ID: 954139607

View in Genome Browser
Species Human (GRCh38)
Location 3:48598144-48598166
Sequence GCTGCCTGGCAGTCACAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 1, 2: 2, 3: 23, 4: 209}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954139607_954139617 26 Left 954139607 3:48598144-48598166 CCTGCTTGTGACTGCCAGGCAGC 0: 1
1: 1
2: 2
3: 23
4: 209
Right 954139617 3:48598193-48598215 CTCGCTTTCAACTTCCCCCTGGG 0: 1
1: 0
2: 1
3: 3
4: 87
954139607_954139611 0 Left 954139607 3:48598144-48598166 CCTGCTTGTGACTGCCAGGCAGC 0: 1
1: 1
2: 2
3: 23
4: 209
Right 954139611 3:48598167-48598189 GACTTCCTCAAAGGAAAATTGGG 0: 1
1: 0
2: 5
3: 38
4: 254
954139607_954139616 25 Left 954139607 3:48598144-48598166 CCTGCTTGTGACTGCCAGGCAGC 0: 1
1: 1
2: 2
3: 23
4: 209
Right 954139616 3:48598192-48598214 CCTCGCTTTCAACTTCCCCCTGG 0: 1
1: 0
2: 1
3: 6
4: 109
954139607_954139609 -9 Left 954139607 3:48598144-48598166 CCTGCTTGTGACTGCCAGGCAGC 0: 1
1: 1
2: 2
3: 23
4: 209
Right 954139609 3:48598158-48598180 CCAGGCAGCGACTTCCTCAAAGG 0: 1
1: 0
2: 1
3: 9
4: 121
954139607_954139610 -1 Left 954139607 3:48598144-48598166 CCTGCTTGTGACTGCCAGGCAGC 0: 1
1: 1
2: 2
3: 23
4: 209
Right 954139610 3:48598166-48598188 CGACTTCCTCAAAGGAAAATTGG 0: 1
1: 0
2: 0
3: 28
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954139607 Original CRISPR GCTGCCTGGCAGTCACAAGC AGG (reversed) Intergenic
900237026 1:1597833-1597855 GCTGCCTTGCAGTTCCTAGCAGG - Intergenic
900883407 1:5398660-5398682 GCTGCCTCTCATTCACAAGCTGG - Intergenic
901536548 1:9886146-9886168 GCTGCCCGTCAGTCCCCAGCTGG + Intronic
902110863 1:14077100-14077122 CCTTCCTGGCAATCACAAGGTGG - Intergenic
903319688 1:22535221-22535243 CCTGCCTGGCTGTCTCAGGCAGG - Intergenic
903586005 1:24415722-24415744 ACTGCCTGCCAGTCAGAAGTTGG - Intronic
905463486 1:38136287-38136309 GCAGCCTGGCCGTCACCCGCCGG - Intergenic
906032199 1:42730601-42730623 GCTGCTCGGAAGTCTCAAGCAGG - Intergenic
906616334 1:47235321-47235343 GCTGCCTGACTGTCAGAATCTGG - Intergenic
906991479 1:50743957-50743979 GCTACCTGGGAGGCAGAAGCAGG + Intronic
907542841 1:55232282-55232304 GATACCAAGCAGTCACAAGCAGG + Intergenic
909691234 1:78409853-78409875 GCTGGCTGGAAAACACAAGCAGG - Intronic
914376945 1:147080209-147080231 GCTGGCGGGCAGACACTAGCAGG + Intergenic
916499463 1:165374531-165374553 TCTGGCTGTCAGTCACCAGCAGG + Intergenic
916882081 1:169028737-169028759 GCTGCTTGGGAGGCAGAAGCAGG + Intergenic
917282547 1:173392478-173392500 GCTGCCTGGCATTCACCAACTGG + Intergenic
917725891 1:177826676-177826698 TCTGCCTCCCAGTGACAAGCAGG - Intergenic
918296155 1:183159409-183159431 GCTGCCTGGGAGACTGAAGCAGG - Intergenic
918642257 1:186857043-186857065 GCTGCATGGCAGACACATGTGGG - Intronic
919639044 1:200031688-200031710 GCTGCCTGGGAGGCTGAAGCAGG - Intronic
921896482 1:220406711-220406733 CCTACCTGGCAGTAACAAGGTGG + Intergenic
