ID: 954134585

View in Genome Browser
Species Human (GRCh38)
Location 3:48576110-48576132
Sequence TACAAGAACCCCAATGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 131}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954134574_954134585 7 Left 954134574 3:48576080-48576102 CCCACTGCCCAAGTTCCCTTGAG 0: 1
1: 0
2: 1
3: 16
4: 150
Right 954134585 3:48576110-48576132 TACAAGAACCCCAATGGGGCAGG 0: 1
1: 0
2: 0
3: 10
4: 131
954134573_954134585 8 Left 954134573 3:48576079-48576101 CCCCACTGCCCAAGTTCCCTTGA 0: 1
1: 0
2: 2
3: 14
4: 216
Right 954134585 3:48576110-48576132 TACAAGAACCCCAATGGGGCAGG 0: 1
1: 0
2: 0
3: 10
4: 131
954134571_954134585 23 Left 954134571 3:48576064-48576086 CCCTTTCTGGTGTGTCCCCACTG 0: 1
1: 0
2: 0
3: 21
4: 213
Right 954134585 3:48576110-48576132 TACAAGAACCCCAATGGGGCAGG 0: 1
1: 0
2: 0
3: 10
4: 131
954134580_954134585 -8 Left 954134580 3:48576095-48576117 CCCTTGAGTGTGGGCTACAAGAA 0: 1
1: 0
2: 0
3: 9
4: 142
Right 954134585 3:48576110-48576132 TACAAGAACCCCAATGGGGCAGG 0: 1
1: 0
2: 0
3: 10
4: 131
954134581_954134585 -9 Left 954134581 3:48576096-48576118 CCTTGAGTGTGGGCTACAAGAAC 0: 1
1: 0
2: 0
3: 4
4: 117
Right 954134585 3:48576110-48576132 TACAAGAACCCCAATGGGGCAGG 0: 1
1: 0
2: 0
3: 10
4: 131
954134578_954134585 0 Left 954134578 3:48576087-48576109 CCCAAGTTCCCTTGAGTGTGGGC 0: 1
1: 0
2: 0
3: 11
4: 122
Right 954134585 3:48576110-48576132 TACAAGAACCCCAATGGGGCAGG 0: 1
1: 0
2: 0
3: 10
4: 131
954134572_954134585 22 Left 954134572 3:48576065-48576087 CCTTTCTGGTGTGTCCCCACTGC 0: 1
1: 0
2: 2
3: 24
4: 176
Right 954134585 3:48576110-48576132 TACAAGAACCCCAATGGGGCAGG 0: 1
1: 0
2: 0
3: 10
4: 131
954134570_954134585 24 Left 954134570 3:48576063-48576085 CCCCTTTCTGGTGTGTCCCCACT 0: 1
1: 0
2: 0
3: 24
4: 240
Right 954134585 3:48576110-48576132 TACAAGAACCCCAATGGGGCAGG 0: 1
1: 0
2: 0
3: 10
4: 131
954134579_954134585 -1 Left 954134579 3:48576088-48576110 CCAAGTTCCCTTGAGTGTGGGCT 0: 1
1: 0
2: 3
3: 24
4: 196
Right 954134585 3:48576110-48576132 TACAAGAACCCCAATGGGGCAGG 0: 1
1: 0
2: 0
3: 10
4: 131
954134575_954134585 6 Left 954134575 3:48576081-48576103 CCACTGCCCAAGTTCCCTTGAGT 0: 1
1: 0
2: 0
3: 11
4: 214
Right 954134585 3:48576110-48576132 TACAAGAACCCCAATGGGGCAGG 0: 1
1: 0
2: 0
3: 10
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954134585 Original CRISPR TACAAGAACCCCAATGGGGC AGG Intronic
900165636 1:1243313-1243335 TCCAAGGCCCCCCATGGGGCAGG + Intronic
901441088 1:9278917-9278939 TACCAGAATCCCCATGGGGAGGG - Intergenic
904528024 1:31149108-31149130 TAAAAAAACCCCAGTGAGGCCGG - Intergenic
906129272 1:43446380-43446402 TTCCCGAATCCCAATGGGGCAGG + Exonic
907077182 1:51589690-51589712 AACAAGAAAGCCAATGTGGCTGG + Intronic
907286785 1:53385571-53385593 TGCAAGAAGCCCAAGGGAGCCGG - Intergenic
907420173 1:54341935-54341957 CAAAAGAAGCCCAATGTGGCTGG + Intronic
912965706 1:114235401-114235423 TACTAGAAAGCCAATGGGGTGGG - Intergenic
915263347 1:154695608-154695630 TACAAGAACCCCCACTGGTCAGG - Intergenic
916145787 1:161738095-161738117 GGCAATAAGCCCAATGGGGCTGG - Intergenic
