ID: 954137361

View in Genome Browser
Species Human (GRCh38)
Location 3:48588193-48588215
Sequence TAGGCGAGGACAGTGATGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 131}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954137361_954137368 12 Left 954137361 3:48588193-48588215 CCCACCATCACTGTCCTCGCCTA 0: 1
1: 0
2: 0
3: 10
4: 131
Right 954137368 3:48588228-48588250 TGCCACAGCCCTGCCCCCAATGG 0: 1
1: 0
2: 5
3: 53
4: 478
954137361_954137376 30 Left 954137361 3:48588193-48588215 CCCACCATCACTGTCCTCGCCTA 0: 1
1: 0
2: 0
3: 10
4: 131
Right 954137376 3:48588246-48588268 AATGGTCCCTAACTTCCTCCTGG 0: 1
1: 0
2: 0
3: 46
4: 381

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954137361 Original CRISPR TAGGCGAGGACAGTGATGGT GGG (reversed) Intronic
900999079 1:6138639-6138661 TAGGCGAGGAGACCGATGCTCGG - Intronic
905273684 1:36803328-36803350 TAGGGGAGGAGAGTGAGGGAAGG + Intronic
905739816 1:40360692-40360714 AAGGAGAGCACAGTGATTGTGGG + Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
919773090 1:201175467-201175489 TTGGAGAGGAAAGTGATGGAAGG + Intergenic
920309656 1:205041606-205041628 TAGGCAAGGACAGTGTGGGCAGG + Intergenic
920872231 1:209804704-209804726 TGGGAGAGGACAGTTATGCTCGG - Intronic
921627387 1:217392061-217392083 GAGGTGAGGACAGTGAAGGGGGG - Intergenic
922303241 1:224321814-224321836 TAGGCTAGTATAGTAATGGTAGG + Intronic
1065477648 10:26158068-26158090 TAGGCGAGTAAAGTGAGGTTAGG - Intronic
1066127363 10:32354909-32354931 TATGTGGGGACAGTGATGGGAGG - Intronic
1067665096 10:48270877-48270899 TAGACCAGGTCAGTGGTGGTGGG - Intronic
1067757990 10:49019678-49019700 TGGGCGTAGACAGTGCTGGTGGG + Exonic
1068007565 10:51408761-51408783 TAGGCGATGACAGGGATGGCTGG + Intronic
1072043122 10:91628191-91628213 TAGATGAGGACAGTCAGGGTAGG + Intergenic
1073180197 10:101578916-101578938 TTGGTGAGGACAGTGTTGGGAGG - Exonic
1073607945 10:104914925-104914947 TAGCCAAGGACAGTGATGACGGG + Intronic
1075560855 10:123467503-123467525 AAGGGGAGGACAGTGAGGGGAGG + Intergenic
1075631767 10:124004672-124004694 TTGGTGAGGACAGAGATGGTGGG + Intergenic
1081209752 11:40318097-40318119 TAGACGAGTATAGTGATGTTTGG - Intronic
1083597147 11:63923432-63923454 GAGGTGAGGACAGGGATGGAGGG - Intergenic
1084226498 11:67718083-67718105 GAGACGATGGCAGTGATGGTTGG - Intergenic
1084489651 11:69471496-69471518 TCGGCGAGGACAATGAGGGAGGG - Intergenic
1085152877 11:74266180-74266202 TAGCCGGGGACAGTGGTGGGAGG + Intronic
1085606487 11:77904152-77904174 TAGGTGAGGAGAGAGATGGAAGG - Intronic
1086430027 11:86727655-86727677 TTGGCCAAAACAGTGATGGTGGG - Intergenic
1089618659 11:119709673-119709695 TGGGAGAGGAGAGTGATGCTCGG + Intronic
