ID: 954139033

View in Genome Browser
Species Human (GRCh38)
Location 3:48595524-48595546
Sequence CTGTGACCTTAGATGGAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 296}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954139033_954139040 23 Left 954139033 3:48595524-48595546 CCTAACTCCATCTAAGGTCACAG 0: 1
1: 0
2: 1
3: 20
4: 296
Right 954139040 3:48595570-48595592 ACAGTGACCAGGCTGAGGAGTGG 0: 1
1: 0
2: 2
3: 42
4: 371
954139033_954139038 12 Left 954139033 3:48595524-48595546 CCTAACTCCATCTAAGGTCACAG 0: 1
1: 0
2: 1
3: 20
4: 296
Right 954139038 3:48595559-48595581 TTAGGTCAATCACAGTGACCAGG 0: 1
1: 0
2: 0
3: 10
4: 146
954139033_954139039 18 Left 954139033 3:48595524-48595546 CCTAACTCCATCTAAGGTCACAG 0: 1
1: 0
2: 1
3: 20
4: 296
Right 954139039 3:48595565-48595587 CAATCACAGTGACCAGGCTGAGG 0: 1
1: 0
2: 4
3: 23
4: 243
954139033_954139037 -6 Left 954139033 3:48595524-48595546 CCTAACTCCATCTAAGGTCACAG 0: 1
1: 0
2: 1
3: 20
4: 296
Right 954139037 3:48595541-48595563 TCACAGGTCTTGGCTGCTTTAGG 0: 1
1: 0
2: 0
3: 14
4: 173
954139033_954139041 28 Left 954139033 3:48595524-48595546 CCTAACTCCATCTAAGGTCACAG 0: 1
1: 0
2: 1
3: 20
4: 296
Right 954139041 3:48595575-48595597 GACCAGGCTGAGGAGTGGACAGG 0: 1
1: 1
2: 4
3: 40
4: 359

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954139033 Original CRISPR CTGTGACCTTAGATGGAGTT AGG (reversed) Intergenic
902817267 1:18923406-18923428 CTGTCACCTTGGGTGGATTTGGG - Intronic
902838412 1:19060639-19060661 CTGGGATCTGTGATGGAGTTGGG - Intergenic
904031096 1:27533819-27533841 CTGGGACCTTGGATGGAATAAGG + Intergenic
906568596 1:46817894-46817916 CTCTGACCTTATGTGGAGGTAGG + Intronic
908597472 1:65703882-65703904 CTGTGAACTTCCCTGGAGTTGGG - Intergenic
910303516 1:85734954-85734976 CTATGACATTAGTTGGAGTTTGG - Exonic
910464657 1:87485323-87485345 CTGTCACCTCAGAAGGGGTTTGG + Intergenic
910499642 1:87875313-87875335 CTGTGTCCTTACATGGTGGTAGG + Intergenic
911340782 1:96633858-96633880 CTGTCACCCTAGCTGGAGTGTGG + Intergenic
911513798 1:98842192-98842214 ATGTGACCTTATTTGGAGATAGG - Intergenic
912749204 1:112271661-112271683 CTGTGACCTTATTTGGAAATAGG - Intergenic
913677658 1:121156961-121156983 ATGTGACCTTATTTGGAGATAGG + Intergenic
914029492 1:143944590-143944612 ATGTGACCTTATTTGGAGATAGG + Intronic
914159957 1:145123360-145123382 ATGTGACCTTATTTGGAGATAGG - Intergenic
914239112 1:145839692-145839714 CTGTTACCTAGGATGGAGTGCGG - Intronic
914359431 1:146920035-146920057 CTGTCACCTCAGAAGGGGTTTGG + Intergenic
914494318 1:148179840-148179862 CTGTCACCTCAGAAGGGGTTTGG - Intergenic
915339619 1:155169463-155169485 CTGTGACCTTGGCTGGTGTGAGG + Exonic
916951414 1:169784208-169784230 ATTTGACCTCAGTTGGAGTTTGG - Intronic
920464964 1:206175471-206175493 ATGTGACCTTATTTGGAGATAGG + Intergenic
921153225 1:212418114-212418136 ATGTGACCTTAGATGGAAATAGG + Intergenic
921253560 1:213319274-213319296 CTGTCACCTAAGCTGGAGTGAGG - Intergenic
921316225 1:213893819-213893841 CTGTCACCTAAGCTGGAGTGCGG - Intergenic