924772579 1:247089884-247089906 GCAGTCTGGCAGCCACGAGCAGG - Intergenic
1062859875 10:803045-803067 TCTGCCTGGCACTCACCGGCCGG + Intergenic
1066074344 10:31858090-31858112 GCTACCTGGGAGTCTGAAGCAGG + Intronic
1067542450 10:47165831-47165853 GCAGCCTGGCAGTGACCATCAGG - Intergenic
1068780022 10:60909577-60909599 ACTGCCCAGCAGTTACAAGCAGG + Intronic
1070792311 10:79196725-79196747 GTTGCCTGGAAGCCCCAAGCAGG - Intronic
1073067274 10:100770134-100770156 GAGGCCAGGCAGTCACTAGCGGG + Intronic
1074541780 10:114371130-114371152 GCTGGCTGGCAGGGCCAAGCTGG + Intronic
1075557602 10:123444732-123444754 GGTGCCTGGCAGGCACACTCAGG - Intergenic
1078135718 11:8650022-8650044 GCTGTCTGGGAGTAACATGCCGG + Intronic
1078246812 11:9580937-9580959 GCTGCTTGGGAGTCTGAAGCAGG + Intronic
1079967670 11:26998483-26998505 AATGTCTGGCAGTCAGAAGCTGG + Intergenic
1080640630 11:34156306-34156328 ACAGCCTGGCAGTCCCTAGCAGG + Intronic
1080673303 11:34401083-34401105 GCTACCTGGGAGCCAGAAGCAGG + Intergenic
1082193519 11:49274414-49274436 GGTGCTTGGCAGTCTCATGCAGG + Intergenic
1082961243 11:58920622-58920644 GCTTCCTGGCACTGACAAGATGG + Intronic
1083610380 11:64001399-64001421 GCTGCCTGGTGCTCACAGGCGGG + Intronic
1083644827 11:64166079-64166101 GCTGGCTGGCAGTCGCCACCCGG - Intronic
1084494721 11:69497286-69497308 GCTGCCTGAGAGTCCCAGGCCGG + Intergenic
1084914639 11:72419394-72419416 GATGCCTGGCACATACAAGCAGG + Intronic
1086647864 11:89246852-89246874 TCAGCCTTGCAGTCACCAGCAGG - Intronic
1086672619 11:89566774-89566796 GGTGCTTGGCAGTCTCATGCAGG - Intergenic
1088465604 11:110134372-110134394 GCTGCTTGGCAACCAGAAGCTGG - Intronic
1088795722 11:113265390-113265412 GCTGCCTTGGAGTCCCCAGCAGG + Intronic
1088851690 11:113708508-113708530 GCAGCCTGGCAGCTACAAGAAGG + Intergenic
1091878851 12:3960277-3960299 TCTTCCTGCCAGCCACAAGCAGG + Intergenic
1096411636 12:51381126-51381148 GCTGCCTGGGAGGCTGAAGCAGG + Intronic
1096657787 12:53102452-53102474 TCTGCCTGGCTGTCACAGGAAGG - Intergenic
1096921768 12:55095061-55095083 TCTGCCTGAGAGTCACAGGCAGG + Intergenic
1101091618 12:101292608-101292630 GCAGTCTGCCAGTCAGAAGCGGG + Intronic
1101985476 12:109442737-109442759 GCTGCCTGGCACGCAGCAGCAGG + Intronic
1102030573 12:109737941-109737963 GCTGCCTTGCTGAGACAAGCGGG + Intronic
1102375424 12:112418089-112418111 GCTGCTTGGGAGTCTGAAGCAGG - Intronic
1104390652 12:128388298-128388320 GCTGCCTGGCAGCCATCGGCTGG - Intronic
1106409665 13:29502566-29502588 GCTTCCTGGCAGTCTCAGGAAGG + Intronic
1108527301 13:51296804-51296826 GCTTCCTGTCACTCACAATCAGG + Intergenic
1109308388 13:60664196-60664218 GCTGCATTGCAGGCCCAAGCCGG - Intergenic
1110195192 13:72781291-72781313 GCTGCCTGGGAGTCGCAGGCTGG + Intronic
1111938156 13:94579684-94579706 GCTGGCTGACACTCACCAGCTGG - Intronic
1112036104 13:95498161-95498183 GCTGCCTGGCAGCTCCAAGGAGG - Intronic
1113297857 13:108981675-108981697 GCCGCCTGGCAGACATTAGCAGG - Intronic
