ID: 954138136

View in Genome Browser
Species Human (GRCh38)
Location 3:48591700-48591722
Sequence TCTGCTGGAGGGCCACGAGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 182}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954138136_954138143 9 Left 954138136 3:48591700-48591722 CCACCTCGTGGCCCTCCAGCAGA 0: 1
1: 0
2: 2
3: 23
4: 182
Right 954138143 3:48591732-48591754 GTGAGGCGGTACTCAGTGCCCGG 0: 1
1: 0
2: 0
3: 4
4: 100
954138136_954138141 -8 Left 954138136 3:48591700-48591722 CCACCTCGTGGCCCTCCAGCAGA 0: 1
1: 0
2: 2
3: 23
4: 182
Right 954138141 3:48591715-48591737 CCAGCAGAGTGTAGAGTGTGAGG 0: 1
1: 0
2: 2
3: 16
4: 204
954138136_954138146 28 Left 954138136 3:48591700-48591722 CCACCTCGTGGCCCTCCAGCAGA 0: 1
1: 0
2: 2
3: 23
4: 182
Right 954138146 3:48591751-48591773 CCGGCTGCAGCCCATCCAACTGG 0: 1
1: 0
2: 0
3: 12
4: 130
954138136_954138142 -5 Left 954138136 3:48591700-48591722 CCACCTCGTGGCCCTCCAGCAGA 0: 1
1: 0
2: 2
3: 23
4: 182
Right 954138142 3:48591718-48591740 GCAGAGTGTAGAGTGTGAGGCGG 0: 1
1: 0
2: 2
3: 39
4: 448

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954138136 Original CRISPR TCTGCTGGAGGGCCACGAGG TGG (reversed) Exonic
900118887 1:1040314-1040336 TTCGCTGGAGGCCCACGAGGTGG + Intronic
900138135 1:1127518-1127540 TGTGCTGGAGGGGCAAGATGGGG - Intergenic
900146025 1:1158951-1158973 GCTGCTGGAGGACCCCGAGCTGG - Intergenic
900237519 1:1599871-1599893 GCTGCCCGAGGGCCCCGAGGCGG - Exonic
900369915 1:2327689-2327711 ACAGGGGGAGGGCCACGAGGAGG + Intronic
900375370 1:2351954-2351976 TCTGCTCGAGGGACACCAGTAGG + Intronic
900395109 1:2450286-2450308 TGTGCTGGAGGCCCACGGGGAGG - Intronic
900554216 1:3271696-3271718 TCAGCTGGAGGGGCACCTGGTGG + Intronic
901646006 1:10717068-10717090 GCTGCTGGAGGGACAGGAGCAGG + Intronic
902080496 1:13817468-13817490 TCTGCTGGTGACCCACGAGCAGG + Intronic
904033520 1:27547515-27547537 GCTGCAGCAGGGCCACGGGGTGG + Exonic
904362371 1:29984782-29984804 TCAGCTGGAGGACCAGGAAGGGG - Intergenic
905449085 1:38045840-38045862 TCAGCTGCAGGGCCTCGAAGCGG + Exonic
905794354 1:40807270-40807292 ACTGCTGGAGAGTCACAAGGCGG + Intronic
905960699 1:42040258-42040280 GCTGCTGGAGTGCCAGGAGGAGG + Intergenic
912532690 1:110338251-110338273 TCCGCCCGCGGGCCACGAGGCGG + Intergenic
913524575 1:119678712-119678734 TCTGGTGGAGTGCCACCAGAAGG + Intronic
917292166 1:173481668-173481690 GCTGCTGGCAGGCCAAGAGGAGG - Intronic
917438535 1:175045302-175045324 TGTGCTGCAGGGCAACGTGGCGG + Intergenic
919851258 1:201674456-201674478 TTTGCTGGAGGGCCTCCAGGAGG - Intronic
922167833 1:223130452-223130474 TTTTCTGCAGGGCCACGAAGAGG - Intronic
