 0
2: 4
3: 18
4: 299
954133135_954133144 -5 Left 954133135 3:48570118-48570140 CCCCAGCGGGACCCACCGTGAGT 0: 1
1: 0
2: 0
3: 3
4: 55
Right 954133144 3:48570136-48570158 TGAGTCCTCGGGGTCCCTCCTGG 0: 1
1: 0
2: 0
3: 13
4: 142
954133135_954133154 19 Left 954133135 3:48570118-48570140 CCCCAGCGGGACCCACCGTGAGT 0: 1
1: 0
2: 0
3: 3
4: 55
Right 954133154 3:48570160-48570182 CGGGGCGGCCATCTTCACCCTGG 0: 1
1: 0
2: 0
3: 5
4: 87
954133135_954133155 23 Left 954133135 3:48570118-48570140 CCCCAGCGGGACCCACCGTGAGT 0: 1
1: 0
2: 0
3: 3
4: 55
Right 954133155 3:48570164-48570186 GCGGCCATCTTCACCCTGGATGG 0: 1
1: 0
2: 1
3: 12
4: 116
954133135_954133148 1 Left 954133135 3:48570118-48570140 CCCCAGCGGGACCCACCGTGAGT 0: 1
1: 0
2: 0
3: 3
4: 55
Right 954133148 3:48570142-48570164 CTCGGGGTCCCTCCTGGCCGGGG 0: 1
1: 0
2: 2
3: 20
4: 192
954133135_954133149 4 Left 954133135 3:48570118-48570140 CCCCAGCGGGACCCACCGTGAGT 0: 1
1: 0
2: 0
3: 3
4: 55
Right 954133149 3:48570145-48570167 GGGGTCCCTCCTGGCCGGGGCGG 0: 1
1: 0
2: 1
3: 37
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954133135 Original CRISPR ACTCACGGTGGGTCCCGCTG GGG (reversed) Exonic