ID: 954134125

View in Genome Browser
Species Human (GRCh38)
Location 3:48574356-48574378
Sequence CTGTCTAGGGGGATGGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 465
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 430}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954134125_954134139 29 Left 954134125 3:48574356-48574378 CCACCCACCATCCCCCTAGACAG 0: 1
1: 0
2: 3
3: 31
4: 430
Right 954134139 3:48574408-48574430 CAGACCCCAGCCCTGCACACAGG 0: 1
1: 0
2: 4
3: 50
4: 470
954134125_954134134 1 Left 954134125 3:48574356-48574378 CCACCCACCATCCCCCTAGACAG 0: 1
1: 0
2: 3
3: 31
4: 430
Right 954134134 3:48574380-48574402 GTCAGGACCCAGACAGTCCCAGG 0: 1
1: 0
2: 1
3: 31
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954134125 Original CRISPR CTGTCTAGGGGGATGGTGGG TGG (reversed) Intronic
900477132 1:2881361-2881383 CTGTCTAGAGGGGTGGGGGCAGG + Intergenic
900998666 1:6136479-6136501 CTGGCTAGGGAGGTGGTGGTGGG - Intronic
901400485 1:9012150-9012172 CTGTCTGTTGGGATGTTGGGAGG - Intronic
902165906 1:14571627-14571649 CTTTATAGGGGGATGGAGTGGGG - Intergenic
903081807 1:20816602-20816624 CTGTCCGGGAGGGTGGTGGGGGG + Intronic
903627963 1:24745088-24745110 CTCTCTAGGGGACTGGTGCGGGG - Intergenic
904614050 1:31740321-31740343 CTGCCTAGGAGGAAGGAGGGCGG - Intronic
904741939 1:32684200-32684222 CTGGCTGAGGGGATGGTGGGAGG - Exonic
904760961 1:32804374-32804396 CTGTCCAGGAGGGAGGTGGGGGG - Intronic
904842147 1:33379455-33379477 GTGGGTGGGGGGATGGTGGGGGG - Intronic
905482093 1:38268644-38268666 CGGTGCAGGGGGGTGGTGGGGGG - Intergenic
906108558 1:43308726-43308748 CTGGCTGGGAGGATGGTGAGGGG + Intronic
906429150 1:45740506-45740528 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
907440577 1:54475825-54475847 CTTACTAGGGTGAGGGTGGGTGG - Intergenic
909301578 1:74019307-74019329 CTGGCTAGAAGGATGGTAGGAGG + Intergenic
910022435 1:82608491-82608513 CACTCAAGGGGAATGGTGGGAGG + Intergenic
911165201 1:94718862-94718884 CGGTAGAGCGGGATGGTGGGAGG + Intergenic
911812658 1:102303190-102303212 TTGTCTTGAGGGAGGGTGGGGGG + Intergenic
912383514 1:109260154-109260176 TTGTCCAGGAGGATGGTGGGGGG + Intronic
913601958 1:120429525-120429547 CTGTCTAGAGACATGGCGGGAGG + Intergenic
916860606 1:168800505-168800527 CTGTGATGGGGCATGGTGGGTGG + Intergenic
917375733 1:174349462-174349484 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
917390568 1:174531737-174531759 CTGTCTCGGGGGTGGGGGGGGGG + Intronic
918038927 1:180900263-180900285 CTGACTTGGGGGTTGTTGGGAGG + Intergenic
918180438 1:182082288-182082310 CTGTCTGGGTGGTGGGTGGGAGG - Intergenic
918377186 1:183920962-183920984 GTGTCGAGGGGGGTCGTGGGGGG + Intronic
919833111 1:201555849-201555871 CTGTGAAGGGAGATGGGGGGCGG + Intergenic
919847606 1:201651381-201651403 CTGGCTAGGGAGATGGGAGGAGG + Intronic
920534432 1:206728569-206728591 GTGCCAAGGGGGCTGGTGGGGGG + Intronic
922710275 1:227824216-227824238 CTGTTTGGGGGGATAGAGGGAGG - Intronic
922756470 1:228099774-228099796 CTGTCAAGGGGGATGAAGGTTGG - Intergenic
924085497 1:240447255-240447277 GTGTGTTGGGGGATGTTGGGAGG + Intronic
1063369856 10:5514127-5514149 CTGTGCTGGGGGGTGGTGGGTGG - Intergenic
1063375609 10:5552532-5552554 CTGTCCAGGGCGATGGTTGCAGG + Intergenic
1063874694 10:10461835-10461857 CTTTTTTTGGGGATGGTGGGAGG - Intergenic
1064108219 10:12519122-12519144 CTGTCCGGGAGGGTGGTGGGGGG - Intronic
1064956983 10:20922282-20922304 ATGGGTAGGGGGATGGAGGGAGG - Intronic
1065212901 10:23421887-23421909 TTGTCAAGGTGTATGGTGGGAGG + Intergenic
1065594253 10:27296322-27296344 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
1066331051 10:34423309-34423331 GGGGTTAGGGGGATGGTGGGTGG + Intronic
1068005921 10:51392815-51392837 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
1069985219 10:72278337-72278359 CAGTTAAGGGGAATGGTGGGAGG - Intergenic
1070458101 10:76637893-76637915 CAGTCTAGGGTGAAGATGGGAGG + Intergenic
1072421250 10:95291814-95291836 CTGGCTAGGAAGCTGGTGGGAGG - Intergenic
1073063765 10:100746617-100746639 CTGACTAGGGAGAGGGTGGCTGG - Intronic
1075626785 10:123969607-123969629 CTGTCTAGGGGTAGGGGGGCGGG + Intergenic
1076454233 10:130578342-130578364 CTGCCTAGGTGGAGGGTGAGTGG - Intergenic
1076707680 10:132310531-132310553 AGTTCTAGGGGGATGCTGGGAGG + Intronic