922620667 1:226986187-226986209 TCTGTATGAGTGCCACGAGGCGG + Intronic
1062821925 10:541412-541434 TCGGGTGGAGGGTCACGATGTGG - Intronic
1066048848 10:31617610-31617632 TCTGCAGGTGGGCCCTGAGGTGG + Intergenic
1066464430 10:35640418-35640440 CCTGGTGGCGGGCCACGAGAAGG - Exonic
1069114138 10:64483525-64483547 TCTGCTGGGGGGCGGCGGGGGGG - Intergenic
1069679979 10:70277537-70277559 TGTGCTGGAGGGACACCAGCTGG + Intronic
1069921045 10:71815753-71815775 TCTGCTGGACGTCCAGGTGGAGG + Exonic
1070617222 10:77978381-77978403 TGTGCTGAAGGACCAGGAGGAGG + Intronic
1070812515 10:79305542-79305564 TCTGCTGGAGGGCCTGGAGGTGG + Exonic
1070965147 10:80525700-80525722 TCTGCTGGATGGACAAGTGGTGG - Exonic
1071255525 10:83868567-83868589 TCTGCTCAAAGGCCATGAGGTGG - Intergenic
1072631342 10:97149045-97149067 CCTGAAGGAGGGCCACGGGGGGG - Intronic
1076793594 10:132788575-132788597 TCTGCTCGCGGGCCAGGAGGTGG - Intergenic
1077704209 11:4468460-4468482 TCTGTTGGAGGGCAAAGATGAGG - Intergenic
1077794368 11:5476392-5476414 TATGCTGTATGGCCACAAGGGGG + Intronic
1078265000 11:9748646-9748668 GGTGCTGAAGGGACACGAGGAGG - Intronic
1078518861 11:12047533-12047555 TCTGCAGGATGCCCAGGAGGGGG + Intergenic
1079233630 11:18671360-18671382 GGGGCTGGAGGGCCCCGAGGAGG + Intergenic
1081746096 11:45473481-45473503 CCTGCTGGTGGGCCATGGGGAGG + Intergenic
1083149991 11:60785844-60785866 ACTTGTCGAGGGCCACGAGGGGG + Intronic
1083571313 11:63763519-63763541 TATCCTGGAGGCCTACGAGGAGG - Exonic
1084142180 11:67239963-67239985 TCTGCTGCAGAGCCGGGAGGGGG - Intronic
1084274307 11:68043856-68043878 GCTGCTGCAGGGCCCCGAGGCGG - Exonic
1084362383 11:68677466-68677488 GCAGCTGGGGGGCCACAAGGAGG - Intergenic
1088599593 11:111462774-111462796 CCGGCTGCAGGGCCAGGAGGAGG + Intergenic
1089284164 11:117394988-117395010 TCTGCTGGAGGTCCAGGTGAGGG + Exonic
1089287278 11:117415705-117415727 GCTGCTGGAGGGCCAAGACAAGG + Intergenic
1091589477 12:1834830-1834852 TCTGCTGGAGGGCGGGGAGGAGG - Exonic
1093860152 12:24155562-24155584 TCTGCAGGAAGGCCACCATGTGG - Intergenic
1093935255 12:24993942-24993964 GCAGATGGAGGGCCAGGAGGAGG - Exonic
1095955205 12:47802092-47802114 TCTGCCAGAGAGCCAGGAGGTGG - Intronic
1096243832 12:49973592-49973614 GCACCTGGAGGGCCAGGAGGCGG + Intronic
1096639955 12:52986228-52986250 TCTGCTGGAGAGCCACAGGCAGG - Intergenic
1097728557 12:63101667-63101689 TCTGCTTGATGGCCTCGTGGTGG - Intergenic
1104968393 12:132520171-132520193 TGTGCTGGAGGGGTACAAGGAGG - Intronic
1104996601 12:132661742-132661764 ACTCCTGGAGGGACACCAGGTGG - Intronic
1106218475 13:27724150-27724172 CCTCCTGGAGGGCCATAAGGAGG - Intergenic