918582996 1:186154144-186154166 TACTAGAACTCCAATTGGGTTGG - Intronic
919325434 1:196100732-196100754 TACAAGAACCACAATGTTACTGG + Intergenic
919331833 1:196181845-196181867 TACTGGAACCCCAATGTAGCTGG + Intergenic
919368976 1:196701507-196701529 TCCAGGCAGCCCAATGGGGCTGG + Intronic
919711674 1:200735410-200735432 TACTAGAACCCCAACTGGGAAGG - Intergenic
922758430 1:228109470-228109492 TACAAGAACCCAGGCGGGGCCGG + Intergenic
923379409 1:233400788-233400810 TATAAAAAACACAATGGGGCCGG + Intergenic
1064243145 10:13648504-13648526 GACAAGGAACCCAACGGGGCCGG + Intronic
1072188281 10:93061870-93061892 AACAAGATCCCCAGTGGGCCTGG - Intronic
1073255670 10:102149434-102149456 TACAAAGAACCCAAGGGGGCTGG + Intronic
1073464511 10:103686478-103686500 TCCAGGAGCCCCAGTGGGGCTGG - Intronic
1075745356 10:124723745-124723767 TGCAGGAACCCCAGTGGGACAGG + Intronic
1079960169 11:26914045-26914067 TACAAGAACACCAGTGAGGCTGG - Intergenic
1080708132 11:34718769-34718791 TAAAAGAAGGCCAATGTGGCTGG + Intergenic
1081939073 11:46925332-46925354 TAGATGAACTCCAATGGAGCAGG + Intergenic
1086227268 11:84527072-84527094 TTTAAGACCCCCAGTGGGGCCGG - Intronic
1089463527 11:118667497-118667519 TATAAGAAACCCATTTGGGCTGG - Intronic
1093964802 12:25312792-25312814 TACAACAACCCAAATCAGGCAGG + Intergenic
1097567723 12:61292213-61292235 TACAAGAACATAAATGGAGCTGG + Intergenic
1097855416 12:64456542-64456564 TTCAAGAACCAAAAAGGGGCCGG + Intronic
1098536271 12:71597014-71597036 TATAAGAACCCCATGGGGGGAGG - Intergenic
1104050767 12:125192163-125192185 TTCAACAACCCTAATGGGGTAGG + Intronic
1105567124 13:21560675-21560697 TGCAATAATCCCAATGGGGTAGG - Intronic
1107010538 13:35665922-35665944 TACAAAAACTCCAAAGAGGCTGG - Intronic
1107295583 13:38903804-38903826 TTCAAGAAGCCAAATGGGCCGGG + Intergenic
1109188664 13:59299875-59299897 TACCAGAACCCCAATTTAGCTGG - Intergenic
1115346527 14:32348707-32348729 CAAAAGAAACACAATGGGGCTGG - Intronic
1117402053 14:55367444-55367466 TAGAAGAACCCATAAGGGGCCGG + Exonic
1118235175 14:63996504-63996526 GACCAGAACTCCAGTGGGGCTGG - Intronic
1121123695 14:91392654-91392676 TTCAAGAACTCCAAAGGGCCAGG - Intronic
1122131369 14:99605867-99605889 TCCAAGAAGGCCAGTGGGGCTGG + Intergenic
1122946809 14:105015036-105015058 AACAAGAATACCAATGGGACAGG + Intronic
1123784705 15:23659024-23659046 TATAAGAACCTCAAAGAGGCTGG + Intergenic
1128643031 15:69353883-69353905 CACAAGAAGCCCAAAGTGGCTGG - Intronic
1128669476 15:69563641-69563663 TCCAAGAACCCCTATGGCCCCGG + Intergenic
1129779121 15:78257871-78257893 TACAAAAAGCCCAATAGGGTGGG - Intergenic
1130552882 15:84903024-84903046 TATAAGAACTCAAATGTGGCTGG - Intronic
1130647347 15:85740849-85740871 TACAAGAACCTCAAAGGTGCAGG - Intronic
1130863480 15:87911461-87911483 TTCTAGAAACCCAATGGGGATGG + Intronic
1131484824 15:92810977-92810999 TATAAGGACACAAATGGGGCAGG - Intergenic
1131635534 15:94229791-94229813 AACAGGAACTCCACTGGGGCAGG + Intergenic
1131662675 15:94535318-94535340 TACAACAACCCAAATCAGGCAGG - Intergenic
1132156972 15:99502642-99502664 CACAAGAAACACACTGGGGCTGG + Intergenic
1134450097 16:14358035-14358057 TACAAGAAGATCAGTGGGGCTGG + Intergenic