922931070 1:229390128-229390150 GTGTGACCTTATTAGGAGTTAGG + Intergenic
923129476 1:231062964-231062986 ACGTGACCTTATTTGGAGTTAGG + Intergenic
924217659 1:241840639-241840661 ATGTGACCTTATTTGGAGATAGG - Intergenic
1063026174 10:2180916-2180938 CTGTGACCTTGGCTGTATTTTGG - Intergenic
1063506157 10:6601597-6601619 CTGTGAACACAGATGAAGTTTGG + Intergenic
1064183962 10:13144099-13144121 CTGTCACCTGAGAGGGAGTGGGG + Intergenic
1065138389 10:22695775-22695797 CTGTGACCATACATTGTGTTAGG - Intronic
1066349868 10:34627407-34627429 ATGTGACCTTACTTGGAGATCGG + Intronic
1066396897 10:35034435-35034457 CTGTTACCTTAGCTGCAGATTGG - Intronic
1066745780 10:38603622-38603644 GTGTGACCTTATTTGGAGATAGG - Intergenic
1069326659 10:67239250-67239272 CTGTGTCTTTAGATGGACATAGG - Intronic
1069980106 10:72246577-72246599 ATGTGACCTTATTTGGAGATGGG - Intergenic
1070373453 10:75807120-75807142 TTGTGACTTTAGCTGGAGGTCGG + Intronic
1071231447 10:83591339-83591361 CTGTCCCCTTAGAATGAGTTGGG + Intergenic
1071670571 10:87605812-87605834 CTGTGAGCTGAGAAGTAGTTAGG + Intergenic
1074501899 10:114033177-114033199 ATGTGACCTCAGTTGGAGATTGG + Intergenic
1074899919 10:117807122-117807144 CTGTGACCTTATTTGGAGATAGG - Intergenic
1074993347 10:118732182-118732204 CTGTGAGCTGATATGGGGTTGGG + Intronic
1075618874 10:123911100-123911122 ATGTGACCTTATATGGAAATAGG - Intronic
1075637182 10:124037199-124037221 CTGTGACCTTATTTGGAAATAGG - Intronic
1076305994 10:129466382-129466404 ATGTGACCTTATTTGGAGATGGG - Intergenic
1081562458 11:44230315-44230337 CTGTGACATGTGAAGGAGTTCGG + Intronic
1081796507 11:45824148-45824170 CTGGGAGCGTAGATGGAGTGTGG + Intergenic
1082114191 11:48309941-48309963 CTGAGAACTTGGATGGAGGTGGG - Intergenic
1082275331 11:50215133-50215155 ATGTGACCTTAGAATGAGTCAGG - Intergenic
1082868229 11:57919192-57919214 CTGTGACCTTATTTGGAAGTAGG + Intergenic
1083699951 11:64469618-64469640 ATGTGACCTTATTTGGGGTTAGG + Intergenic
1084176743 11:67426333-67426355 CTGTGACTTTAGATTGGGTATGG - Intergenic
1084468655 11:69342409-69342431 ATGTGACCTTATATGCAGATAGG + Intronic
1084469029 11:69344404-69344426 GTGTGACCTTATATGGAGATAGG + Intronic
1085711303 11:78831319-78831341 CTGGGGCCATAGAGGGAGTTAGG - Intronic
1085795954 11:79540079-79540101 ATGTGACCTTATCTGGAATTAGG + Intergenic
1086435460 11:86775650-86775672 ATGTGTCCTTCCATGGAGTTGGG - Intergenic
1088224129 11:107600727-107600749 CTTTGACATTAGATGAAGATGGG - Intronic
1088666327 11:112097440-112097462 CTGTCACCTAAGCTGGAGTGCGG - Intronic
1088853397 11:113724214-113724236 GTGTGACCTTATTTGGAGGTAGG + Intergenic
1089458810 11:118641027-118641049 CTGTGGCCTGGCATGGAGTTTGG + Intronic
1090117596 11:123990330-123990352 CTATGAAGTTAGATGGACTTGGG + Intergenic
1090906693 11:131082916-131082938 CTATGCCCTTAACTGGAGTTTGG + Intergenic
1091242794 11:134065329-134065351 CTGTTTCCTTAGAGGGAGGTGGG + Intergenic
1093071634 12:14711667-14711689 CTGTGACCCTTGCTGGATTTTGG + Intergenic
