ID: 954133431

View in Genome Browser
Species Human (GRCh38)
Location 3:48571199-48571221
Sequence CTCACGACCAGGACCCCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 147}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954133425_954133431 17 Left 954133425 3:48571159-48571181 CCCTTTGAGGAAAAGAGGCATCG 0: 1
1: 0
2: 1
3: 43
4: 625
Right 954133431 3:48571199-48571221 CTCACGACCAGGACCCCAGCAGG 0: 1
1: 0
2: 0
3: 17
4: 147
954133423_954133431 26 Left 954133423 3:48571150-48571172 CCTGGGTCACCCTTTGAGGAAAA 0: 1
1: 0
2: 2
3: 21
4: 142
Right 954133431 3:48571199-48571221 CTCACGACCAGGACCCCAGCAGG 0: 1
1: 0
2: 0
3: 17
4: 147
954133426_954133431 16 Left 954133426 3:48571160-48571182 CCTTTGAGGAAAAGAGGCATCGG 0: 1
1: 0
2: 0
3: 15
4: 155
Right 954133431 3:48571199-48571221 CTCACGACCAGGACCCCAGCAGG 0: 1
1: 0
2: 0
3: 17
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954133431 Original CRISPR CTCACGACCAGGACCCCAGC AGG Intronic
900208174 1:1440340-1440362 TTCATGCCCAGGACACCAGCTGG + Exonic
900329341 1:2126331-2126353 GCCCCGACCACGACCCCAGCCGG - Intronic
900432280 1:2607963-2607985 CTCAGGACCGGCAGCCCAGCCGG - Intronic
900575539 1:3380522-3380544 CTCGGGACCAGGACCCCTGGGGG + Intronic
902080993 1:13820649-13820671 CCCACTCCCAGGACCCCAGGAGG - Intronic
906824263 1:48961874-48961896 CTCACATCCAGGTCCACAGCGGG + Intronic
915282127 1:154829797-154829819 CTCAGCACCAGGAACCCCGCTGG + Intronic
917446283 1:175108367-175108389 CACCAGACCAGGAGCCCAGCTGG + Intronic
917728329 1:177848939-177848961 CTGCCCACCAGGACCTCAGCAGG + Intergenic
919070705 1:192751540-192751562 CACCCCACCAGGAGCCCAGCTGG - Intergenic
919136807 1:193519871-193519893 CTTATGAACAGGACCCCAGAAGG - Intergenic
919425624 1:197426714-197426736 CTCCCAACCAGGACCACAGAAGG + Intronic
921175031 1:212586043-212586065 CCCACGGGCAGGACCCCAGAGGG - Intronic
922675373 1:227546187-227546209 CTCAGGCCCGGGACCTCAGCGGG - Intergenic
923645319 1:235814741-235814763 TTCACAACCAGGACACCAGAAGG - Intronic
1066672682 10:37857327-37857349 CTGACCACCAGGGCCCCTGCTGG - Exonic
1067145355 10:43689919-43689941 TTCACGACGAGGACCCCAAGGGG - Intergenic
1067276328 10:44838361-44838383 CTCTGCACTAGGACCCCAGCTGG - Intergenic
1070959983 10:80491910-80491932 ATCACTACCAGGAACCCAGTGGG - Intronic
1072157955 10:92741024-92741046 CTCACTAACAGGGCTCCAGCTGG + Intergenic
1074477255 10:113784486-113784508 CTAATAACAAGGACCCCAGCTGG - Intergenic
1076495929 10:130897959-130897981 CTGCCCACTAGGACCCCAGCTGG - Intergenic
1079450563 11:20597264-20597286 CTCAGGCCCAGGGCCGCAGCTGG + Intergenic
1084196002 11:67523875-67523897 CTCCCTGCCAGGACCCCAGCTGG + Intergenic
1085053722 11:73392476-73392498 CTTCCCACCTGGACCCCAGCTGG - Intronic
1085758132 11:79218411-79218433 TACATGACTAGGACCCCAGCAGG - Intronic
1089757820 11:120699293-120699315 CTCAAGAGCAGGACCCCTGGAGG - Intronic
1090004025 11:122984488-122984510 CGCGCGGCCAGGACCCGAGCAGG + Intergenic
1091721979 12:2820469-2820491 ATCAGGACCTAGACCCCAGCTGG + Intronic
1096710581 12:53452444-53452466 CTCGTGACTAGGACCCGAGCCGG - Intronic
1101982853 12:109422548-109422570 CTGACGGCCATGACCCCAGAGGG - Intronic