1107016539 13:35712058-35712080 TCTCCTTGGGGGCCATGAGGAGG - Intergenic
1108747333 13:53409009-53409031 CCGGCTGGAGGGCCACGGGCGGG - Intergenic
1110437657 13:75493362-75493384 TATGCTGGAGGGATACCAGGAGG - Intergenic
1110558405 13:76885746-76885768 GCTGCTGGGGCGCCCCGAGGCGG + Exonic
1112276143 13:98021939-98021961 TCTTCTGGAGAGCCACAAGCAGG + Exonic
1113146058 13:107208884-107208906 TCTGCTGGAGGGGGAGGAGGGGG - Intronic
1113353054 13:109548496-109548518 TCTGATGGAGGGTCAGGAGGAGG - Intergenic
1114347198 14:21808466-21808488 TCTGCTTGATGGCCACGAGGTGG - Intergenic
1119323877 14:73747104-73747126 TGTGCTGGAGGGCCAGCTGGAGG - Intronic
1121122044 14:91382179-91382201 TCTGCTGTGGGGGCAGGAGGTGG - Intronic
1121310415 14:92932629-92932651 GCGGCTGGAGGGGCAGGAGGAGG + Exonic
1121655461 14:95592277-95592299 TCTGCTGGAGGGCCAAAGAGAGG + Intergenic
1122603439 14:102932497-102932519 TCTGCTGGATGGGCACCTGGGGG - Exonic
1122776714 14:104120105-104120127 GCTGCTGGAGGGCCACGCCGGGG + Intergenic
1127722241 15:61714718-61714740 TTTGGTGGAGGGACAAGAGGAGG - Intergenic
1127793935 15:62422645-62422667 GCTGCTGGAGTGCCAGGAGATGG - Intronic
1128446489 15:67766189-67766211 TCTGCTGAAGGGACACAAGCTGG - Intronic
1129641596 15:77384734-77384756 TCTGGTGGAGGGCCAAGGGAAGG - Intronic
1129704198 15:77785253-77785275 GCTGCTTGAGGGCCAAGAGAGGG - Intronic
1130579280 15:85120931-85120953 TGTGCTGGAGAGCCACCATGCGG + Exonic
1131048808 15:89333316-89333338 TCTGCTTCTGGGCCAGGAGGCGG + Exonic
1131988245 15:98066454-98066476 TCTGCTGAAGGAGCACGAGGGGG - Intergenic
1132973378 16:2699844-2699866 TGTGCTGCAGTGCCAGGAGGAGG + Exonic
1136248716 16:28989846-28989868 TCTGCGGGAGGGGCAGGAGCTGG + Intronic
1136568043 16:31081559-31081581 CCGGCTGGAGGGCCACGGGCGGG + Exonic
1139590007 16:67928270-67928292 TCTGGTGGAGGGCCATGGCGTGG + Exonic
1140881842 16:79205481-79205503 TCTTCTGGAGGGCTAAGAGTTGG + Intronic
1141948204 16:87324542-87324564 GGTGCTGGAGGGCCAGGGGGAGG - Intronic
1142117234 16:88365462-88365484 TCTGCTGCTGGACCAGGAGGTGG + Intergenic
1142432333 16:90036493-90036515 GCTGATGCAGCGCCACGAGGAGG + Exonic
1142669391 17:1480765-1480787 GCTGCTGGAGGGGGGCGAGGAGG - Exonic
1143011626 17:3869328-3869350 TCTGCTGGAGGCCCATGGAGAGG - Intronic
1143480672 17:7225989-7226011 ACTGCTGGAGGGACTGGAGGTGG + Exonic
1143598659 17:7930250-7930272 CCCCCTGGAGGGCCACGAAGTGG - Intronic
1144778211 17:17795420-17795442 GCTGCTGCAGTGCCCCGAGGTGG + Exonic
1145247089 17:21276292-21276314 TCTGTTGGGGGGCCACGACCCGG - Intergenic
1146405653 17:32534807-32534829 CCAGCTGGAGGGCCACAAGAAGG + Intronic
1147757485 17:42778646-42778668 TCTGCTTCAGGGCCACAAAGGGG - Intronic