1093904701 12:24676811-24676833 CTGTGTCCTTACATGGAGAAAGG + Intergenic
1094089798 12:26636023-26636045 CTGTGATCTTACTTGGAATTGGG - Intronic
1094750956 12:33407640-33407662 CTGTCACCCTAGCTGGAGTACGG + Intronic
1098132456 12:67364675-67364697 CTGTCTCTTTAGATGAAGTTAGG - Intergenic
1098188430 12:67923134-67923156 ATGTGACCTTATCTGGAGATAGG + Intergenic
1099441716 12:82707226-82707248 CTGTGTCCTTACATGGAGGTCGG + Intronic
1100218563 12:92479382-92479404 ATGTGACCTTATGTGGAGATAGG - Intergenic
1100581024 12:95940636-95940658 CTGTGTCCTTGGATGGTGTGGGG + Intronic
1100607438 12:96163222-96163244 CTGTGCCCTTTGAAGCAGTTGGG - Intergenic
1102594910 12:113984890-113984912 GTGTGACCTTAGTTGGAAATAGG + Intergenic
1105585770 13:21741457-21741479 ATGTGACCTTATTTGGAGATAGG + Intergenic
1105641384 13:22268600-22268622 GTGTGACCTTACTTGGAATTAGG - Intergenic
1105713037 13:23031680-23031702 ATGTGACCTTATTTGGAGATAGG + Intergenic
1105760740 13:23512131-23512153 CTGTGACCTGGGATTGATTTAGG - Intergenic
1106265821 13:28108776-28108798 ATGTGACCTTATTTGGAGATAGG - Intergenic
1106997631 13:35506097-35506119 CTGTCACCTGAGCTGGAGTGTGG + Intronic
1107799376 13:44089953-44089975 ATGTGACCTTATTTGGAGATAGG - Intergenic
1109044669 13:57394090-57394112 CAGTGTCCTTAGATAGTGTTTGG + Intergenic
1111812687 13:93111204-93111226 TTGTGACTTTTGATGAAGTTAGG - Intergenic
1112449257 13:99494215-99494237 CTCTGACCTTAGATGGGGGCTGG + Intergenic
1112967740 13:105218757-105218779 ATGTGACCTTATTTGGAATTAGG - Intergenic
1113090621 13:106614188-106614210 ATGTGACCGTATTTGGAGTTGGG + Intergenic
1113501300 13:110777004-110777026 ATGTGCCCTTATTTGGAGTTTGG + Intergenic
1113507212 13:110825619-110825641 CTGTGGCCATGGGTGGAGTTGGG - Intergenic
1114367798 14:22048579-22048601 ATGTGACCTTATTTGGAGTTGGG - Intergenic
1114856191 14:26447550-26447572 CAGTGACCTAAAATGGAGTGAGG - Exonic
1115044286 14:28971842-28971864 CTGTGGCATTAAATGGAGTAGGG - Intergenic
1117376794 14:55124838-55124860 CTCTCACCTTAAGTGGAGTTGGG - Intronic
1117644195 14:57834083-57834105 CTCTCATCTTAGGTGGAGTTTGG - Intronic
1117953432 14:61104641-61104663 ATGTGACCTTAAGTGGAGATAGG - Intergenic
1117965900 14:61206490-61206512 ATGTGACCTTATTTGGAGATAGG - Intronic
1118878451 14:69805023-69805045 CTGTGCCCTTAGATGGTGGAGGG - Intergenic
1120179273 14:81326862-81326884 TTGGGACCTTAGATTGATTTGGG + Intronic
1121020219 14:90575435-90575457 CTGTGCCCTTCGATGGAGGAAGG - Intronic
1121857789 14:97286150-97286172 GTGTGACCTTATTTGGATTTAGG + Intergenic
1121945983 14:98122485-98122507 CTGTGACCATATTTGGAGATAGG + Intergenic
1124176240 15:27426784-27426806 CTGTGACCCAGGATGGAGTGAGG - Intronic
1127287351 15:57543374-57543396 CCGTGACCTTATTTGGAGATGGG - Intronic
1127607161 15:60597975-60597997 CTTTGGCATTAGATGAAGTTGGG + Intronic
1128598165 15:68972756-68972778 ATGTGACCTTATTTGGAGATAGG - Intronic
1128749867 15:70141148-70141170 CAGTGACCTTAGAGGGAGAGGGG - Intergenic
1129221073 15:74131860-74131882 CTTTGGCCTTAGATGCAGTAGGG + Intronic