1076768086 10:132647695-132647717 CTGCCTTGGAGGAGGGTGGGTGG + Intronic
1077394617 11:2314963-2314985 CTGTCTAGGGGGAAGGGTGCAGG + Intronic
1078731587 11:13979874-13979896 CTCTCTAGGGTGAGGGTGGGTGG - Intronic
1079927467 11:26512459-26512481 CTGGCCAGGGGGCTGGTGCGGGG - Intronic
1080007066 11:27420762-27420784 GTGTCTTGGGGGAAGGTGGAGGG + Intronic
1080329616 11:31120816-31120838 ATCTGTAGGGGGATGGTGAGTGG - Intronic
1080383353 11:31796463-31796485 TTGGCTGGGGGGATGGAGGGTGG + Intronic
1081807229 11:45897196-45897218 CTTGCTGGGGGGGTGGTGGGGGG - Intronic
1082811074 11:57479372-57479394 CTGTCTGGGCTGGTGGTGGGAGG - Intergenic
1083118909 11:60491718-60491740 CCGTCCAGGAGGAAGGTGGGGGG + Intergenic
1083154631 11:60815362-60815384 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1083478114 11:62926828-62926850 CCGCCTCGGGGGGTGGTGGGGGG - Intergenic
1084722505 11:70916289-70916311 CTGTCTGGGGGAAAGGTTGGGGG + Intronic
1084797553 11:71518810-71518832 CTGTCTGGGGGCGGGGTGGGGGG + Intronic
1084849766 11:71929240-71929262 CTGACTAGGGGGCGGGTGCGTGG + Intronic
1086430589 11:86732506-86732528 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1089197783 11:116704980-116705002 TTGTCTTGTGGGGTGGTGGGTGG - Intergenic
1089254487 11:117187070-117187092 CTGTCTGGAGGGCTCGTGGGCGG + Intronic
1090354484 11:126130695-126130717 CTGTTTAGGGGTACGGTGGAAGG - Intergenic
1092045331 12:5428468-5428490 CTGTCTGGGTGGATGGGGGTGGG + Intergenic
1092200040 12:6575812-6575834 TTGTGTTGGGTGATGGTGGGAGG - Intronic
1092827404 12:12413714-12413736 CCGTCCGGGAGGATGGTGGGGGG - Intronic
1092843869 12:12566267-12566289 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1093437306 12:19150317-19150339 CTGTTTTGGGGGATGGAGGAAGG + Intronic
1095955341 12:47802687-47802709 CTGGCTGGGGGGATGGCTGGGGG + Intronic
1095958971 12:47821701-47821723 CTATCTAGTGGGAGGGAGGGAGG + Intronic
1096412980 12:51390811-51390833 CTGTGTATGGGGGTGGAGGGTGG - Intronic
1096848228 12:54419319-54419341 CTGCCGAGGGGGCTGGCGGGGGG + Exonic
1097269598 12:57765912-57765934 CAATCTGGGGGCATGGTGGGAGG - Intronic
1097605937 12:61754579-61754601 ATTTCTCGGTGGATGGTGGGAGG - Intronic
1098019133 12:66135164-66135186 CTGTCCAGGAGGGAGGTGGGGGG + Intronic
1099228869 12:80000400-80000422 CTGTATGGGGGGATTGTGGATGG - Intergenic
1100172356 12:91989707-91989729 CTGTTGAGGTGGATGATGGGTGG - Intronic
1100325222 12:93533817-93533839 CTGCAAAGGGGGATGGTGGATGG + Intergenic
1100995117 12:100294576-100294598 CTGTCCAGGAGGGAGGTGGGGGG - Intronic
1101318288 12:103649858-103649880 CTGTCTAGGGAAATGTTGGAGGG - Intronic
1101563450 12:105882068-105882090 CTGTCCATGGAGATTGTGGGAGG - Intergenic
1102089308 12:110172972-110172994 CTGTCCAGGAGGGAGGTGGGGGG + Intronic
1102457618 12:113080412-113080434 CAGGCTAGGGGGAGTGTGGGAGG + Intronic
1102565543 12:113794991-113795013 CTGAATAGGGGGAAGGAGGGAGG + Intergenic
1103082365 12:118035376-118035398 CTGCCTAGGGTGATGATGGAGGG - Intronic
1103334258 12:120177416-120177438 CTGTCAACCAGGATGGTGGGAGG - Intronic
1103363256 12:120366502-120366524 CTGTGTAGGGGGACTGTGTGTGG - Intronic
1104159495 12:126164751-126164773 CTGTCTAGGCCTAGGGTGGGTGG + Intergenic
1104894876 12:132159199-132159221 CTGTCTTGGGGGGTGCTGGGCGG + Intergenic
1104934765 12:132358512-132358534 CTGTCTACGGGGATGTTTGGGGG + Intergenic
1105367931 13:19779715-19779737 CTGTCTGGGAGGGAGGTGGGGGG + Intronic
1105818114 13:24055415-24055437 CTGCCTAGGGAGATGGAGGATGG + Intronic
1105851389 13:24339431-24339453 CTTTCTTGGGGGGGGGTGGGGGG + Intergenic
1106295909 13:28413363-28413385 CTGGCTTGGGGGGTGGAGGGCGG - Intronic
1107834865 13:44404951-44404973 CTGGCTGGGGGGCTGGGGGGAGG + Intergenic
1109627398 13:64993442-64993464 CTATCACGGGGGAGGGTGGGCGG + Intergenic
1113446240 13:110369824-110369846 CTGGACAGGGGGCTGGTGGGTGG - Intronic
1113573996 13:111381898-111381920 GGGTCTATAGGGATGGTGGGGGG + Intergenic
1114428018 14:22638012-22638034 CCGTCCGGGAGGATGGTGGGGGG + Intergenic
1114493037 14:23114941-23114963 CTGTGTAGGGTGATGAAGGGTGG + Intergenic
1115488290 14:33934181-33934203 CTGGGAATGGGGATGGTGGGAGG - Intronic
1115578587 14:34735971-34735993 CTGGTGAGGGGGATGGTGGTAGG - Intergenic
1115997835 14:39212077-39212099 CTCTCTAGGGGGATGATGGAGGG - Intergenic