1113682292 13:112252994-112253016 CGTGCCGGGCAGTCACAACCCGG - Intergenic
1114083677 14:19221317-19221339 GCTGCCTGCCAGGCACAGGAGGG + Intergenic
1117183569 14:53217490-53217512 GCTGCCTGCCAGTCCCGCGCAGG + Intergenic
1118617066 14:67581155-67581177 ACTGCCTGGCAGTCACTAGCTGG + Intronic
1119539121 14:75427649-75427671 GCTGCCTGGCGGGCACAAGCCGG + Intergenic
1122618865 14:103041709-103041731 GGTGGCTGGCATTCACAAGAAGG + Intronic
1202895298 14_GL000194v1_random:3086-3108 GCTGCCTGCCAGGCACAGGAGGG + Intergenic
1124387786 15:29224764-29224786 GCTGCCTGCCAGTCCCCTGCTGG + Intronic
1124803868 15:32861567-32861589 AATGCCTGGCACTCACAAGCAGG + Intronic
1126381363 15:48050865-48050887 GCTGCATGGCAGTCAAGAGCAGG - Intergenic
1130949592 15:88574886-88574908 GTTGCCTGGCAACCACCAGCAGG - Intergenic
1131371818 15:91888175-91888197 GCTGGCTGGGAGTCAGGAGCTGG + Intronic
1131446525 15:92502510-92502532 GCTGCCTGCCAGTAACAGTCAGG - Intergenic
1132102406 15:99033734-99033756 GCTACCTGGGAGTCTGAAGCAGG - Intergenic
1132854156 16:2037357-2037379 GGCGCCTGGCAGTGACAGGCAGG - Intronic
1133850361 16:9497717-9497739 GCTGCCTGACAGGGACAAGATGG + Intergenic
1134666539 16:16023021-16023043 GCTACCTGGGAGGCAGAAGCGGG - Intronic
1135473366 16:22751892-22751914 GCTGCCTCCCACTCACCAGCTGG + Intergenic
1137352209 16:47723312-47723334 GCTGCTTGGGAGTCTGAAGCAGG + Intergenic
1137576880 16:49605760-49605782 GCTGCCTGCCAGTGACAACGGGG - Intronic
1140542535 16:75770741-75770763 GCTGCCTAGCAGTCATCAGTGGG - Intergenic
1141687659 16:85579507-85579529 GCTGCCGGGGACTCACAGGCCGG + Intergenic
1141698304 16:85631040-85631062 GCTGCCTGGAAGACAGGAGCAGG - Intronic
1142218034 16:88839434-88839456 GGGGCCTGGCACTCACCAGCAGG + Intronic
1142274621 16:89111284-89111306 GCTGCCTGGCAGAGAAAGGCAGG - Intronic
1143363964 17:6393572-6393594 GCTGCCTGGCAATTAAAATCGGG - Intergenic
1143493508 17:7297180-7297202 GCTGCCTGGGAGGCTGAAGCAGG + Intergenic
1143679609 17:8466764-8466786 GCTGCCTGGAAAGCACCAGCTGG - Intronic
1144535145 17:16081534-16081556 GCTGCCTGGCAGCCACTAGAAGG + Intronic
1147638111 17:41976266-41976288 CCTGCCTAGCACTCACATGCTGG + Exonic
1149175864 17:53869039-53869061 TCTACCTGGCAGTCACAAGGAGG + Intergenic
1154341077 18:13502859-13502881 TCTGGCTGGCAGCCACAGGCTGG + Intronic
1154500362 18:14992979-14993001 GCTGCCTGCCAGGCAAAAGAGGG + Intergenic
1163205393 19:15798719-15798741 GCTGCTTGGCAGACAGAAACTGG - Intergenic
1164435697 19:28227246-28227268 GCTTCCTGTCAGTCAAAAGGTGG - Intergenic
1165720137 19:38073230-38073252 GCTGCGTCACGGTCACAAGCTGG - Intronic
1165769429 19:38370219-38370241 GCTGCCACTCAGTCCCAAGCGGG + Exonic
1165901543 19:39171680-39171702 GATGCCTGGCAGCCCCAGGCAGG + Intronic
1166283496 19:41810080-41810102 TCTGCCTGGCAGTGACTGGCAGG - Intronic
1166727307 19:45036788-45036810 GCTACCTGGCAGTCTGAGGCAGG - Intronic