1091887610 12:4027869-4027891 GAGGTAAGGACAGAGATGGTGGG + Intergenic
1094026427 12:25964110-25964132 GAGGAGAGGAAAGTTATGGTTGG + Intronic
1102146151 12:110656437-110656459 TTGGCGAGGGCACTGATGGCAGG + Intronic
1103731849 12:123033053-123033075 TAGGCGAAGCCAGTGATGGGAGG + Intronic
1104320646 12:127747663-127747685 TAGGAGAGGAGAGTGAGGATAGG + Intergenic
1112300566 13:98225928-98225950 TTGGGGAGGTCAGTGATGGTTGG + Intronic
1115660885 14:35493601-35493623 TGGGGGAGCACAGTGATTGTGGG + Intergenic
1122231026 14:100306369-100306391 CAGGCGCGGTCAGGGATGGTGGG + Exonic
1202904164 14_GL000194v1_random:59098-59120 GAGGTGGGGACAGGGATGGTGGG - Intergenic
1126572285 15:50164903-50164925 GAGGAGAGCACAGTGATTGTAGG - Intronic
1132203307 15:99969782-99969804 GGGGGGAGGTCAGTGATGGTGGG + Intergenic
1133247073 16:4456024-4456046 TAGGGGAGGACGGTGCTGGTGGG - Exonic
1133842285 16:9420651-9420673 TAGACGAGGGAAGTGATGTTGGG + Intergenic
1134249300 16:12563235-12563257 TGGGCGGGGTCAGTGATGATGGG - Intronic
1137866638 16:51904056-51904078 TAGACCAGCAAAGTGATGGTGGG + Intergenic
1140786062 16:78343306-78343328 TAGGCGAGGAACGTGGCGGTGGG - Intronic
1141836090 16:86540594-86540616 GAGCCGAGAACAGGGATGGTGGG - Intronic
1146230810 17:31107303-31107325 TAGGGAATGACAGTGATAGTAGG + Intronic
1147300686 17:39524307-39524329 AAGACGAGGACAGTAATGGCTGG - Intronic
1147459464 17:40559115-40559137 GAGGTGAGGACAGTGATGCCGGG - Intronic
1148064574 17:44859675-44859697 TAGGAGGGGGCAGTGATGGGGGG - Intronic
1150937372 17:69651413-69651435 TAGGGAAGGACAGTAATGGAAGG - Intergenic
1152410894 17:80122432-80122454 AAGGTGAGGACGCTGATGGTCGG - Intergenic
1153706851 18:7754707-7754729 CAGGAGTGGACAGTGATGTTTGG + Intronic
1154252464 18:12755893-12755915 TGGGCGATGACAGGGGTGGTTGG + Intergenic
1155998814 18:32361136-32361158 TAGGCAACGACAGTGATGTCAGG - Intronic
1157316402 18:46593576-46593598 TAGGAGAGGATTGTGATGGATGG - Intronic
1160245632 18:77156585-77156607 CAGCCAAGGACAGTGATGGTGGG + Intergenic
1161340207 19:3737542-3737564 GAGGCAAGGACAGAGATGGGGGG - Intronic
1163371970 19:16906116-16906138 CAGGCAAGGAAAGTGATGCTTGG + Intronic
1163620644 19:18357812-18357834 TTGGTGGGGACCGTGATGGTGGG - Intronic
1163725527 19:18921298-18921320 GAGGCCAGGACAGAGTTGGTTGG + Intronic
1164593240 19:29517619-29517641 CAGCCCAGGACAGTGTTGGTGGG + Intergenic
1167812564 19:51847492-51847514 TCGGCGAGGACAGGGATTGGCGG - Intergenic
927868162 2:26606313-26606335 TAGGACAGGACAGTGAGGCTGGG + Intronic
928342661 2:30458629-30458651 TGGGAGTGGAGAGTGATGGTGGG + Intronic
929872205 2:45768557-45768579 TAGGAGGGGACAGTGAGGGCTGG + Intronic
930456407 2:51612870-51612892 TAGGTGAGGACTATTATGGTGGG - Intergenic
934502475 2:94871300-94871322 GAGGCGGGGACAGGGATGGTGGG + Intergenic