1148738548 17:49879110-49879132 CCTGCAGGAGGGCCCAGAGGAGG + Intergenic
1148858512 17:50592068-50592090 TCTGGTGGAGGGCTTCCAGGCGG + Exonic
1148866356 17:50630794-50630816 TTTGCAGGAGGGGCACCAGGTGG - Intergenic
1150134929 17:62690262-62690284 GCTGCTGCTGGGCCACAAGGAGG + Exonic
1150666879 17:67148131-67148153 ACTGCTGGGGGGCCGGGAGGGGG + Intronic
1151990722 17:77572372-77572394 TCAGATGGAGGGGCAGGAGGAGG - Intergenic
1152642649 17:81455621-81455643 CCTGCTGGAGTGAGACGAGGAGG - Intronic
1152699699 17:81812837-81812859 TCTGCTGGGCGTCCACGAAGTGG + Exonic
1156671199 18:39472033-39472055 TTTGCTGTAGGGCCATGAGGAGG + Intergenic
1159644814 18:70905382-70905404 GCTGCTGGAGGACGACGAGGTGG + Intergenic
1161220677 19:3116701-3116723 TGTCCTGGAGGGCCTCGCGGTGG + Intronic
1162517214 19:11155668-11155690 GCTGCTGGGGCGCCACGAGCAGG - Exonic
1162845510 19:13389313-13389335 TCTCCAGGAGGGACACCAGGTGG + Intronic
1163597981 19:18231534-18231556 GCTGCTGGAGGGCCAGGCTGGGG + Intronic
1164590711 19:29505330-29505352 TCTGGGGGAGGGACAGGAGGAGG + Intergenic
1166295822 19:41888811-41888833 GCTGCAGGAGGGCCATGAGGTGG - Exonic
1166837857 19:45678118-45678140 CCTGCTGGGTGTCCACGAGGTGG + Exonic
1167133070 19:47600377-47600399 ACTGCGGGCGGGCCACGGGGCGG - Intergenic
1167421170 19:49404230-49404252 TCCCCTGGAGTGCCAAGAGGAGG + Intronic
1167445561 19:49535100-49535122 TCTCCTGGGGGCCCAGGAGGGGG - Intronic
1168713402 19:58514071-58514093 GCTGCTGGAGCGCCACCTGGCGG - Exonic
927292437 2:21417980-21418002 TTCGCTGGAGGGGCACAAGGAGG - Intergenic
928830106 2:35471731-35471753 TGTCCTGGAGGCCCTCGAGGTGG + Intergenic
929019570 2:37538341-37538363 AATGCTGGAATGCCACGAGGAGG - Intergenic
931087127 2:58844920-58844942 TCTTCTGGAGGGGAAAGAGGTGG + Intergenic
935592813 2:104856593-104856615 TCAGCTGCAGGGCCTCGAAGCGG - Exonic
935789570 2:106578371-106578393 TCTGCTGGGGGGTAAAGAGGAGG - Intergenic
937434533 2:121869616-121869638 TCTGCTGTAGGAATACGAGGGGG + Intergenic
938904490 2:135825604-135825626 TCTGCAGGAGGCACACGAGGAGG - Intronic
944306584 2:198186546-198186568 TCAGCTGGAGGTCCACTTGGGGG - Intronic
946155041 2:217801749-217801771 TCTGGTGCAGGGCCCAGAGGTGG + Exonic
948492813 2:238324441-238324463 TGAGCTGAAGGACCACGAGGAGG - Intronic
1168973606 20:1947620-1947642 GCTGATGGAGGGCCTCGAGCTGG + Intergenic
1169124251 20:3115719-3115741 TCTGCAGTTGAGCCACGAGGTGG - Intronic
1171138823 20:22723182-22723204 TCTGCTGGTGGGCCACCAATTGG - Intergenic
1171413265 20:24960475-24960497 TCTGTTGGGGGTGCACGAGGAGG + Intergenic
1172447169 20:34999335-34999357 GCTGCGGCACGGCCACGAGGAGG + Exonic