1103950077 12:124545650-124545672 CTCAGGGCCCTGACCCCAGCCGG - Intronic
1122418022 14:101559701-101559723 TGCAGGACCAGGGCCCCAGCGGG - Intergenic
1123105872 14:105840816-105840838 CCCAGGGCCATGACCCCAGCTGG - Intergenic
1128760475 15:70213200-70213222 CACACGAGCAGGACCCTTGCTGG + Intergenic
1129079094 15:73023822-73023844 AACAACACCAGGACCCCAGCAGG + Intergenic
1131264308 15:90906639-90906661 CTCACTACCAGGACAAGAGCTGG + Intronic
1132607855 16:800935-800957 CTCTCCACCAGGGCCCAAGCTGG - Intergenic
1132664321 16:1074641-1074663 CCCACGACGGGGACCACAGCGGG - Intergenic
1132934037 16:2472111-2472133 CTCAGGACCATGGCCGCAGCTGG + Exonic
1133806396 16:9128639-9128661 GGCACCACCAGGACCCCACCTGG - Intergenic
1134054880 16:11163766-11163788 CTCCCGACAATGACCCCGGCTGG - Intronic
1136040025 16:27571519-27571541 CTCAGGACCAGATCCCCAGGAGG + Intronic
1136393127 16:29977776-29977798 CTCCCGGCCCGGCCCCCAGCTGG - Exonic
1137756397 16:50905840-50905862 CTCACACCCAGGAAGCCAGCAGG + Intergenic
1140818070 16:78638949-78638971 CCCACTACCAGCACCCCAGAGGG - Intronic
1141469597 16:84229448-84229470 CACAGGGCCAGGAGCCCAGCAGG + Intronic
1144522859 17:15965770-15965792 GCCACGGCCAAGACCCCAGCAGG - Intronic
1145302409 17:21649846-21649868 CCCAGGACCAGGACCCTGGCTGG + Intergenic
1148357176 17:46983214-46983236 GTCAGGAGCAGGACCCCATCTGG + Intronic
1151702782 17:75752291-75752313 CTCCCGCTCAGGCCCCCAGCCGG - Exonic
1152098890 17:78289398-78289420 CCCACGTCCAGGACCCGAGGAGG - Intergenic
1153825627 18:8871582-8871604 CTCAGGCCCATGGCCCCAGCTGG + Intergenic
1160869766 19:1271856-1271878 GACACAACAAGGACCCCAGCAGG - Intronic
1161220150 19:3114667-3114689 CCCAGGACGAGGACTCCAGCTGG - Intronic
1161742711 19:6033244-6033266 CTCTGGACCAGGACCCAATCTGG + Intronic
1162298328 19:9828424-9828446 CTCACGCCAAGCACCCCTGCGGG - Intronic
1162718689 19:12649079-12649101 CTCCCAACCTGGACCCCTGCTGG - Intronic
1163196956 19:15728623-15728645 CCCACGCCCAGGGCCACAGCTGG - Exonic
1166941988 19:46372899-46372921 CTCAGGAGCAGGAGCCCAGCAGG + Intronic
1167795125 19:51703924-51703946 CTCAGGGCCAGGACTCCAGGGGG + Intergenic
1168100493 19:54138520-54138542 GTCGGGACGAGGACCCCAGCTGG + Intronic
925123740 2:1439086-1439108 CTCAAGACCAGGGCCTCAGCCGG + Intronic
927681038 2:25139200-25139222 CTCACGACCAAGAGCTCAGGGGG + Intronic
929594594 2:43168348-43168370 GTCCCACCCAGGACCCCAGCAGG - Intergenic
931749418 2:65317591-65317613 CTCACAACCAGGGCCACAGATGG - Intronic
932446815 2:71786600-71786622 GTCATGACCAGGACCCTACCTGG + Intergenic
934144400 2:89077466-89077488 CCCCTGACCAGGACACCAGCAGG - Intergenic
934224851 2:90123083-90123105 CCCCTGACCAGGACACCAGCAGG + Intergenic
936618636 2:114073143-114073165 CTCAAGATCAGGAGCCCAGGAGG - Intergenic
938083813 2:128385191-128385213 CTAACCCTCAGGACCCCAGCAGG - Intergenic
938538462 2:132265469-132265491 CCCACGTCCCGGACACCAGCAGG - Intergenic
944149944 2:196547278-196547300 CTCAAGAACAGGACCCTAGGAGG + Intronic
944595187 2:201254764-201254786 CTCAGGACCAGGCCTCCAGGTGG + Intronic
945251247 2:207768171-207768193 CACACGAACGGGCCCCCAGCGGG + Exonic
949044928 2:241868033-241868055 CACACGACCAGGACCACAAGGGG + Intergenic