934565075 2:95334465-95334487 GAGGGGAGGATAGTGACGGTAGG - Intronic
936656419 2:114493270-114493292 GAAGCCAGGACAGGGATGGTGGG + Intronic
943698222 2:190959678-190959700 TTGGTGAGGACAGTGATTGCTGG + Intronic
945969338 2:216220873-216220895 TAGGTTAGGGCAGTTATGGTGGG + Intergenic
947741615 2:232487416-232487438 GGGGCGGGGACAGAGATGGTGGG - Intronic
948630821 2:239301398-239301420 CAGGCGAGGCCAGTGATGCCAGG + Intronic
1173903370 20:46607375-46607397 GAGGCGAGGACAGGGGTGGAGGG - Intronic
1176386926 21:6142774-6142796 TGGGCGAGCACTGTGATGGAGGG + Intergenic
1176623531 21:9073865-9073887 GAGGTGGGGACAGGGATGGTGGG - Intergenic
1178925221 21:36769062-36769084 TAGCCAGGGACAGTGATGGGAGG + Intronic
1179736547 21:43395478-43395500 TGGGCGAGCACTGTGATGGAGGG - Intergenic
953701157 3:45196785-45196807 CAGGAGAGGAAAGAGATGGTGGG + Intergenic
954137361 3:48588193-48588215 TAGGCGAGGACAGTGATGGTGGG - Intronic
954208192 3:49076276-49076298 GCGGCGATGTCAGTGATGGTGGG - Intronic
954402026 3:50323919-50323941 CAGGCTGGGACAGTGGTGGTAGG + Intronic
955868442 3:63410832-63410854 TTGAGGAGGACAGTGATGGTTGG + Intronic
959126059 3:102291325-102291347 AAGGAGAGCACAGTGATTGTGGG - Intronic
959526381 3:107381903-107381925 AAGGTGAGGACAGGGAGGGTGGG - Intergenic
959868576 3:111300352-111300374 AAGGAGAGCACAGTGATTGTGGG - Intronic
960604334 3:119489487-119489509 TAGAGGAGGGCAGTGGTGGTGGG + Intronic
962240632 3:133748094-133748116 GGGGCCAGGACAGTGATGGGAGG + Intronic
962938298 3:140101929-140101951 TAGGAGAGTACAGGGATGTTTGG + Intronic
973846395 4:54917494-54917516 TAGGTGAGAAAAGGGATGGTAGG - Intergenic
973919938 4:55674326-55674348 AAGGAGAGTACAGTGATTGTGGG - Intergenic
981462918 4:145032585-145032607 TGGGCGATGACAGTGGTGGCTGG - Intronic
982117933 4:152113408-152113430 GAGGAGAGGAGAGTGATGGAGGG + Intergenic
986036941 5:3949659-3949681 TGGGCGATGACAGGGATGGCTGG + Intergenic
992416188 5:76553853-76553875 AATGCAAGGACAGTGTTGGTGGG + Intronic
993848726 5:92978710-92978732 TAGGCAAGGGCAGTAATGGATGG - Intergenic
998173753 5:139887531-139887553 TAGGTGAGCACGGTGGTGGTAGG + Intronic
1000433411 5:161179310-161179332 ACGGAGAGCACAGTGATGGTGGG + Intergenic
1001723074 5:173872540-173872562 TAGGGGCGGAGAGTGGTGGTTGG + Intergenic
1004298680 6:14437450-14437472 TGGGCGATGACAGGGATGGCGGG - Intergenic
1005851131 6:29823338-29823360 TCGGGGAGGGCAGTGATGGGGGG + Intergenic
1009373629 6:62939374-62939396 AAGGAGAGCACAGTGATGGCAGG - Intergenic
1009847456 6:69151400-69151422 TGGGGGAGCACAGTGATTGTGGG - Intronic
1012875545 6:104721355-104721377 GAGGAGAGGGGAGTGATGGTGGG + Intergenic
1013047475 6:106501575-106501597 TAGCCTATGACAGTGATGGCTGG - Intergenic