1116718251 14:48455831-48455853 CTGTGTGTGGGGATGGGGGGTGG + Intergenic
1117553128 14:56856256-56856278 CTTTCTCGGGGGCTGGGGGGAGG - Intergenic
1118162288 14:63302211-63302233 CGGTCTGGGGGGCTGTTGGGTGG + Intergenic
1118622991 14:67631123-67631145 AGGTCAAGGGGGATGGTGGAGGG - Intronic
1119242691 14:73074566-73074588 CTGTCTTGTGGGGAGGTGGGGGG + Intronic
1119333000 14:73809479-73809501 GTGTCTTGGGTGGTGGTGGGAGG - Intergenic
1119711006 14:76822081-76822103 CTGTCCAGGAGGGAGGTGGGGGG + Intronic
1121507395 14:94487178-94487200 CTGTCTAGGGAGGTGGTGACAGG + Intergenic
1122557723 14:102590772-102590794 CAGCCTTGGGGGCTGGTGGGTGG + Intergenic
1122770896 14:104097199-104097221 CTGTAGAGGGAGCTGGTGGGTGG + Intronic
1122939758 14:104976045-104976067 CTTTCTTGGGGGGTCGTGGGAGG + Intronic
1123039845 14:105486024-105486046 CTGACAGGAGGGATGGTGGGTGG + Intergenic
1124150988 15:27178009-27178031 ATCTCCTGGGGGATGGTGGGTGG + Intronic
1124585370 15:31000703-31000725 TTCTCTTGGGGGATGGTGAGGGG + Intergenic
1124640626 15:31393880-31393902 CTGTCTGCGAGGGTGGTGGGTGG + Intronic
1125694273 15:41622030-41622052 CGGGGTAGGGGGAGGGTGGGGGG + Intronic
1125861665 15:43005406-43005428 CTGTCTTGGAGGGAGGTGGGGGG + Intronic
1126504197 15:49384425-49384447 CTGTCTGTGGGGATGGGGTGGGG + Intronic
1126695362 15:51321290-51321312 GGATCTAGGGGCATGGTGGGTGG - Intronic
1127147426 15:56038942-56038964 CAGTGTTGGGGGAAGGTGGGAGG - Intergenic
1127237083 15:57065628-57065650 CACTCAAGGGGGGTGGTGGGGGG - Intronic
1127292961 15:57586564-57586586 CTGGGTATGGGGATGGAGGGTGG - Intergenic
1127304144 15:57685506-57685528 GTGTGTCGGGGGAGGGTGGGGGG + Intronic
1127667984 15:61167829-61167851 CTGTGTAGGAGAGTGGTGGGTGG - Intronic
1127782865 15:62332258-62332280 CCGTCTAGGAGGGAGGTGGGGGG - Intergenic
1128231821 15:66040569-66040591 CTGTCTACAGTGGTGGTGGGAGG + Intronic
1128489615 15:68134369-68134391 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
1128604716 15:69028116-69028138 GTGTCTGGGGTGGTGGTGGGGGG - Intronic
1129054069 15:72807087-72807109 CCGTCTAGGAGGGAGGTGGGGGG - Intergenic
1129109682 15:73330144-73330166 CTGTTTAGGGGGTTGGGGGGTGG - Intronic
1129161810 15:73751949-73751971 CTGGCTGGGGGGAAGGTGGGGGG - Intronic
1130832603 15:87616744-87616766 CTGTCTGGAGGGCTGATGGGTGG + Intergenic
1131423377 15:92326086-92326108 CAGTGATGGGGGATGGTGGGTGG + Intergenic
1132464109 16:69859-69881 TTGTCTAGGGTGATGAGGGGAGG - Intronic
1132482084 16:171871-171893 TTGGCGAGGGGGAGGGTGGGAGG - Intergenic
1133461554 16:5990632-5990654 CGGTGTATGGGGAAGGTGGGTGG + Intergenic
1133688478 16:8189785-8189807 CTGTGGAGAGGGATGGAGGGTGG - Intergenic
1134488439 16:14677764-14677786 CTGGATAGATGGATGGTGGGTGG + Intronic
1135113435 16:19707958-19707980 CTGTGTAGGGAGGTGGGGGGAGG - Intronic
1136277378 16:29186986-29187008 CTGTATGGGGGGATGGCGTGAGG + Intergenic
1136662646 16:31777954-31777976 CTGTCGAGGGGGGTGGGAGGAGG + Intronic
1140161205 16:72496880-72496902 CCGTCCGGGAGGATGGTGGGGGG + Intergenic
1140450988 16:75070663-75070685 CTGGGAAGGGGTATGGTGGGCGG - Intronic
1140712939 16:77695121-77695143 CTTTTTAGGGGGTGGGTGGGCGG + Intergenic
1142611808 17:1112590-1112612 CTGTCTTGAGGGAGGGAGGGAGG + Intronic
1143107811 17:4538236-4538258 CTGGCTTGGGGGGTGGTGGCAGG - Exonic
1143135427 17:4710185-4710207 CTGGGAAGGAGGATGGTGGGGGG - Intergenic
1143370791 17:6437798-6437820 CTGTTTAGGGTGAGGGTGGTGGG - Intergenic
1143868216 17:9939462-9939484 TTGTCTAGGGGCAGGCTGGGAGG - Intronic
1145294708 17:21578926-21578948 CTGGCTATGGGGTGGGTGGGAGG + Intergenic
1145684356 17:26638649-26638671 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1145684546 17:26639080-26639102 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1147017786 17:37506363-37506385 CTGGCTTGGGGGATGGGGGTAGG - Intronic
1147037378 17:37691865-37691887 CTGACAAGGGGGCAGGTGGGTGG - Intronic
1147323890 17:39661258-39661280 CTGTCTGTGGAGATGGGGGGTGG + Intronic
1147464856 17:40603193-40603215 CTCTCTGGGAAGATGGTGGGGGG + Intergenic
1147914831 17:43879981-43880003 GTGTCTAGGGGGATGGGGGTAGG + Exonic
1148533578 17:48418914-48418936 CTTTCTAGGGGGATGGAAGGTGG + Intronic
1148797538 17:50204210-50204232 CAGACTGGGGGGATGGGGGGTGG + Intergenic
1148809057 17:50278931-50278953 CTCTCTGGGGGGATGATGGAGGG - Exonic