1175056299 20:56201679-56201701 TCTGCTTGATGGCCACCAGGGGG - Intergenic
1175392170 20:58634414-58634436 TCTGCTGGATGGGCAGGAGCCGG - Intergenic
1175983375 20:62752505-62752527 TCTGCCGCAGGGCCACGTGTGGG - Intronic
1176129074 20:63488608-63488630 TCTGCGGGGCGGCCACGGGGCGG + Intronic
1179658874 21:42862252-42862274 TCTGCTGGAGGGGCAGGAAGGGG + Intronic
1179996487 21:44976737-44976759 TCTGCCCGATGGCCACCAGGGGG - Exonic
1180837233 22:18936014-18936036 GCTGCTGGCGCGCCACGAGCAGG - Exonic
1181064729 22:20300011-20300033 GCTGCTGGCGCGCCACGAGCAGG + Intergenic
1182693709 22:32181700-32181722 TCTGCTGGAGTGACTGGAGGAGG - Intergenic
1185056423 22:48580975-48580997 TCTGCTGGAGGGTCAGGGAGAGG - Intronic
1185418325 22:50721605-50721627 TCTGCCGGGGTGCCACCAGGGGG - Intergenic
1203287326 22_KI270734v1_random:161313-161335 GCTGCTGGCGCGCCACGAGCAGG - Intergenic
950365155 3:12477868-12477890 ACTGCGGGAGGGCCTCGAGGAGG - Intergenic
953879994 3:46686570-46686592 TCTGCTGGTGGGGCAGGGGGTGG + Intronic
954107860 3:48418988-48419010 GGAGCTGGAGGGCCTCGAGGTGG - Exonic
954138136 3:48591700-48591722 TCTGCTGGAGGGCCACGAGGTGG - Exonic
957215735 3:77317675-77317697 GCTGCTGGGGGGCTACTAGGGGG + Intronic
961864580 3:129944486-129944508 TGTGCAGGATGGCCAGGAGGAGG + Intergenic
962974273 3:140432536-140432558 TCTGGCGGAGGGCCTCGTGGGGG + Intronic
968479890 4:828637-828659 TCTGCTGGAGGGCTTCAGGGTGG + Intergenic
969474908 4:7416340-7416362 TGTCCTGGAGGGCAAGGAGGGGG - Intronic
975386933 4:73769048-73769070 TCTGTTGGAGGGGCAAGAGTGGG - Intergenic
982235621 4:153249025-153249047 GTTGCTGGAGGGCCAGGCGGGGG + Intronic
984366252 4:178803656-178803678 TCTGCTGGAGTGCCTGGAAGGGG + Intergenic
985425690 4:189828344-189828366 TCTGCTGCAGAGCCACCAGCTGG + Intergenic
987764582 5:22208644-22208666 TCTCCTGGAAGGCCACATGGTGG + Intronic
991418933 5:66421159-66421181 TCTGCTGGAGGGACAGAGGGAGG + Intergenic
991598666 5:68330793-68330815 TTGGCTGGAGGGCAAGGAGGTGG - Intergenic
991899321 5:71441794-71441816 TCTCCTGGAAGGCCACATGGTGG + Intergenic
994631811 5:102296367-102296389 GAGGCTGGAGGGCCAGGAGGCGG - Exonic
1000765032 5:165277025-165277047 TCTGCTGAAGGGGCAAGATGGGG - Intergenic
1001589046 5:172853116-172853138 TTTGCTGCAGGCCCACAAGGTGG + Intronic
1002123358 5:177022810-177022832 GTTGCTGGAGGGCCAGGAGCCGG + Exonic
1002580964 5:180209221-180209243 GCTGCCTGAGTGCCACGAGGGGG - Intergenic
1004517343 6:16331502-16331524 GCTGCAGGAGGGCCAGCAGGGGG - Intronic
1005873451 6:29994515-29994537 CCTGCTGGAAGGGCAGGAGGGGG - Intergenic
1015275045 6:131375521-131375543 ACTGCTGGAGGGCCAGAAGCTGG - Intergenic
1015525397 6:134171061-134171083 TCTGCAGGAGGCCCTCCAGGAGG + Exonic