1137708394 16:50550012-50550034 TACAGGAACCCCAGTAGAGCAGG + Intronic
1138283934 16:55793772-55793794 TCCAGAAACCCCAATGGGGAAGG + Intergenic
1138285068 16:55803215-55803237 TCCAGAAACCCCAATGGGGAAGG - Exonic
1139437353 16:66943834-66943856 TACAGGAACCCCAATGGCGAGGG + Exonic
1139746230 16:69076851-69076873 TAAATGAACTCCAATGGGACAGG - Intronic
1140014761 16:71171117-71171139 TACGAGAAGGCCAGTGGGGCTGG - Intronic
1140389397 16:74572212-74572234 CATAAAAACCCCAAAGGGGCTGG + Intronic
1143227668 17:5321011-5321033 TACAAGAAACCCACTTTGGCTGG + Intronic
1147688084 17:42299288-42299310 TTCAAGCACCCCACTGAGGCAGG + Intronic
1150236760 17:63599624-63599646 TATAAGAACCTCCATGGGGCTGG - Intergenic
1156912269 18:42425233-42425255 TACAAGAACCACAATGTTACTGG - Intergenic
1165339187 19:35198410-35198432 AACAAGAACTGAAATGGGGCTGG + Intergenic
926324532 2:11772960-11772982 TATAAGAAGCCCAATGACGCTGG - Intronic
926505511 2:13709770-13709792 TACAAGAACCCCCTTCAGGCAGG + Intergenic
928031421 2:27783144-27783166 TACAAGATGCCCCAGGGGGCCGG + Intronic
941749570 2:169120479-169120501 TAGAAGAACCAAAATAGGGCTGG + Intergenic
946879259 2:224161010-224161032 CACAGCAACCCCAATGGAGCAGG - Intergenic
1170813801 20:19696361-19696383 TAGAAGAACTGCAAAGGGGCTGG - Intronic
1175074513 20:56361283-56361305 TAGAGAAACACCAATGGGGCGGG - Intronic
1175839688 20:62019066-62019088 TACAACCACCACAATGGGTCAGG + Intronic
1178402452 21:32298598-32298620 TAGAAGATGCCCAATAGGGCTGG - Intronic
1180836449 22:18932070-18932092 TAAAGGAACCCCAAAGGGGAAGG + Intronic
1183522522 22:38303627-38303649 CAGAAGAGGCCCAATGGGGCTGG + Intronic
1203286541 22_KI270734v1_random:157369-157391 TAAAGGAACCCCAAAGGGGAAGG + Intergenic
950101372 3:10358899-10358921 TGCAAAATCCTCAATGGGGCGGG - Exonic
951652115 3:24962223-24962245 TAAAAGACACCCAAAGGGGCCGG - Intergenic
954134585 3:48576110-48576132 TACAAGAACCCCAATGGGGCAGG + Intronic
954135684 3:48581185-48581207 TCCAAGAACCCCCATGATGCTGG + Intronic
955740138 3:62081639-62081661 TACAAGAAAGACAAAGGGGCCGG - Intronic
965369249 3:167840534-167840556 TGGAAGAACCCCAAGAGGGCAGG + Intergenic
974402678 4:61426014-61426036 TAGAAGTGCCCCACTGGGGCTGG + Intronic
975364218 4:73509820-73509842 TAAAAGAAGCCCAAGGGAGCTGG - Intergenic
978096096 4:104780318-104780340 TACAAAAATGCCAATGGGGTGGG + Intergenic
980880321 4:138703576-138703598 TATAAGAACATCAGTGGGGCTGG - Intergenic
981015083 4:139965875-139965897 TATAAGAACCTCACTGGAGCTGG - Intronic
982925413 4:161331339-161331361 TACCGGAACCCCAATTTGGCTGG - Intergenic
983237318 4:165194173-165194195 AACAAGAAGACCAATGTGGCTGG - Intronic
983869454 4:172808117-172808139 TACAAGAATACAGATGGGGCCGG - Intronic
984600683 4:181722915-181722937 TAGAAGGACCACAATGGGCCAGG + Intergenic
985293853 4:188413511-188413533 TACAAGAAGCCTCTTGGGGCTGG - Intergenic
987058458 5:14218682-14218704 CACAAGAAGCCCAGTGGGGCAGG + Intronic
987466349 5:18276336-18276358 TACAACAACCCAAATCAGGCAGG + Intergenic
987467997 5:18295512-18295534 TACAAGAACCCAAACCAGGCAGG - Intergenic
988043038 5:25912152-25912174 CACAAGAATCCTGATGGGGCTGG - Intergenic