1148987799 17:51638750-51638772 CTGTCTGGGGCGAGGGTGCGGGG + Intronic
1149991836 17:61387759-61387781 CTTTCTTGGGGGATGGGGGTGGG + Intronic
1150490921 17:65573699-65573721 CTGTCTGGTGGGTTGTTGGGAGG + Intronic
1152020354 17:77777003-77777025 CCGTCCGGGAGGATGGTGGGGGG + Intergenic
1152400683 17:80064726-80064748 AAGTCTAGGGGCATCGTGGGGGG - Intronic
1153073260 18:1131530-1131552 GTGTGTAGGAGGATGGAGGGAGG + Intergenic
1153819676 18:8822783-8822805 CTGTGAACGGGGAAGGTGGGAGG - Intronic
1154216629 18:12420699-12420721 CGGGCTGGGGGGCTGGTGGGAGG + Intronic
1156550907 18:38015654-38015676 CTGTCTGGGGGTAAGGTGGAGGG - Intergenic
1157437420 18:47682549-47682571 CTGTCTAGTGGCATTGTGGCAGG - Intergenic
1159287980 18:66376958-66376980 ATCACTAGGGGGATGGTGAGTGG - Intergenic
1160658644 19:287972-287994 CTGGGTAGGGGGATGGGGTGGGG - Intronic
1161779611 19:6282740-6282762 CTGTCAGGGGGTGTGGTGGGGGG + Intergenic
1161807977 19:6456093-6456115 CTGTGTGGGTGGAAGGTGGGAGG + Intronic
1162140170 19:8580721-8580743 CTGGCTGGGGGGATGGAGAGGGG - Exonic
1162316024 19:9938445-9938467 TTGTCAAGGGCGCTGGTGGGTGG + Intergenic
1163076314 19:14895005-14895027 CTGGCGGGGGGGGTGGTGGGAGG + Intergenic
1163945290 19:20529994-20530016 CTGTCTGGGAGGGAGGTGGGGGG - Intergenic
1164298408 19:23937143-23937165 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
1165661764 19:37587004-37587026 GGGTCCAGGAGGATGGTGGGGGG - Intronic
1165794165 19:38509052-38509074 CTCTCAAGGGGAATGCTGGGGGG - Intronic
1166180159 19:41103090-41103112 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1166191823 19:41180768-41180790 CTGTCCAGGAGGGAGGTGGGGGG + Intergenic
1167975989 19:53226264-53226286 CCGTCTCGGGGGGGGGTGGGGGG + Intergenic
1168308552 19:55449855-55449877 CTGGGCAGGGGGCTGGTGGGGGG - Intergenic
1168328080 19:55548398-55548420 GTGTATGGGGGGGTGGTGGGTGG + Intergenic
925005920 2:443061-443083 CTGTGTAGGGGCAGTGTGGGGGG - Intergenic
926045054 2:9704081-9704103 CTGTTGTGGGGGATGGTGGCTGG + Intergenic
926252739 2:11165164-11165186 CTGTCCAGGAGGGAGGTGGGGGG - Intronic
926722476 2:15971460-15971482 CTGCAGAGGGGGCTGGTGGGGGG + Intergenic
929690091 2:44067029-44067051 CCGTCTAGGAGGGAGGTGGGGGG - Intergenic
929739905 2:44589117-44589139 CCGTCTGGGAGGGTGGTGGGGGG + Intronic
931095567 2:58937039-58937061 ATGCCTAGGGGGAGGGTAGGTGG - Intergenic
931247391 2:60503000-60503022 CTGTCTAGGGGGATGGCTACTGG + Intronic
931256752 2:60581015-60581037 CTGTTTAGGGAGATGGTTAGGGG - Intergenic
932630403 2:73337638-73337660 CTGTGGAGGGCCATGGTGGGAGG + Intergenic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
932807048 2:74793295-74793317 CTGTCTAACAGGAGGGTGGGTGG + Intergenic
933760943 2:85671568-85671590 CTGGCCAGGGGGATGAAGGGAGG - Intergenic
934196613 2:89842265-89842287 CTGCCTTGGGTTATGGTGGGTGG + Intergenic
934998509 2:98988903-98988925 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
935384288 2:102484942-102484964 TTCTCTAGGAGGATAGTGGGAGG + Intronic
935630463 2:105210299-105210321 CCGTCCGGGAGGATGGTGGGGGG - Intergenic
937263618 2:120601997-120602019 CTGGGCAGGGGCATGGTGGGTGG - Intergenic
938413393 2:131084192-131084214 CTGTCTTGGGGTGGGGTGGGGGG - Intronic
938764373 2:134450584-134450606 CAGTCTAAGAGGAGGGTGGGGGG + Exonic
938828795 2:135033248-135033270 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
939216938 2:139250644-139250666 CTGTCAGGGGGTGTGGTGGGGGG + Intergenic
939244513 2:139606450-139606472 CTGTCATGGGGGGTGGAGGGAGG + Intergenic
939639031 2:144617209-144617231 CTGTCAGGGGGTGTGGTGGGGGG - Intergenic
940652394 2:156451749-156451771 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
943005842 2:182386784-182386806 CTGTCTGGGAGGGAGGTGGGGGG + Intronic
943105748 2:183544021-183544043 ATCTCCAGGGGGGTGGTGGGGGG + Intergenic
944605542 2:201348625-201348647 GTGTGTAAGGGGGTGGTGGGGGG - Intronic
946156956 2:217813354-217813376 CAGTCTTGGGAGGTGGTGGGAGG - Intronic
946186609 2:217984253-217984275 GTGTCTCAGGGGATGGTCGGGGG + Intronic
946292421 2:218755190-218755212 CAGTCCAGGGGGAGGGTGGAAGG + Exonic
946919691 2:224566065-224566087 CTGTAGATGGGGAAGGTGGGGGG - Intronic
948075779 2:235164171-235164193 TTCTCAAGGGGGAAGGTGGGGGG + Intergenic
948968642 2:241406157-241406179 GGGTGTAGGGGCATGGTGGGGGG + Intronic