1130416150 15:83696429-83696451 CAGTGACCTTACATGGTGTCTGG + Intronic
1134332253 16:13261753-13261775 CTGTGACCTGAAATGGATATGGG + Intergenic
1134598674 16:15516086-15516108 CTGTCACCCAAGATGGAGTGTGG - Intronic
1136055411 16:27684883-27684905 CTGTGACCTTATTTGGAAATAGG - Intronic
1137247076 16:46714554-46714576 CTCTTCCCTTAGTTGGAGTTCGG - Intronic
1137266118 16:46870372-46870394 CTGTCACCCAAGCTGGAGTTCGG - Intergenic
1137721989 16:50632910-50632932 CAGTGACCTTAGATAGTTTTCGG + Intronic
1138732456 16:59209841-59209863 ATGTGACCTTATTTGGAGATAGG + Intergenic
1139062009 16:63263861-63263883 CTGAGACCTCAGGTGGGGTTGGG + Intergenic
1139332813 16:66207002-66207024 TAGTGACCTTATTTGGAGTTAGG - Intergenic
1139823479 16:69739073-69739095 CTGTCACCTAGGCTGGAGTTTGG + Intergenic
1139923965 16:70475569-70475591 CTCTGCCCTTAGACGGAGTCAGG + Intronic
1140614983 16:76651251-76651273 CTGTGACCTTATTTGGAAATTGG + Intergenic
1141065145 16:80908233-80908255 CTGTCACCTAGGATGGAGTGTGG - Intergenic
1142852754 17:2712017-2712039 CTGTGACCTTGGGTGGAGACTGG + Exonic
1145213509 17:21034190-21034212 CTGTACCCTTAGATTGATTTTGG - Intronic
1147157663 17:38552346-38552368 CAGTGACCTTTGGGGGAGTTGGG + Intronic
1147511695 17:41075089-41075111 CTGTCACCTAAGCTGGAGTGTGG + Intergenic
1150710974 17:67530552-67530574 ATGTGACCTTATTTGGAGATAGG - Intronic
1151834774 17:76575357-76575379 ATGTGACCTTAGTTGGAACTAGG + Intronic
1151883912 17:76912165-76912187 CTATGACCTTATTTGGAGTTGGG - Intronic
1152292529 17:79448334-79448356 CTGTGACCTTATCTGGAATGAGG + Intronic
1153232879 18:2956825-2956847 GTGTGACTTTAAATGGAGTTTGG + Intronic
1157243484 18:46033299-46033321 CTGTGACCTTATTTGGAAATAGG + Intronic
1157512871 18:48291047-48291069 GTGGTACCTAAGATGGAGTTGGG - Intronic
1158033767 18:52999832-52999854 CTGTGACCTTAGTTGAAAATAGG + Intronic
1158062369 18:53360967-53360989 CTGTGACCTTAGATGGAAAAGGG + Intronic
1159880494 18:73854332-73854354 ATGTGACCTTATTTGGAGATAGG + Intergenic
1159918072 18:74203573-74203595 ATGTGACCTTATTTGGAGATAGG - Intergenic
1159957968 18:74533180-74533202 ATGTGACCTTCTATGGAGATAGG + Intergenic
1160013278 18:75122797-75122819 ATGTGACCTTATTTGGAGATAGG - Intergenic
1160186291 18:76679033-76679055 CTGTGACCTTATTTGGAATAGGG + Intergenic
1161436687 19:4267764-4267786 CTGTGACCTTACCTGGGGTGGGG - Exonic
1161732734 19:5971822-5971844 CTGTGACCTTGGTTGGTATTTGG - Intronic
1163585190 19:18160141-18160163 CTGTGACCTTATTTGGAAATAGG - Intronic
1164596303 19:29532675-29532697 CTCTGACCTCAGAGGGAGCTTGG + Intronic
1165353369 19:35289447-35289469 ATGTGACCTTAGTTGGAGGCAGG + Intergenic
1166483639 19:43194708-43194730 CAGTGAACATAGAGGGAGTTTGG - Intronic
1167572498 19:50297894-50297916 ATGTGACCTTAGTTGGAAATAGG - Intronic
1168032703 19:53693672-53693694 CTGTCACCCAAGATGGAGTGTGG + Intergenic
1168304386 19:55427423-55427445 CTGTGACCTTATTTGGAGAGAGG + Intergenic
1168546187 19:57252252-57252274 CTGTGTCCTTATCTTGAGTTTGG - Intronic