1170452598 20:16499766-16499788 CTCATGACCAGCACCCCTTCTGG + Intronic
1171448416 20:25220448-25220470 CAGACCCCCAGGACCCCAGCAGG - Intronic
1172800589 20:37573699-37573721 CTCACATCTAGCACCCCAGCTGG - Intergenic
1174052665 20:47778189-47778211 CTCATGGTCAGGACCCCAGCGGG - Intronic
1174287340 20:49482721-49482743 CTCTCCACCAGGCTCCCAGCCGG + Intergenic
1174395851 20:50246510-50246532 CTCACAACCAGGAAGCCAGAGGG - Intergenic
1174487586 20:50871026-50871048 CGCACCTCCTGGACCCCAGCGGG + Intronic
1175404358 20:58717064-58717086 CTCAGGACCAGGGACCCAGCTGG + Intronic
1176512723 21:7760749-7760771 CCCACTAGCAGGACCCCACCTGG + Intronic
1176653140 21:9567672-9567694 CCCAGGACCAGGACCCTGGCTGG + Intergenic
1178646836 21:34391273-34391295 CCCACTAGCAGGACCCCACCTGG + Intronic
1179709579 21:43205538-43205560 CTCCCCACCAGCAGCCCAGCTGG - Intergenic
1179887445 21:44320251-44320273 CTCACAGCTCGGACCCCAGCAGG - Intronic
1180050545 21:45329173-45329195 CTAACAGCCAGGACCCCAGAAGG - Intergenic
1180696464 22:17754290-17754312 CTGACAACAAGGACCCCAGCAGG + Intronic
1180801558 22:18634308-18634330 CTGACCTCCAGGACCCCCGCCGG - Intergenic
1180852796 22:19029850-19029872 CTCACCTCCAGGACCCCCGCCGG - Intergenic
1181220164 22:21360953-21360975 CTGACCTCCAGGACCCCCGCCGG + Intergenic
1181571057 22:23767992-23768014 CTCAGGAACACGCCCCCAGCGGG + Exonic
1182440304 22:30359475-30359497 GTCAAGACCAGGAACACAGCAGG - Intronic
1184778831 22:46636071-46636093 CGCCAGACTAGGACCCCAGCTGG - Intronic
1184784632 22:46665774-46665796 CTCACAACCGTGACCCCAGCTGG + Intronic
1184880076 22:47299176-47299198 CACCCCACCAGGTCCCCAGCAGG + Intergenic
1185271872 22:49933636-49933658 CTGAGGACTAGGACCCCAGGAGG - Intergenic
951614355 3:24524752-24524774 CTCACGACCAGGAACCAAACAGG + Intergenic
952434733 3:33261710-33261732 CTCACGACCAAGACCCCAAAAGG - Intergenic
954133431 3:48571199-48571221 CTCACGACCAGGACCCCAGCAGG + Intronic
955406126 3:58626930-58626952 CCCATGACCAGGGCCCCAACAGG + Intronic
955568570 3:60277092-60277114 CTGACCACCAGGACTTCAGCAGG - Intronic
956174069 3:66456915-66456937 CTGCTGGCCAGGACCCCAGCTGG + Intronic
961418032 3:126775843-126775865 CTGAGGAACATGACCCCAGCAGG - Intronic
962738952 3:138348974-138348996 GCCACGACCAAGACCCCAGTGGG + Intronic
966941825 3:184752716-184752738 CTCACCTCCAGGCCCCCACCTGG - Intergenic
969454938 4:7295342-7295364 CTCCTGGCCAGGACCGCAGCAGG + Intronic
976081041 4:81355320-81355342 ATCCCCACCAGGACTCCAGCTGG - Intergenic
978557239 4:109993880-109993902 CTCACCATCAGCACCCCAGAAGG + Intronic
980396380 4:132221576-132221598 CTCAAGATCAGGTCCCTAGCTGG + Intergenic
980922324 4:139099352-139099374 CTCAGGGCCAGGAACCCAGTAGG - Intronic
983560831 4:169099953-169099975 CTCAAGATCAGGACCTGAGCTGG - Intronic
984453431 4:179933836-179933858 CACACCTCCAGTACCCCAGCTGG - Intergenic
985525489 5:399261-399283 CCAACCACCAGGACCCCGGCAGG + Intronic
985692822 5:1323138-1323160 CTCAGGGCCAGCACCCCACCTGG + Intronic
985692859 5:1323253-1323275 CTCAGGGCCAGCACCCCACCTGG + Intronic
985692896 5:1323369-1323391 CTCAGGGCCAGCACCCCACCCGG + Intronic
985694832 5:1334205-1334227 CCCAGGTCCAGGACCCCTGCAGG + Intronic