949050627 2:241895659-241895681 CTGTGTGGGTGGATGGAGGGGGG + Intronic
1169077460 20:2770037-2770059 CTGGGTAGGGGGTAGGTGGGAGG - Intergenic
1170293112 20:14793436-14793458 CTGGCGGGGGGCATGGTGGGGGG - Intronic
1170623095 20:18010609-18010631 CTGTCCAGGAGGGAGGTGGGGGG - Intronic
1170801523 20:19594242-19594264 CTGTGTAGGGGGTTGATAGGAGG - Intronic
1171749393 20:29033581-29033603 GTGTTAAGGGGGATGGCGGGAGG - Intergenic
1171957261 20:31471092-31471114 CTGTCCAGGAGGGAGGTGGGGGG - Intronic
1172494431 20:35368896-35368918 TTGTCTAGGTGGAGGGTGGTTGG - Intronic
1173082303 20:39879919-39879941 CTGTATTGGAGGATGGAGGGTGG - Intergenic
1173504121 20:43573771-43573793 CTGTGTTTGGGTATGGTGGGTGG + Intronic
1173549211 20:43920761-43920783 CAGCCTAGAGGGATGGTGTGGGG + Intronic
1174339624 20:49887720-49887742 GTGTCTAGGGAGGAGGTGGGAGG - Intronic
1175219544 20:57409032-57409054 CTGTCTTGGGGGTTGGTGGAGGG + Exonic
1175554134 20:59835789-59835811 CCGTCTGGGCTGATGGTGGGAGG + Intronic
1176141854 20:63548376-63548398 CTGTCCAGGGAGAGGGTGGGAGG - Intronic
1176315784 21:5242111-5242133 GTGTTAAGGGGGATGGCGGGTGG + Intergenic
1176348188 21:5770441-5770463 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
1176355002 21:5891025-5891047 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
1176496639 21:7554014-7554036 CTGTCCAGGAGGGAGGTGGGGGG + Intergenic
1176542509 21:8168511-8168533 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
1176561460 21:8351556-8351578 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
1177178303 21:17720144-17720166 CTGTCTGGGAGGGAGGTGGGGGG - Intergenic
1179561149 21:42217051-42217073 ATGGCCAGGGGGATGGTGTGTGG - Intronic
1180055399 21:45356432-45356454 CAGTCTAAGGGGATGCTGGCAGG - Intergenic
1180228947 21:46414757-46414779 GTGTCCAGGAGGAGGGTGGGCGG - Intronic
1180393584 22:12308056-12308078 GTGTTAAGGGGGATGGCGGGAGG + Intergenic
1180406162 22:12556696-12556718 GTGTTAAGGGGGATGGCGGGAGG - Intergenic
1182315912 22:29447139-29447161 CTTTCTGGGGTGAAGGTGGGTGG - Intergenic
1182592678 22:31394192-31394214 CTGGCTTGGGGGAGGGAGGGGGG - Intergenic
1182616390 22:31592185-31592207 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
1182616590 22:31592637-31592659 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
1182866694 22:33610626-33610648 CTTTATAGGGTGGTGGTGGGTGG + Intronic
1183319659 22:37157266-37157288 CTGTCTTGGGGACTGGTGGGTGG - Intronic
1183658411 22:39204377-39204399 ATGGCTGCGGGGATGGTGGGAGG - Intergenic
1183971098 22:41478102-41478124 CTATCTGGGGAGATGATGGGAGG - Intronic
1184478984 22:44736353-44736375 GTGTCCAAGGGGATGGTGGGAGG - Intronic
1184599096 22:45532185-45532207 CTGTCCAGGGGCCTGGTGGAGGG + Intronic
1203247449 22_KI270733v1_random:84929-84951 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
949204278 3:1419822-1419844 ATGTTTAGAGAGATGGTGGGAGG + Intergenic
949941625 3:9159189-9159211 GAGTCTGGTGGGATGGTGGGTGG - Intronic
950230397 3:11271060-11271082 CTGCCTTTGGGGAGGGTGGGGGG + Intergenic
950494780 3:13327258-13327280 CTGTCTGGGGCCATGGTGGTGGG - Exonic
950661057 3:14467240-14467262 CTGTCCAGGGGGAAGGGTGGTGG - Intronic
952074636 3:29681500-29681522 CTGTCTGGGGGGATTGTGTGGGG - Intronic
952149938 3:30578416-30578438 CTGTATAGTGGGTTGGGGGGTGG - Intergenic
953830894 3:46296938-46296960 CTGTATGTGGGGATGGCGGGTGG - Intergenic
954059585 3:48056648-48056670 CTGTCTGGGAGGGAGGTGGGGGG + Intronic
954134125 3:48574356-48574378 CTGTCTAGGGGGATGGTGGGTGG - Intronic
954481255 3:50803749-50803771 CTGTCCAGGAGGGAGGTGGGGGG - Intronic
954757362 3:52848586-52848608 CTGTTTGTGGGGGTGGTGGGAGG + Intronic
954770078 3:52959120-52959142 CTGTCAAGGGGGACGGGGGAGGG + Intronic
954878416 3:53818284-53818306 CTGTCTGAGGGGATGGTGTTTGG + Intronic
955032545 3:55234804-55234826 CTCAGGAGGGGGATGGTGGGAGG - Intergenic
955433964 3:58879732-58879754 GTGTCTTGGGGGTTGGTGGAGGG + Intronic
957620291 3:82585007-82585029 CTGTCCAGGAGGGAGGTGGGGGG + Intergenic
958019100 3:87977081-87977103 ATATGTAAGGGGATGGTGGGAGG - Intergenic
959415082 3:106073453-106073475 CCGTCCAGGAGGGTGGTGGGGGG - Intergenic
959574436 3:107919257-107919279 CTTTCTGGGGTGGTGGTGGGAGG - Intergenic
960360252 3:116702492-116702514 CTGTCTCTGGGGATGCTGGTTGG - Intronic