925551030 2:5074663-5074685 CTGTGTCAGTAGATGGAGGTTGG - Intergenic
925827083 2:7859820-7859842 CTGTGACCATTGATGTAGTTTGG - Intergenic
925966577 2:9072258-9072280 CTGTGACCTTATTTGGAGATAGG + Intergenic
927028872 2:19099844-19099866 ATGTGACCTTATTTGGAGATAGG + Intergenic
927695129 2:25234655-25234677 CTGTGACCTTAAAGGTAGTAAGG + Intronic
927943471 2:27120306-27120328 CTGTGACCTTATTTGGAAATAGG + Intergenic
930850205 2:55952014-55952036 CTGTCACCTTATTTGGAATTGGG + Intergenic
932463120 2:71896094-71896116 CTGGTACCTTAGAAGGAGCTGGG - Intergenic
932563048 2:72888840-72888862 CTGAGGTATTAGATGGAGTTTGG + Intronic
934049495 2:88198483-88198505 CTGTGACCTTATTTGGAAATAGG + Intergenic
935331697 2:101982044-101982066 ATGTGACCTTAGTTGGAGATGGG - Intergenic
936151933 2:110026736-110026758 CTGAGACCTGAGACTGAGTTTGG + Intergenic
936192744 2:110344677-110344699 CTGAGACCTGAGACTGAGTTTGG - Intergenic
939069402 2:137521006-137521028 CTCTGACCTGAGGTGGGGTTGGG + Intronic
939259102 2:139783947-139783969 TTTTATCCTTAGATGGAGTTGGG + Intergenic
940603195 2:155886491-155886513 CTGTGACCTGTCATGGGGTTGGG + Intergenic
940722104 2:157293322-157293344 CTGTGACCTTACATGGTGGAAGG + Intronic
941874078 2:170415972-170415994 ATGTGACCTTATTTGGAATTAGG + Intronic
943055592 2:182974409-182974431 ATGTGACCTTATTTGGAATTAGG + Intronic
943562051 2:189475815-189475837 ATGTGACCTGAGCTGGAGTGAGG + Intergenic
943887907 2:193246373-193246395 ATGTGACCTTATTTGGAGATAGG - Intergenic
944150151 2:196548975-196548997 ATGTGACCTTAACTGGAGATAGG - Intronic
944388937 2:199197239-199197261 ATGTGACCTTATTTGGAGATAGG + Intergenic
945029453 2:205649884-205649906 TTGTGACCTTAGATGAGGTTTGG - Intergenic
946220412 2:218221104-218221126 CTGTCAACTTAGCTGGAGTCTGG + Intronic
946528382 2:220544290-220544312 ATGTGACCTTACATGGAAATGGG - Intergenic
946890380 2:224269641-224269663 GTGTGACCTTATTTGGAGATAGG + Intergenic
947158561 2:227188502-227188524 CTGTTACGTGAGATGGAGTGGGG - Intronic
947348840 2:229221641-229221663 CTGTGGCCGTAGATGAAATTGGG - Intronic
948317678 2:237041469-237041491 CAGTGACCTTAGTTGGAAATCGG - Intergenic
1169249836 20:4051922-4051944 CTGGGAGCATAGGTGGAGTTTGG + Intergenic
1171227208 20:23451739-23451761 CTGTGGCTTTAGAATGAGTTGGG - Intronic
1172669427 20:36624680-36624702 CTGTGAGCACAGATGGTGTTGGG + Intronic
1173634684 20:44544970-44544992 CTGTGGCCTGAGCTGGAGTACGG + Intronic
1173747600 20:45449782-45449804 ATGTGACCTTATTTGGAGATGGG - Intergenic
1174055122 20:47793372-47793394 ATGTGACCTTATGTGGAATTGGG + Intergenic
1175565720 20:59975162-59975184 CTGTGACCTTATTTGGATATAGG + Intronic
1176964935 21:15201946-15201968 ATGTGACCTTATTTGGAGATAGG - Intergenic
1177746621 21:25222496-25222518 CTGGGACCTCAGCTGGGGTTGGG + Intergenic
1178110188 21:29362652-29362674 ATGTGACCTTATTTGGAGATAGG + Intronic
1178492606 21:33062582-33062604 CTGTGACCTTACTTGGAGATAGG - Intergenic
1179436407 21:41365092-41365114 ATGTGACCTTAGTTGGAAATAGG + Intronic
1179489313 21:41729941-41729963 CTGTGACCTTAGTGGGTGGTGGG - Intergenic