1167714193 19:51130628-51130650 GCGGCCTAGCAGTCACAGGGTGG - Intronic
1168654705 19:58118508-58118530 GCTGCCTGGCAGCCAGAACCTGG + Intergenic
925879085 2:8335875-8335897 GCTGTATGGCAGTCACCAGGAGG + Intergenic
926130537 2:10301290-10301312 GGTGCATGGCAGACACAGGCAGG - Intergenic
926152385 2:10432397-10432419 GCTGCCAGGCTGCCCCAAGCCGG - Intergenic
927185633 2:20480115-20480137 GCTGCGATGCAGTCACAACCAGG - Intergenic
927860746 2:26558582-26558604 GCTGCCTGGCACTGCCAGGCAGG + Exonic
931004805 2:57836896-57836918 CCGGCCTGCCAGTCACAGGCTGG - Intergenic
932246539 2:70201626-70201648 GCTGCATGGCAGTCAAGAGTAGG + Intronic
932488773 2:72105114-72105136 GCTGCCTGCCTGTCACTGGCAGG + Intergenic
934741064 2:96722906-96722928 GCTGCTTGGAAGTCTGAAGCAGG + Intronic
934777440 2:96948473-96948495 GGAGCCTGACAGTCAGAAGCTGG + Intronic
935250694 2:101257498-101257520 GCAGCCTGGCAGTCAAAGACAGG - Intronic
936118488 2:109721749-109721771 TCTGACTGGCAGACACTAGCGGG - Intergenic
936572009 2:113625387-113625409 GTGGCCTGGCAGTCACATGTGGG + Intergenic
938492905 2:131775316-131775338 GCTGCCTGCCAGGCACAGGAGGG - Intergenic
938499565 2:131823324-131823346 GCTGCCTGCCAGGCAAAAGAGGG + Intergenic
938746232 2:134280997-134281019 GCTACTTGGCAGTCACAGCCTGG + Intronic
940115914 2:150208228-150208250 GCTGCTTGGCACTCAGCAGCTGG + Intergenic
941433586 2:165440481-165440503 TCTGCCTGGAAATCACAAGCTGG - Intergenic
942178264 2:173355304-173355326 TCTGCCTGGCAGGCAAAATCGGG - Intronic
942763695 2:179429250-179429272 GCTGCCTGGCATCCCCAAACAGG - Intergenic
945195911 2:207237634-207237656 TCCGCCTGGCAGACACAATCTGG + Intergenic
949066856 2:241996264-241996286 CCTACCTGGCTGTGACAAGCAGG - Intergenic
1169432287 20:5548385-5548407 GTTGCCTGGCTGTCACATTCAGG - Intronic
1170622775 20:18009332-18009354 GCTGCATGGCAGGGACAAGCTGG + Intronic
1176614997 21:9019073-9019095 GCTGCCTGCCAGGCACAGGAGGG + Intergenic
1176710208 21:10144798-10144820 GCTGCCTGCCAGGCACAGGAGGG - Intergenic
1178307147 21:31500268-31500290 GCTGCCTGTCAGTGAAGAGCTGG - Intronic
1179468294 21:41593042-41593064 GGTCCCCGGCAGTCACAAGGTGG + Intergenic
1179558455 21:42195466-42195488 CCTGACTGTCAGTCACAGGCCGG + Intergenic
1180294298 22:10871950-10871972 GCTGCCTGCCAGGCACAGGAGGG - Intergenic
1180497104 22:15901364-15901386 GCTGCCTGCCAGGCACAGGAGGG - Intergenic
1180983499 22:19890730-19890752 GCTGCCTGGCACTCAACAGAGGG + Intronic
1181518340 22:23430891-23430913 GCTTCCTGGCAGTCACACCCTGG - Intergenic
1181542776 22:23582675-23582697 GCTGCCTGGGAGGCTGAAGCAGG - Intergenic
1183371214 22:37433588-37433610 GCCCCTTGCCAGTCACAAGCAGG + Intergenic
1185008833 22:48301737-48301759 GCTGTTTGGCAGTGCCAAGCGGG - Intergenic
1185012240 22:48320788-48320810 CCTGCCTGGGAGTCCCAGGCAGG - Intergenic
1185428182 22:50785495-50785517 GTGGCCTGGCAGTCACATGTGGG - Intergenic
950635385 3:14310847-14310869 GCTGTCTGGCAGTCACAGTCAGG + Intergenic