960780330 3:121313095-121313117 CCGTCTGGGAGGGTGGTGGGGGG - Intronic
962112784 3:132470798-132470820 CTGTCCAGGAGGGAGGTGGGGGG - Intronic
962149888 3:132881534-132881556 CTTTTTGGGGGGAAGGTGGGAGG + Intergenic
963498558 3:146097110-146097132 CTGTCCAGGAGGGAGGTGGGGGG + Intronic
963734047 3:148999846-148999868 CTGACTATGGGGGTGGTGGAGGG - Intronic
963911162 3:150820037-150820059 CCGTCCGGGAGGATGGTGGGGGG - Intergenic
963990275 3:151645051-151645073 CAGTCTCTGGGGATGGAGGGAGG - Intergenic
964075334 3:152685180-152685202 CTCTCTATGGAGCTGGTGGGAGG - Intergenic
964284817 3:155106652-155106674 GTGGTTGGGGGGATGGTGGGAGG + Intronic
964458594 3:156896193-156896215 CTGTCAGGGGGCATGGTGAGGGG + Intronic
966612525 3:181881869-181881891 CTATCCATGGGGTTGGTGGGAGG - Intergenic
967054337 3:185815761-185815783 CTGTTTATGGTGCTGGTGGGAGG - Intronic
967258905 3:187622414-187622436 CTGTCTAGGGAGATGGAGGATGG - Intergenic
967279162 3:187805648-187805670 CTGGCTTGGGGGATGGAGGAAGG + Intergenic
968586199 4:1417200-1417222 CTGTCTCTGGGCATGGTGGCCGG + Intergenic
968682227 4:1929102-1929124 TTGTCTAGAGAGGTGGTGGGTGG + Intronic
968978517 4:3834427-3834449 CTGTGTGGGTGGATGGAGGGTGG - Intergenic
969414722 4:7050852-7050874 CTGCATCGTGGGATGGTGGGGGG + Intronic
969637521 4:8377938-8377960 CTGTCTAGGGGGCAGCTGGTGGG - Intronic
973117120 4:46475782-46475804 CAGGGTAGGGGGTTGGTGGGTGG - Intergenic
973266646 4:48217883-48217905 ATGTCTAGGGGTATGGATGGAGG + Intronic
973287044 4:48430106-48430128 CTGTCTTAGGGCATGATGGGGGG + Intergenic
973346566 4:49062550-49062572 CAGTCTGGGAGGCTGGTGGGAGG - Intergenic
973585655 4:52388337-52388359 CTGTCGAGGGGTGGGGTGGGGGG - Intergenic
973593597 4:52465313-52465335 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
975686186 4:76918223-76918245 CCGTCCGGGAGGATGGTGGGGGG + Intergenic
976265274 4:83182720-83182742 CTGTCCAGGAGGGAGGTGGGGGG + Intergenic
976280339 4:83320791-83320813 GTGTCTAGGGGGATGGTCGGTGG - Intronic
978134467 4:105240553-105240575 CTGTGTAGAAGGATGGAGGGAGG + Intronic
978159870 4:105533190-105533212 CTGTCAAGGGGCGGGGTGGGGGG - Intergenic
980895241 4:138854449-138854471 CTGTCCAGGAGGGAGGTGGGGGG + Intergenic
981240694 4:142473484-142473506 CAGTCTAGAAGCATGGTGGGGGG - Intronic
981677482 4:147358048-147358070 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
981971345 4:150666048-150666070 CTGCCTAGGGGCAGGGAGGGTGG + Intronic
984533536 4:180945018-180945040 CTGTCCGGGAGGAAGGTGGGGGG + Intergenic
984533561 4:180945067-180945089 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
984977125 4:185240528-185240550 CTGTCCAGGAGGGAGGTGGGGGG - Intronic
985640145 5:1059752-1059774 CTGTGTCGGGGGGTGGGGGGTGG + Intronic
985935784 5:3096739-3096761 CTGTCTTGGTGCCTGGTGGGTGG - Intergenic
986167093 5:5283466-5283488 CTTTCTGGGGGGGAGGTGGGGGG - Intronic
988240047 5:28597000-28597022 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
988694292 5:33604542-33604564 CTAAGTAGGGGGGTGGTGGGGGG - Intronic
989247741 5:39273006-39273028 CTGTCCAGGAGGGAGGTGGGGGG + Intronic
989379852 5:40800881-40800903 CCGTCTGGGAGGGTGGTGGGGGG + Intergenic
989379952 5:40801135-40801157 CCGTCTGGGAGGGTGGTGGGGGG + Intergenic
990260679 5:54018743-54018765 CAGACTTGGGGGATGGTGAGGGG - Intronic
990521107 5:56582164-56582186 CTTTCTTGGGGGTTGGTGGAAGG - Intronic
990870987 5:60431176-60431198 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
992406952 5:76468472-76468494 CTGTTTAGGAGGATGATGGCTGG - Intronic
993384700 5:87251061-87251083 CTGTGTGGGGGGATGGGGGGTGG - Intergenic
995972942 5:117994947-117994969 CAGTTCAGGGGGATGGAGGGAGG + Intergenic
997341153 5:133145620-133145642 CTGTTCAGGAGGATGGTGGCTGG - Intergenic
997376731 5:133402912-133402934 CTGTCAAGGTTGATGGTGGCGGG + Intronic
997874957 5:137538288-137538310 CTGTCCAGGAGGGAGGTGGGGGG - Intronic
997981849 5:138472591-138472613 CTGAATAGGGGGAAGGTGGAAGG - Intergenic
998365760 5:141629792-141629814 GTGTTTAGGATGATGGTGGGGGG - Intronic
998400368 5:141845707-141845729 GTGTGAAGGGGGAGGGTGGGTGG - Intergenic
999288283 5:150407097-150407119 CTGAGTTGAGGGATGGTGGGAGG + Intronic
1000153552 5:158527854-158527876 GTGTCTGGGGGGATTGTGGAAGG + Intergenic
1000517913 5:162262488-162262510 TGGTCTAGGGGGATGGAGTGAGG + Intergenic