1179513703 21:41892036-41892058 ATGTGACCTTATTTGGAGATGGG + Intronic
1181409957 22:22711842-22711864 ATGTGACTTTAAATGGATTTAGG + Intergenic
1182112018 22:27730831-27730853 CTGTGAGCTCAGATGTGGTTGGG - Intergenic
1184978397 22:48079335-48079357 ATGTGACCTTATTTGGAGATAGG + Intergenic
950436237 3:12982005-12982027 GTGTGACCTGAGCTGGATTTGGG + Intronic
952741157 3:36736356-36736378 ATGTGACCTTATATGTGGTTTGG + Intronic
954139033 3:48595524-48595546 CTGTGACCTTAGATGGAGTTAGG - Intergenic
954867085 3:53738907-53738929 CTGTGACCTAGGAAGGAGTAAGG + Intronic
956621374 3:71224338-71224360 ATGTGATCGTAGATGGAGTTGGG + Intronic
956749477 3:72334789-72334811 ATGTGACCTTATTTGGAGATAGG + Intergenic
957711067 3:83860096-83860118 CAGTGACCTGAGATGTATTTAGG + Intergenic
959581086 3:107983341-107983363 CTGGGACCAAAGATGGAATTAGG - Intergenic
959697152 3:109260762-109260784 CTGTCCCCTTAGGTGGAGGTAGG + Intergenic
959912364 3:111778169-111778191 ATGTGACCTTATTTGGAGGTAGG + Intronic
961146475 3:124598199-124598221 CTGTGATTTCAGATGGACTTGGG - Intronic
962826098 3:139102011-139102033 CTGTGTCCTAAGGTGGAGTGGGG + Intronic
962864880 3:139440098-139440120 CTGTCATCTGAGATGGAGTGGGG + Intergenic
963723456 3:148891441-148891463 CTGTTACCTTGGCTGGAGTGCGG - Intronic
963830816 3:150007036-150007058 CTTTGACATTAGATGGTCTTGGG + Intronic
964088757 3:152848717-152848739 GTCTGTCCTTAGATGGAGTCAGG + Intergenic
965308723 3:167101320-167101342 TTGTGACAATAGATTGAGTTTGG - Intergenic
967295356 3:187958897-187958919 CTGTGGCCTTTGATGGAGCCAGG + Intergenic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
970328804 4:14957345-14957367 ATGTGACCTTATGTGGAGTAGGG + Intergenic
971354334 4:25881117-25881139 CTGTTACCTTGGAAGGACTTAGG + Intronic
972392765 4:38628387-38628409 CTCTGAGCTAAGATGCAGTTGGG + Intergenic
972426432 4:38937539-38937561 CTGTGACCTTATTTGGAGATAGG - Intronic
973935347 4:55840849-55840871 ATGTGACCTTAATTGGAGATAGG - Intergenic
976695986 4:87920197-87920219 ATGTGACCTTATTTGGAGATAGG - Intergenic
977087806 4:92626508-92626530 CCTTGACTTTAGATGGAGTGTGG + Intronic
977441796 4:97077115-97077137 CTGAGATGTTAGTTGGAGTTTGG - Intergenic
978827973 4:113047616-113047638 CTGTGACCACAGTGGGAGTTGGG + Intronic
979694037 4:123591242-123591264 CTGTGATCTTTGGTGGAGTTGGG + Intergenic
982323709 4:154107889-154107911 ATGTGACCTTATTTGGAGATAGG + Intergenic
984049243 4:174843319-174843341 ATGTGACCTTATTTGGAGATAGG + Intronic
985621663 5:959314-959336 GTGTGAGCTCAGATGGACTTGGG - Intergenic
986339854 5:6779579-6779601 CTGTGACCTTATTTGGAAATGGG + Intergenic
988309959 5:29543951-29543973 CTGTGACCTAAGCTTGAGTGTGG - Intergenic
990417698 5:55601782-55601804 ATGTGACCTTATCTGGAGATAGG + Intergenic
990620461 5:57553714-57553736 ATGTGACCTTATTTGGAGATAGG + Intergenic
992263339 5:74992530-74992552 CTGTGACCTTATTTGGAAATAGG - Intergenic
992887395 5:81172097-81172119 CTGTGACCTTAGGTGGATGTTGG + Intronic
