ID: 954133708

View in Genome Browser
Species Human (GRCh38)
Location 3:48572524-48572546
Sequence GAGCCCGACCACAGCCTGTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 141}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954133695_954133708 27 Left 954133695 3:48572474-48572496 CCCTCACTGGCAGCCCCACACAC 0: 1
1: 0
2: 2
3: 32
4: 387
Right 954133708 3:48572524-48572546 GAGCCCGACCACAGCCTGTGGGG 0: 1
1: 0
2: 3
3: 18
4: 141
954133698_954133708 13 Left 954133698 3:48572488-48572510 CCCACACACACTCACCTTCTCTC 0: 1
1: 1
2: 8
3: 119
4: 836
Right 954133708 3:48572524-48572546 GAGCCCGACCACAGCCTGTGGGG 0: 1
1: 0
2: 3
3: 18
4: 141
954133699_954133708 12 Left 954133699 3:48572489-48572511 CCACACACACTCACCTTCTCTCC 0: 1
1: 0
2: 14
3: 102
4: 1007
Right 954133708 3:48572524-48572546 GAGCCCGACCACAGCCTGTGGGG 0: 1
1: 0
2: 3
3: 18
4: 141
954133693_954133708 29 Left 954133693 3:48572472-48572494 CCCCCTCACTGGCAGCCCCACAC 0: 1
1: 0
2: 1
3: 39
4: 444
Right 954133708 3:48572524-48572546 GAGCCCGACCACAGCCTGTGGGG 0: 1
1: 0
2: 3
3: 18
4: 141
954133692_954133708 30 Left 954133692 3:48572471-48572493 CCCCCCTCACTGGCAGCCCCACA 0: 1
1: 0
2: 8
3: 34
4: 439
Right 954133708 3:48572524-48572546 GAGCCCGACCACAGCCTGTGGGG 0: 1
1: 0
2: 3
3: 18
4: 141
954133704_954133708 -10 Left 954133704 3:48572511-48572533 CCTTTGCTCCAGGGAGCCCGACC 0: 1
1: 0
2: 3
3: 13
4: 175
Right 954133708 3:48572524-48572546 GAGCCCGACCACAGCCTGTGGGG 0: 1
1: 0
2: 3
3: 18
4: 141
954133697_954133708 14 Left 954133697 3:48572487-48572509 CCCCACACACACTCACCTTCTCT 0: 1
1: 0
2: 17
3: 185
4: 1145
Right 954133708 3:48572524-48572546 GAGCCCGACCACAGCCTGTGGGG 0: 1
1: 0
2: 3
3: 18
4: 141
954133701_954133708 -1 Left 954133701 3:48572502-48572524 CCTTCTCTCCCTTTGCTCCAGGG 0: 1
1: 0
2: 7
3: 75
4: 607
Right 954133708 3:48572524-48572546 GAGCCCGACCACAGCCTGTGGGG 0: 1
1: 0
2: 3
3: 18
4: 141
954133696_954133708 26 Left 954133696 3:48572475-48572497 CCTCACTGGCAGCCCCACACACA 0: 1
1: 1
2: 7
3: 48
4: 536
Right 954133708 3:48572524-48572546 GAGCCCGACCACAGCCTGTGGGG 0: 1
1: 0
2: 3
3: 18
4: 141
954133694_954133708 28 Left 954133694 3:48572473-48572495 CCCCTCACTGGCAGCCCCACACA 0: 1
1: 0
2: 3
3: 28
4: 361
Right 954133708 3:48572524-48572546 GAGCCCGACCACAGCCTGTGGGG 0: 1
1: 0
2: 3
3: 18
4: 141
954133703_954133708 -9 Left 954133703 3:48572510-48572532 CCCTTTGCTCCAGGGAGCCCGAC 0: 1
1: 0
2: 0
3: 9
4: 134
Right 954133708 3:48572524-48572546 GAGCCCGACCACAGCCTGTGGGG 0: 1
1: 0
2: 3
3: 18
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954133708 Original CRISPR GAGCCCGACCACAGCCTGTG GGG Exonic