1001663463 5:173413474-173413496 CTGGGTGAGGGGATGGTGGGGGG + Intergenic
1002691931 5:181055874-181055896 CTGGCTATGTGGGTGGTGGGGGG + Intronic
1003188813 6:3855206-3855228 CTGTCTTGGAGGTTGGTGGGTGG - Intergenic
1004253795 6:14044336-14044358 CTGTCCAGGGAGAAGCTGGGAGG - Intergenic
1004291716 6:14373683-14373705 CTGGTCAGGGGCATGGTGGGTGG + Intergenic
1004453767 6:15771895-15771917 GTGTCTTGGGGCATGGTGGGCGG + Intergenic
1004511269 6:16286116-16286138 CTGTCCAAGGGGATGGTGCCAGG + Intronic
1004731833 6:18366490-18366512 GAGCCTAGGGGGATGGTGTGGGG + Intergenic
1004874393 6:19939598-19939620 CTGTCCAGGAGGGAGGTGGGGGG + Intergenic
1005151800 6:22760170-22760192 CTGTCAGGGGGCATGGAGGGAGG - Intergenic
1005158926 6:22836939-22836961 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1005570877 6:27144455-27144477 CTGTCTGGGGGGGGGGGGGGGGG + Intergenic
1005824230 6:29622928-29622950 CTTTCAAGGGGGGTGGTGGGTGG - Intronic
1006091051 6:31629252-31629274 CTGACTAGGGGGCTGGCGGGTGG - Exonic
1006196118 6:32243580-32243602 CTGTCCAGGGGGGTGGAGGAAGG + Intergenic
1006656116 6:35594336-35594358 CTGTCTCGGGGGGTGGGGGAGGG + Intronic
1006832567 6:36977606-36977628 CAGTCTCGGGGGAAGGGGGGTGG + Intronic
1007229221 6:40336790-40336812 GTGACTTGGGGGATAGTGGGTGG + Intergenic
1007784838 6:44273582-44273604 CTCCCTGGGGGGAAGGTGGGAGG + Intronic
1007910083 6:45504880-45504902 CTGTTTAGGGGGAAAATGGGTGG + Intronic
1008436083 6:51478081-51478103 TTGACTCAGGGGATGGTGGGGGG + Intergenic
1009438101 6:63641404-63641426 GTGTGTAGGGGGGTGGTGTGAGG - Intronic
1012978450 6:105805019-105805041 CCAACTTGGGGGATGGTGGGAGG + Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013616627 6:111849547-111849569 GTGGCTAGGAGGATGGTGGCAGG + Intronic
1013896697 6:115097400-115097422 CTGTCTGGGGTGATGGGGGAAGG - Intergenic
1014432892 6:121390414-121390436 GTGTCTAGTGGGATGTTGGAGGG - Intergenic
1016246148 6:141983621-141983643 CTGTTCAGGAGGCTGGTGGGTGG + Intergenic
1019516501 7:1442530-1442552 CGGCCTCGGGTGATGGTGGGAGG - Intronic
1019740014 7:2668086-2668108 CTGGCTAGGGGGAGGGGGGTAGG + Intergenic
1020831836 7:13103031-13103053 CTGTCCAGGAGGGAGGTGGGGGG + Intergenic
1021440465 7:20669085-20669107 CCGTCCGGGAGGATGGTGGGGGG + Intronic
1021672198 7:23045929-23045951 CCGTCTGGGAGGAAGGTGGGGGG - Intergenic
1021792551 7:24220023-24220045 CTGTCAAGGGGTAGGGTGTGGGG + Intergenic
1021872493 7:25018989-25019011 CTGTCCAGGAGGGAGGTGGGGGG + Intergenic
1025839847 7:65136188-65136210 CTGTCTTGGGGTGGGGTGGGGGG - Intergenic
1025883219 7:65559777-65559799 CTGTCTTGGGGTGGGGTGGGGGG + Intergenic
1025890227 7:65642829-65642851 CTGTCTTGGGGTGGGGTGGGGGG - Intergenic
1026481104 7:70780320-70780342 CTGCCTAAGAGGATGGTAGGCGG + Intronic
1027265674 7:76494052-76494074 GAGTCTAGGGGGAGGTTGGGAGG + Intronic
1027317044 7:76992169-76992191 GAGTCTAGGGGGAGGTTGGGAGG + Intergenic
1028505588 7:91567119-91567141 CTGTATATGGGGATAGTTGGTGG - Intergenic
1028667570 7:93364294-93364316 ATGTCTAGGGGCAGGGTGGGGGG - Intergenic
1029955145 7:104630899-104630921 CAGTCCCGGGGAATGGTGGGTGG - Intronic
1030409795 7:109161803-109161825 CTCTCAAGGATGATGGTGGGAGG - Intergenic
1030923987 7:115428498-115428520 CTGCCATGGAGGATGGTGGGGGG - Intergenic
1031506637 7:122592830-122592852 CCTTCCAGGGGGATGGGGGGAGG + Intronic
1031871352 7:127092009-127092031 ATGACTAGTGGGATGGTGGGGGG - Intronic
1032168786 7:129566908-129566930 CTGTGGTAGGGGATGGTGGGGGG - Intergenic
1032452787 7:132047766-132047788 CTGTCTTGAAGGAGGGTGGGGGG - Intergenic
1033005525 7:137557816-137557838 CTGTTGATGGGCATGGTGGGAGG - Intronic
1033376110 7:140763292-140763314 CTGTCCAGGAGGGAGGTGGGGGG - Intronic
1034196977 7:149255500-149255522 CTGTCTGGGGGGATGGGAGTGGG + Exonic
1035564302 8:631038-631060 CTGTCAATGTGGGTGGTGGGTGG - Intronic
1035636068 8:1145273-1145295 CTTCCTGGAGGGATGGTGGGTGG - Intergenic
1036660481 8:10705185-10705207 CTGGCTGGGGGTGTGGTGGGTGG - Intronic
1036775789 8:11612478-11612500 CTGGGGAGGGGGGTGGTGGGCGG - Intergenic
1038444961 8:27596818-27596840 CTGTCTCGGGGGGCGGGGGGGGG + Intergenic
1039743950 8:40406966-40406988 CTGTCTAAAGGGATGTTGGCAGG - Intergenic
1040572043 8:48619989-48620011 CTGGCCTGGGTGATGGTGGGAGG - Intergenic