991017211 5:61945129-61945151 ATCAAGACCAGGAGCCCAACTGG + Intergenic
993498743 5:88639523-88639545 CTCTCAGCCAGGACCTCAGCTGG - Intergenic
994067097 5:95555372-95555394 CTCACGACCAGCACCACATTGGG - Exonic
995712159 5:115046904-115046926 CTGACAACCAGGAGCCCCGCAGG + Intergenic
997824994 5:137098412-137098434 CTCAGGACCAGTGGCCCAGCAGG + Intronic
999278870 5:150351225-150351247 GACTCGACAAGGACCCCAGCAGG - Intergenic
999825971 5:155274153-155274175 CTCATCCCCTGGACCCCAGCAGG + Intergenic
1002476391 5:179468873-179468895 CTCTCTCCCAGGTCCCCAGCGGG + Intergenic
1003954457 6:11148853-11148875 CTCAACACCAGGACCTCAGGAGG + Intergenic
1011938396 6:92811885-92811907 AACACTACCAGGACCCCATCTGG + Intergenic
1013538719 6:111087435-111087457 CTCCCGGCCACGCCCCCAGCCGG + Intergenic
1018074411 6:160198793-160198815 CTCAGGAGCAGGACTGCAGCTGG + Intronic
1020017195 7:4838062-4838084 CTCACGCCCTGGCCCCCTGCGGG - Intronic
1022834602 7:34101808-34101830 CTCAGGCCCAGGACCCCCTCAGG + Intronic
1023826112 7:44010843-44010865 CTCACGCCCATGATCTCAGCAGG + Intergenic
1026089683 7:67289712-67289734 CTCACGCCCATGATCCCAGCAGG + Intergenic
1026724602 7:72860797-72860819 CTCACGCCCATGATCCCAGCAGG - Intergenic
1027119276 7:75505023-75505045 CTCACACCCATGATCCCAGCAGG + Intergenic
1027135505 7:75621268-75621290 CACACGAGCAGAAGCCCAGCTGG + Intronic
1027272549 7:76530588-76530610 CTCACGCCCATGATCCCAGCAGG - Intergenic
1027326002 7:77049671-77049693 CTCACGCCCATGATCCCAGCAGG - Intergenic
1029718217 7:102345011-102345033 CTCACGCCCATGATCCCAGCAGG - Intergenic
1029754398 7:102564245-102564267 CTCACGCCCATGATCCCAGCAGG + Intronic
1029772347 7:102663326-102663348 CTCACGCCCATGATCCCAGCAGG + Intronic
1035671208 8:1418725-1418747 CCCACTACCAGGACACCAACTGG + Intergenic
1038581672 8:28753493-28753515 CTTCCGGACAGGACCCCAGCTGG - Exonic
1039059939 8:33565484-33565506 GTCAAGACTAGGACCCCAGGAGG + Intronic
1043861456 8:85321931-85321953 CCCAGGAAAAGGACCCCAGCTGG - Intergenic
1049040160 8:140106569-140106591 CCCACGACCAAGAACACAGCTGG - Intronic
1049801898 8:144521755-144521777 CAAAGGACCAGGACCCCAGACGG - Exonic
1051966105 9:22831835-22831857 CTCACGTCTAGGAGCCCACCAGG - Intergenic
1055508401 9:76970921-76970943 GTCTCGAGCTGGACCCCAGCAGG - Intergenic
1056137926 9:83647514-83647536 CTGACAACCAGGACCCCATTTGG + Intergenic
1060044490 9:120328893-120328915 CCCCCAACCAGGACCCCAGGTGG + Intergenic
1060496004 9:124118902-124118924 GTCTCAGCCAGGACCCCAGCAGG - Intergenic
1060892693 9:127198736-127198758 CTGAGGACCCAGACCCCAGCGGG + Intronic
1203630871 Un_KI270750v1:71212-71234 CCCAGGACCAGGACCCTGGCTGG + Intergenic
1193212325 X:78821832-78821854 ATCACTACCAGCACCACAGCAGG - Intergenic
1194554725 X:95342211-95342233 CTCACTACCAGGAAAACAGCAGG - Intergenic
1195749159 X:108147080-108147102 CTCACCTCCAGGAGCCCACCAGG + Intronic
1200099230 X:153681367-153681389 CCGACAAACAGGACCCCAGCCGG + Intronic
1202261695 Y:22977085-22977107 CTCACGTGCAGTACCCAAGCTGG - Intronic
1202414683 Y:24610826-24610848 CTCACGTGCAGTACCCAAGCTGG - Intronic
1202456102 Y:25059260-25059282 CTCACGTGCAGTACCCAAGCTGG + Intronic