988377929 5:30461870-30461892 TAAAAGAACCCAAATGGTGCGGG + Intergenic
990355829 5:54965233-54965255 CACAACAACCCCATTGAGGCAGG - Intergenic
990495422 5:56343053-56343075 TGGAAGAACCCCAATGGGAGAGG - Intergenic
992626388 5:78639168-78639190 AATAAGAACCCCAATGGTGGTGG - Intronic
997599795 5:135131487-135131509 CACAGCAACCCCAAAGGGGCTGG - Intronic
998916281 5:147015082-147015104 TAGAAGAACTCCAAGAGGGCAGG + Intronic
999961408 5:156759999-156760021 TACAAAAACCCCAATATGTCTGG - Intronic
1003449906 6:6221026-6221048 TACAAGCATCCAAATGGGGATGG - Intronic
1003601204 6:7519112-7519134 TACAAGAAGCACAATCAGGCTGG - Intergenic
1005976500 6:30804121-30804143 CACAAGAACCCCAGAGGGGCTGG - Intergenic
1006116860 6:31780196-31780218 TGCCAGAACCCCATGGGGGCAGG + Intronic
1006386356 6:33733270-33733292 TAGCAGAGCCCCAAGGGGGCTGG + Intronic
1010465594 6:76164446-76164468 TGCAAGAAGGCCAATGTGGCTGG + Intergenic
1011105168 6:83771589-83771611 TACAGGAACACGAATGGAGCTGG - Intergenic
1013322920 6:109012758-109012780 TACAGGAAGCTCAATGGGTCTGG + Intronic
1014928665 6:127306474-127306496 CACAAGAACACCAAGGGGGAAGG - Intronic
1015906171 6:138119029-138119051 TACAAGAACACAGATGGAGCTGG - Intergenic
1016402180 6:143693059-143693081 TATAAGAACCCCATTGGAGTAGG + Intronic
1017933486 6:158981986-158982008 TACGAGAACCCAAATAGGTCTGG + Intronic
1018125176 6:160675833-160675855 TACAGGAACACGAATGGAGCTGG + Intergenic
1019684179 7:2371423-2371445 TAAAGGCACACCAATGGGGCTGG - Intronic
1020915583 7:14188363-14188385 TAAAAGATCCCCAATTGGCCGGG + Intronic
1021988324 7:26118703-26118725 AACCAGAACCTAAATGGGGCAGG + Intergenic
1024932677 7:54680317-54680339 TAAAAAAACCCCAAAGTGGCAGG - Intergenic
1026465456 7:70649821-70649843 TACAAAATCACCACTGGGGCCGG - Intronic
1028084998 7:86625609-86625631 TACTGGAACCCCAATTTGGCTGG - Intergenic
1030253575 7:107480514-107480536 TAAAAGAACCCAGATGAGGCTGG + Intronic
1038753320 8:30316835-30316857 TTCAAGACCTCCAAAGGGGCTGG - Intergenic
1038773022 8:30501559-30501581 TACAAGCACCCCAATCTGACTGG - Intronic
1040464821 8:47684924-47684946 TAAAAGAAACCAAATGGGCCGGG + Intronic
1041627577 8:60048145-60048167 CTCAAGCACCCCAATGGGGTTGG - Intergenic
1045578129 8:103448194-103448216 TACAGGAACCCCAATACAGCTGG + Intergenic
1054934086 9:70668319-70668341 CACAAGTACCACAATGGGGCAGG - Intronic
1055071939 9:72175326-72175348 GAATAGAACCTCAATGGGGCTGG - Intronic
1055197125 9:73609773-73609795 TACAGAGACCCCAATGGGGATGG + Intergenic
1056248676 9:84725533-84725555 TACAAGGACCACAGTGGGGCAGG - Intronic
1056786022 9:89593110-89593132 TCCAAAAACCACAAGGGGGCGGG - Intergenic
1059291404 9:113227548-113227570 TACAAGAATGCAAATGAGGCTGG - Intronic
1061048868 9:128182434-128182456 TAGAAGGACCCCACTGGGCCAGG - Intronic
1062215393 9:135386363-135386385 TTCAAAAAACCCACTGGGGCAGG - Intergenic
1187438164 X:19291546-19291568 TACAGGGACCCCAATGAGCCTGG + Intergenic
1191892154 X:65955179-65955201 TATAAGAAACAAAATGGGGCTGG - Intergenic
1194538610 X:95141771-95141793 TACAAGAACCCAATTGAGGCAGG - Intergenic
1197114282 X:122814101-122814123 TTAAAGAAAACCAATGGGGCTGG - Intergenic