952191479 3:31027381-31027403 GGTGCCTGGTAGACACAGGCAGG + Intergenic
953438077 3:42895707-42895729 GCAGCCTGGCAGCCACCAGAGGG - Intronic
954139607 3:48598144-48598166 GCTGCCTGGCAGTCACAAGCAGG - Intergenic
955335515 3:58082230-58082252 GCTGCCTCGCAGTCATAAACAGG - Intronic
959141567 3:102492447-102492469 GCTGCCTGCCAGTTCCACGCTGG + Intergenic
960054993 3:113270832-113270854 CCTGGCTGGCATTCACAATCTGG - Exonic
960167415 3:114419345-114419367 GCTGGCTGGTAGTCAGAAGAGGG + Intronic
960227465 3:115184858-115184880 GCTGCCTGCCAGTCCCGTGCTGG + Intergenic
960492409 3:118333416-118333438 GCTGCCTGGAAGTCACCACTTGG + Intergenic
961654734 3:128435091-128435113 GCTGCCAGGGAGTCACAGCCAGG - Intergenic
961956971 3:130814812-130814834 GCTGCCTGCCAGTCCCGTGCGGG + Intergenic
963062485 3:141235743-141235765 GCTGCATGGCAGCCACGAGGAGG + Intronic
965078067 3:164003358-164003380 GCTGCCTGCCAGTCCCGTGCCGG - Intergenic
967258098 3:187613695-187613717 GCTGCCTGGCATGCAGCAGCAGG + Intergenic
970137212 4:12938007-12938029 GCTGCCTGGCAGACAAAGGCAGG - Intergenic
973705945 4:53580458-53580480 GCTGTCTGGCAGTCACATCAAGG - Intronic
973748058 4:53984083-53984105 GCTGCCTGGCATTCATAGCCAGG + Intronic
976399608 4:84592915-84592937 GCTACCTTCCAGTCCCAAGCAGG + Intronic
979899816 4:126201936-126201958 TCAGCCTGGCAGACACAGGCCGG - Intergenic
985127339 4:186707820-186707842 AGTGGCTGCCAGTCACAAGCTGG - Exonic
985203322 4:187506021-187506043 GCTGCCTGCCAGTCCCGCGCCGG - Intergenic
985403798 4:189616616-189616638 GCTGCCTGCCAGTCCCGCGCCGG + Intergenic
985614347 5:910588-910610 TCTCCCTGTCAGTCACAAGGGGG + Intronic
985980506 5:3458428-3458450 TCTGCCTGGCACTAACAACCCGG + Intergenic
986060936 5:4189169-4189191 GCTGCCTGTGAGTCAGCAGCAGG + Intergenic
986182237 5:5404060-5404082 GCTGCCTGACCTTCACAGGCTGG + Intergenic
986592816 5:9389069-9389091 GCTTCCTGGATTTCACAAGCAGG - Intronic
988073576 5:26324851-26324873 GCTGCCTGCCAGTCCCACACTGG - Intergenic
989777409 5:45225866-45225888 GCTGGCTGCAAGTCCCAAGCAGG - Intergenic
992120805 5:73590073-73590095 GCTTGCTGACAGTAACAAGCAGG + Intergenic
992453034 5:76890536-76890558 GCTGCCTGGAAGTCTGAGGCTGG + Intronic
995483544 5:112616073-112616095 GCTGACTGGCAGTCACAGAATGG + Intergenic
995551150 5:113282853-113282875 GCAGCCAGGAAGTCACAGGCTGG - Intronic
995778884 5:115755147-115755169 GCTGGCAGGCACTCACCAGCAGG - Intergenic
996095944 5:119399297-119399319 GCTCCCTGGCAGGCAGAAGCTGG - Intronic
998129890 5:139646449-139646471 GCTCCCTGGGAGTCAGCAGCAGG - Intergenic
998869844 5:146541247-146541269 GCAGCCTTCCAGTCACATGCAGG + Intergenic
1001877167 5:175211543-175211565 GTTGCCTGATAGTCACAAGATGG + Intergenic
1002159585 5:177307414-177307436 CCTGCCTGGCAGCCAGCAGCAGG + Exonic
1002690711 5:181048090-181048112 GCTCCCTGGCAGGCAGATGCCGG + Exonic
1003023186 6:2529825-2529847 GCTGCGTTGCAGTCACATTCAGG + Intergenic
1003135943 6:3434933-3434955 GCTGCCTGTCAGTTCCAAACAGG + Intronic