1016307538 6:142699295-142699317 TAGGAGAGGAAAGGGAGGGTAGG - Intergenic
1018650138 6:165986272-165986294 TCGGAGAGGAGAGTGAAGGTGGG + Intronic
1019496776 7:1344454-1344476 AAGGCCAGGACAGAGATGGATGG + Intergenic
1022526933 7:31044241-31044263 TAGGGGTGGAAAGTGATGGAGGG + Intergenic
1023024854 7:36041163-36041185 TAGTCCAGGGCAGTGATGGGAGG + Intergenic
1024084665 7:45883409-45883431 GAGGTGAGGACATTTATGGTGGG + Intergenic
1025846152 7:65200061-65200083 TAGGTGAGGAGAGAGATGGAAGG + Intergenic
1025896372 7:65705793-65705815 TAGGTGAGGAGAGAGATGGAAGG + Intergenic
1026466487 7:70659176-70659198 TAGGCATGGACAGTGAGGTTCGG + Intronic
1028237930 7:88383613-88383635 TGGGCGATGACAGGGGTGGTTGG - Intergenic
1029790610 7:102839267-102839289 TAGGAGAGCAGGGTGATGGTGGG - Intronic
1032900567 7:136302468-136302490 TAGACGAGGAAAGTGATTTTGGG - Intergenic
1034040373 7:147871071-147871093 GAAGGGAGGCCAGTGATGGTTGG - Intronic
1034261072 7:149755983-149756005 TGGGAGAGGACAGTGCTGGGTGG - Intergenic
1038097511 8:24331296-24331318 TGGGAGAGGACTGTGATTGTGGG + Exonic
1043502362 8:80870800-80870822 TAGGAGAGGTCAGGGATAGTGGG - Intronic
1043749587 8:83918843-83918865 TAGGAGAGAAGAGGGATGGTAGG + Intergenic
1045227321 8:100261694-100261716 TAGGGGAGGGAAGTGTTGGTGGG - Exonic
1048125779 8:131634461-131634483 TATGCAGGGACAGGGATGGTTGG - Intergenic
1049097904 8:140559609-140559631 TAGGCCAGGCCAGCCATGGTGGG + Intronic
1056513993 9:87333079-87333101 AAGGCCAGGACAGTGGTGGCAGG - Intergenic
1057225751 9:93292332-93292354 TAGGCTATGACAGAGATGGAAGG + Exonic
1059910672 9:119040559-119040581 AAGGAGGGGACAGTGGTGGTTGG - Intergenic
1060321473 9:122565399-122565421 TGGGCGATGACAGTGGTGGCTGG - Intergenic
1061852416 9:133423909-133423931 TGGGAGAGGACAGTGAGGGCTGG + Intronic
1062543463 9:137051717-137051739 TAGGCCAGGAGAGTGAGGGTGGG + Intronic
1203746715 Un_GL000218v1:44293-44315 GAGGTGGGGACAGGGATGGTGGG - Intergenic
1203563387 Un_KI270744v1:75187-75209 GAGGCAGGGACAGGGATGGTGGG + Intergenic
1189412003 X:40780596-40780618 AAGGAGAGCACAGTGATGGTGGG - Intergenic
1191873297 X:65768904-65768926 TAGGCCAGGCCTGTGATGGGAGG - Intergenic
1193356351 X:80523912-80523934 TAGGCGATGACAGGGGTGGCTGG - Intergenic
1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG + Intronic
1195601225 X:106751277-106751299 AAGGAGAGCACAGTGATTGTGGG + Intronic
1195669053 X:107453731-107453753 AAGGCAAGGACAGTGATCTTGGG + Intergenic
1195705450 X:107735028-107735050 GTGGCAAGGACAGTGAGGGTCGG - Intronic
1199144576 X:144350064-144350086 TAGGTGAGGACTTTTATGGTGGG - Intergenic
1201160044 Y:11159307-11159329 GAGGTGGGGACAGGGATGGTGGG - Intergenic
1201583793 Y:15538194-15538216 TAGGGGAGAACAGAGAGGGTTGG + Intergenic