1040900978 8:52416875-52416897 CTGCCTTGGGGTCTGGTGGGAGG + Intronic
1041286962 8:56272192-56272214 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
1041645795 8:60251179-60251201 CTATCTGGGGGCAAGGTGGGAGG + Intronic
1042268729 8:66935093-66935115 TTGGCGAGGGGGAGGGTGGGGGG - Intergenic
1044116560 8:88343169-88343191 CTGTCAAGGGGGGTGGTGGGGGG - Intergenic
1044597188 8:93970670-93970692 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
1046636836 8:116680059-116680081 CTGTCCAGGAGGGAGGTGGGGGG + Intronic
1047312369 8:123703351-123703373 CTGCCTAGGGGGATGGTAGCTGG + Intronic
1047687284 8:127316463-127316485 CCGTCTGGGAGGAAGGTGGGGGG + Intergenic
1048101726 8:131359267-131359289 CAGTCTAGAAGCATGGTGGGAGG + Intergenic
1049365240 8:142233897-142233919 CTGTGCAGGGGGAAGCTGGGAGG - Intronic
1050552139 9:6758004-6758026 CCGTCGAGGGGGTGGGTGGGAGG - Intronic
1052492653 9:29188838-29188860 CTGTCTGGGAGGAAGGTGGCGGG - Intergenic
1053008843 9:34622176-34622198 CTGTCTACGGGGATGGAGGGGGG - Intronic
1053089350 9:35259781-35259803 GTGTGTAGGGGGATGCGGGGGGG + Intronic
1053789550 9:41677104-41677126 CTATGTAGGGGGAGGCTGGGAGG - Intergenic
1054155593 9:61637648-61637670 CTATGTAGGGGGAGGCTGGGAGG + Intergenic
1054177888 9:61888795-61888817 CTATGTAGGGGGAGGCTGGGAGG - Intergenic
1054475362 9:65568658-65568680 CTATGTAGGGGGAGGCTGGGAGG + Intergenic
1054659641 9:67692029-67692051 CTATGTAGGGGGAGGCTGGGAGG + Intergenic
1054880827 9:70142902-70142924 TTGACCATGGGGATGGTGGGAGG + Intronic
1055011119 9:71566601-71566623 GTGTTTAGGGGGGTGGTGGGGGG - Intergenic
1055242248 9:74198004-74198026 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1055586087 9:77761099-77761121 CTGTCCAGGAGGGAGGTGGGGGG + Intronic
1056007134 9:82284882-82284904 CTGCCTCGGGGGAAGGTGGGTGG - Intergenic
1056564128 9:87758444-87758466 CTGTCTGGGAGGGAGGTGGGGGG - Intergenic
1056564280 9:87758826-87758848 CTGTCTGGGAGGGAGGTGGGGGG - Intergenic
1057594032 9:96399331-96399353 CTTTTTTGGGGGATGGTGGAGGG + Intronic
1057817164 9:98304221-98304243 CGGTCTGGAGGGATGGTGGGGGG + Intronic
1057905233 9:98977711-98977733 AGGTCTAGGGGGATGGAGGGTGG + Intronic
1058098371 9:100889291-100889313 CTGGGTGGGGGGATGGAGGGAGG - Intergenic
1059121070 9:111641385-111641407 CTGTCTGGGAGGGAGGTGGGGGG + Intronic
1059416534 9:114166057-114166079 CTGGCTGGATGGATGGTGGGTGG - Intronic
1060687310 9:125624191-125624213 CTGTCTGGGAGGGAGGTGGGGGG + Intronic
1061798010 9:133099465-133099487 CTGTCTGGGCTAATGGTGGGAGG + Intronic
1062311279 9:135938797-135938819 CTGGCACGGGGGATGGTGGGGGG + Intronic
1062388595 9:136325076-136325098 CTGGTAAGGTGGATGGTGGGAGG + Intergenic
1203463781 Un_GL000220v1:67989-68011 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
1203405794 Un_KI270539v1:836-858 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1186293764 X:8126341-8126363 GTGTCTAGGTGGAGAGTGGGAGG - Intergenic
1187950596 X:24466224-24466246 CTGTCCGGTGGGCTGGTGGGCGG + Intronic
1188367456 X:29333284-29333306 CCGTCCGGGAGGATGGTGGGGGG - Intronic
1189837489 X:45040145-45040167 CCGTCCGGGAGGATGGTGGGGGG - Intronic
1189968424 X:46395792-46395814 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
1190056706 X:47185419-47185441 CTGTAGAGGGTGAGGGTGGGCGG - Intronic
1192326294 X:70134874-70134896 CTTTCTTGGCGGGTGGTGGGGGG + Intronic
1192567969 X:72179335-72179357 CCGTCCGGGAGGATGGTGGGGGG + Intergenic
1192722696 X:73716400-73716422 CTGTCTTGGGAGGTGGTGGGGGG - Intergenic
1193164568 X:78265527-78265549 CTGTCCGGGAGGAAGGTGGGGGG - Intergenic
1193207402 X:78765295-78765317 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1193423129 X:81308333-81308355 CACTCTGGTGGGATGGTGGGAGG + Intergenic
1194024534 X:88735640-88735662 CTGTGTCTGGGGAGGGTGGGTGG + Intergenic
1195792824 X:108607486-108607508 CTGTCTTGGGGTATGGGGGGAGG - Intronic
1195869333 X:109469790-109469812 CTGTGTAAGAGGAAGGTGGGAGG + Intronic
1196624518 X:117863182-117863204 ATGTGTGGGGGGGTGGTGGGAGG - Intergenic
1196812533 X:119640144-119640166 CTGGATAGTGGGAGGGTGGGAGG - Intronic
1197773813 X:130107354-130107376 CTGTGTGTGGGGAGGGTGGGAGG + Intronic
1198629606 X:138620309-138620331 CTGTCAAGGGGGGTGGGGTGTGG + Intergenic
1201282277 Y:12352287-12352309 CTGTCCAGGAGGGAGGTGGGGGG + Intergenic