993592390 5:89810014-89810036 CTGTGACCCTGGATGGGGGTGGG + Intergenic
993733475 5:91448843-91448865 ATGTGACCTTATTTGGAGCTAGG + Intergenic
997288690 5:132706745-132706767 CTGTGACCTTTGCAGGACTTGGG - Intronic
997799441 5:136844993-136845015 CTGTGAACTTATTTGGATTTAGG + Intergenic
1000940654 5:167356122-167356144 CAGTGAGCTGAGATGGAGATGGG + Intronic
1001668757 5:173456118-173456140 ATGTGACCTTATTTGGAGATAGG + Intergenic
1002059449 5:176617807-176617829 CTCTGTCCTTAGATGGAGGAGGG - Intergenic
1002140143 5:177133244-177133266 CTGTAACCTAAGATGGAGGCCGG + Intronic
1003144448 6:3498173-3498195 CTGTGACCTTACATGCAGAAGGG - Intergenic
1003954190 6:11146861-11146883 CTGTGACCTTATTTGGAAATGGG + Intergenic
1004010054 6:11676012-11676034 ATGTGACCTTATTTGGAGATAGG - Intergenic
1004061917 6:12206020-12206042 ATGTGACCTTATATGGAGACAGG + Intergenic
1004324159 6:14658787-14658809 ATGTGACCTTATTTGGAGATAGG - Intergenic
1005531939 6:26716440-26716462 CTGTGTCCTTATATGCATTTGGG - Intergenic
1005538856 6:26785225-26785247 CTGTGTCCTTATATGCATTTGGG + Intergenic
1007122366 6:39393713-39393735 CTGTGACCCTGGATGTGGTTGGG + Intronic
1008762230 6:54865453-54865475 ATGTGACCTTACATGGAAATAGG - Intronic
1009009703 6:57827452-57827474 CTGTGTCCTTATATGCATTTGGG + Intergenic
1011476957 6:87757641-87757663 CTGTCACCTGAGCTGGAGTGTGG + Intergenic
1011841067 6:91499559-91499581 CTGTGTCCTCATATGGAGTGGGG + Intergenic
1013640159 6:112067389-112067411 CAGTGACCTTACATGGAAATGGG + Intronic
1015579878 6:134712815-134712837 CTGTGGAGTTAGATGGCGTTTGG - Intergenic
1017339316 6:153302200-153302222 CTGTGGGATGAGATGGAGTTTGG - Intergenic
1018663511 6:166112439-166112461 ATGGGACCTTAGATGGATTCAGG - Intergenic
1018741974 6:166736525-166736547 TTGTGACCTTCCATTGAGTTTGG - Intronic
1020055554 7:5115593-5115615 CTGTTACCTAAGTTGGAGTGTGG - Intergenic
1021614675 7:22489470-22489492 CTGTGACCTTACTGGGAGATAGG + Intronic
1022580962 7:31553664-31553686 CTGTGAAGTTAGAAGGAATTGGG - Intronic
1025873037 7:65452800-65452822 CTGTTACCTAGGATGGAGTGCGG - Intergenic
1026027239 7:66755551-66755573 CTGTTACCTTAGGTGGAGTTAGG + Intronic
1026732848 7:72926089-72926111 CTCTGGCCTTAGATGGAATAAGG + Intronic
1027673846 7:81134693-81134715 CTGTGACTGTATTTGGAGTTAGG - Intergenic
1029178630 7:98683470-98683492 CTGTGTCCTTACATGGAGGAGGG - Intergenic
1030568727 7:111194015-111194037 CTGTGACTTTATAAGTAGTTTGG - Intronic
1031482671 7:122298184-122298206 CTGAGACCTTATATTTAGTTCGG - Intergenic
1031764621 7:125762733-125762755 CTGTGACCTTTGATATGGTTTGG + Intergenic
1032672608 7:134099102-134099124 ATGTGACCTTATTTGGAATTAGG + Intergenic
1032746600 7:134792676-134792698 ATGTGACCTTATTTGGAGATAGG - Intronic
1033943334 7:146682462-146682484 CTGTGAACTAACATGAAGTTTGG - Intronic
1037154618 8:15684707-15684729 CTGTGGCCTTAGCTTGAGTGGGG - Intronic
1038501958 8:28052381-28052403 ATGTGACCTTATATGGAAATTGG + Intronic
1038731996 8:30136185-30136207 ATGTGACTGTATATGGAGTTAGG + Intronic
1038741319 8:30219480-30219502 CTGTGGCCTTAGAGGGACCTGGG + Intergenic