1016894797 6:149041314-149041336 TGGGCTGGAGGTCCAAGAGGAGG - Intronic
1016895104 6:149043622-149043644 TCTGACGGAGAGCCACCAGGAGG + Intronic
1018905779 6:168075176-168075198 TCTGCTGGAGGTCAAGGGGGTGG - Intronic
1019399484 7:844126-844148 TCTCCTGCAGGCCCAGGAGGAGG - Intronic
1021206422 7:17786627-17786649 CCTGCTGGAAGGGCAGGAGGGGG + Intergenic
1023940260 7:44764950-44764972 TTTGCTGGAGGGCCTGGAGGTGG + Exonic
1026176545 7:68002727-68002749 TCTGTTGGAGGGCCTAGTGGGGG - Intergenic
1028426230 7:90692634-90692656 TATGCTGGCGGGCCATGATGGGG + Intronic
1032119739 7:129147130-129147152 TCTACTGTAGGGCCAAGAAGGGG - Intronic
1034427025 7:151019314-151019336 TCCGCTGCAGTGCCAAGAGGCGG + Exonic
1034926887 7:155129833-155129855 ACTGCTGGAAGGACAGGAGGTGG + Intergenic
1035743440 8:1945483-1945505 TCAGCTGGAGGCCCACCAGGAGG + Exonic
1037017222 8:13923890-13923912 TCTGCTGAAGGGCAACTTGGTGG + Intergenic
1037326775 8:17699732-17699754 TGTGCTGCACGGCCACCAGGAGG - Intronic
1039567478 8:38561501-38561523 ACTGCTGGAGGGCTTCGAGCAGG - Intergenic
1048256073 8:132906244-132906266 CCTGCAGGAAGGCCACCAGGTGG + Intronic
1048572811 8:135669274-135669296 TCTGCTGCAGGGCCAGGCGGAGG - Intergenic
1049058091 8:140254644-140254666 TAGGCTGGAGGGGCACCAGGAGG - Intronic
1049282955 8:141759796-141759818 GCTGCTGGAGGCCCACGTGTGGG - Intergenic
1049612509 8:143562068-143562090 GCTGCTGGAGGGCCTGGAGGGGG + Exonic
1049807329 8:144546934-144546956 TCAGCTGGGAGTCCACGAGGAGG - Intronic
1053198314 9:36136590-36136612 TCTCCGGGAGGCCCACGGGGTGG + Intronic
1053372790 9:37576462-37576484 TCTGCAGGAGGGGCACCGGGAGG + Intronic
1053688477 9:40567175-40567197 TCTGCTGGAGGATCCCGGGGTGG - Intergenic
1058596633 9:106622287-106622309 CCTGGAGGAGGGCCAAGAGGTGG - Intergenic
1060197407 9:121632577-121632599 TATGCTGGAGGGGCCAGAGGAGG - Intronic
1061432115 9:130537584-130537606 TCTGCCGCAGGGGCAGGAGGAGG - Intergenic
1061838206 9:133342831-133342853 TCTGCTGCAGGGCCGTGAGCAGG + Intronic
1188005422 X:25013247-25013269 ACTGCTGGAGGACGACGAGGAGG - Exonic
1189695148 X:43655384-43655406 TATGCTGGAGCTCCAGGAGGCGG - Intronic
1190126115 X:47707191-47707213 TTTGCAGGAGGGCCAGGAAGGGG + Intergenic
1190491665 X:50988854-50988876 TCAGCTGGATGGCCATTAGGTGG - Intergenic
1193420848 X:81280347-81280369 TATGCTGGTTGGCCAGGAGGTGG - Intronic
1196515586 X:116606582-116606604 CCAGCTGGAGGGCCATGGGGTGG + Intergenic
1200209632 X:154341562-154341584 TCTACTGCGGGGCCACGAGAGGG + Intergenic
1200221244 X:154390566-154390588 TCTACTGCGGGGCCACGAGAGGG - Intronic
1201867877 Y:18673788-18673810 GCTGCTGGAGGGCGAGGACGCGG - Intergenic