1039616369 8:38957880-38957902 CTATGACTTTAGAAGGAGTTGGG - Intronic
1040600686 8:48880837-48880859 CTGTGACCTTATTTGGAAGTAGG - Intergenic
1041567098 8:59291106-59291128 CTGTGACCTCAGGTAGAGATTGG + Intergenic
1042115069 8:65422440-65422462 CTGTGACCTTATATGGAAATAGG + Intergenic
1042154431 8:65827062-65827084 ATGTGACCTTATTTGGAGTAAGG - Intronic
1042514402 8:69644478-69644500 CTGTGACTGATGATGGAGTTTGG - Intronic
1043185674 8:77145803-77145825 ATGTGACTTTATTTGGAGTTAGG + Intergenic
1043458973 8:80440232-80440254 CTATGACCTGAGATCGAGCTGGG + Intergenic
1043665725 8:82810326-82810348 ATGTGACCTTATTTGGAGATAGG + Intergenic
1043950183 8:86300070-86300092 ATGTGACCATATTTGGAGTTGGG + Intronic
1045804285 8:106139041-106139063 ATGTGACCTTATTTGGAGCTGGG - Intergenic
1047494105 8:125397484-125397506 CTGTGACCTTATATGGACAAAGG - Intergenic
1047600236 8:126418873-126418895 CTGTGACCTTATTTGGAAATAGG + Intergenic
1048190110 8:132280622-132280644 CTGTGACCACTGATAGAGTTTGG - Intronic
1048457524 8:134591583-134591605 ATGTGACCTTATTTGGAGATAGG + Intronic
1048549443 8:135420915-135420937 CTATGACATTCAATGGAGTTGGG + Intergenic
1050128322 9:2382788-2382810 ATGTGACCTTATGTGGAGGTAGG - Intergenic
1051234879 9:14989496-14989518 CTGTGACCTTATTTGGAAATAGG + Intergenic
1051337515 9:16079320-16079342 ATGTGACCTTATTTGGAGCTAGG + Intergenic
1051784685 9:20729490-20729512 ATGTGACCTTATATGGAAATAGG - Intronic
1051821619 9:21177171-21177193 CAGTGACCTTAGGTGGATCTAGG - Intergenic
1052679303 9:31668366-31668388 CTGGTACCTTAAATGGTGTTAGG - Intergenic
1053363115 9:37503539-37503561 CTGTGACCCAGGATGGAGTGTGG - Exonic
1055362896 9:75513233-75513255 ATGTGACCTTATGTGGAGATAGG - Intergenic
1055959138 9:81803441-81803463 CTCTGCCTTTAAATGGAGTTTGG + Intergenic
1061709270 9:132476546-132476568 CTGTGACCTTACTTGGAAATAGG + Intronic
1186229562 X:7438789-7438811 ATGTGACCTTATTTGGAGATAGG + Intergenic
1186650230 X:11551598-11551620 ATGTGACCTTATGTGGAGATAGG + Intronic
1187049046 X:15678021-15678043 ATGTGACCTCATATGGAGATTGG + Intergenic
1187377480 X:18768430-18768452 CTGTGCCCTTAGTTGGCTTTGGG - Intronic
1187892005 X:23945252-23945274 ATGTGACCTTATTTGGAGATAGG + Intergenic
1188675008 X:32928763-32928785 CTGTTAACTTACATGGGGTTGGG + Intronic
1189249254 X:39587405-39587427 CTGTGACCTTATTTGGAAGTAGG - Intergenic
1189539633 X:41972382-41972404 ATGTGACCTTACTTGGAATTAGG - Intergenic
1194345329 X:92756533-92756555 CTGTCACCTAGGCTGGAGTTCGG - Intergenic
1195209541 X:102639972-102639994 ATGTGACCTTATTTGGAGATAGG + Intergenic
1195705004 X:107732250-107732272 CTGAGTCCTTGGAGGGAGTTTGG - Intronic
1198420491 X:136466734-136466756 CTATGACCTGAGAGGGAGATTGG - Intergenic
1199473995 X:148226137-148226159 CTGGTTCCTCAGATGGAGTTAGG + Intergenic
1200653672 Y:5873183-5873205 CTGTCACCTAGGCTGGAGTTCGG - Intergenic
1200756107 Y:6991492-6991514 CTGTGAGCTTATTTGGAGGTGGG + Intronic
1201631770 Y:16077754-16077776 CTGTCACCTTAACTGCAGTTGGG - Intergenic