1003492609 6:6636788-6636810 GCTGCCTGGTATTTACAAGCAGG - Intronic
1009497915 6:64373947-64373969 GCTGCCTGGCTATCAGCAGCTGG + Intronic
1010629496 6:78180539-78180561 GCTGCCTACCAGTCACATACTGG + Intergenic
1013709642 6:112881300-112881322 GCCGCCTGTCAGTCACACCCTGG - Intergenic
1014772849 6:125476487-125476509 CCAGCCTGGCAGACACAAGCCGG - Intergenic
1016557185 6:145352296-145352318 TCTGCCTAGCAGCCATAAGCTGG - Intergenic
1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG + Intronic
1019442804 7:1055960-1055982 GCAGCCTCGCAGGCAGAAGCTGG + Intronic
1019710624 7:2516705-2516727 GCTGCCTGGGAGCCCCAAACTGG + Intronic
1021734429 7:23628953-23628975 TCTGCCTGGCAGTAACAAGGTGG + Intronic
1023232553 7:38050060-38050082 GCTGCCTGCCAGTCCCATGCAGG - Intergenic
1026341558 7:69438642-69438664 GCTGCCTGACACTCACATGCAGG + Intergenic
1027602484 7:80256294-80256316 GCTGCCTGGAAATCAAAAGAAGG + Intergenic
1031837756 7:126699111-126699133 TCTGCCTGGCAGTCAGGTGCAGG - Intronic
1033285531 7:140037765-140037787 GCTGCCTGGCCGTCAGACCCCGG + Exonic
1034415076 7:150959937-150959959 GGAGCCTGGCAGCAACAAGCTGG - Intronic
1034709276 7:153176608-153176630 GCAGTCTGGGAGTCAGAAGCAGG - Intergenic
1034900919 7:154907291-154907313 GCTGCCCGCCAGTCCCACGCAGG - Intergenic
1035212768 7:157340778-157340800 GCTACCTGGCAGGCTGAAGCAGG - Intronic
1036754617 8:11464100-11464122 GCTGCCTGGCAGAGATGAGCAGG + Intronic
1037832716 8:22198777-22198799 GGTGGCTGGCAGTGCCAAGCAGG - Intronic
1038001908 8:23399195-23399217 TCTGCATGGCAGTCACACCCTGG - Intronic
1043048700 8:75359137-75359159 TTTGCCTGGGAGTCACCAGCGGG + Intergenic
1044693375 8:94900137-94900159 ACAGCCTGGCAGAGACAAGCAGG - Intronic
1045970276 8:108072247-108072269 TCTTCCTGGTAGTCAAAAGCAGG - Intronic
1047100121 8:121667415-121667437 GCTGCCTGCCAGTCCCGCGCTGG + Intergenic
1047368866 8:124238287-124238309 GGTGCCGGGCAGTCAGAAACAGG + Intergenic
1048281061 8:133106041-133106063 CCTGCCTGGCAGTCCCCAACAGG - Intronic
1049044158 8:140136352-140136374 GCTGCCTGGCAGGCACAAGCAGG + Intronic
1049693113 8:143971401-143971423 GCTGCCTTGCCGTCACTGGCTGG + Intronic
1050091037 9:2016582-2016604 TCTGCCTGACTGTCACAAACAGG + Intronic
1050110553 9:2211240-2211262 TCTGCCTGGCAGTAACCAGCAGG + Intergenic
1053647183 9:40130496-40130518 GCTGCCTGCCAGGCACAGGAGGG - Intergenic
1053758541 9:41333347-41333369 GCTGCCTGCCAGGCACAGGAGGG + Intergenic
1054328189 9:63728452-63728474 GCTGCCTGCCAGGCACAAGAGGG - Intergenic
1054537395 9:66245674-66245696 GCTGCCTGCCAGGCACAGGAGGG + Intergenic
1057628563 9:96700858-96700880 GCTGCCTGCCAGTCCCGCGCCGG + Intergenic
1061401180 9:130369366-130369388 ACAGCCTGGGAGTCACAGGCAGG - Intronic
1062637647 9:137500055-137500077 TCTGCCAGGCAGCCACAGGCGGG + Intronic
1202794972 9_KI270719v1_random:113793-113815 GCTGCCTGCCAGGCACAGGAGGG - Intergenic
1186608914 X:11119669-11119691 ACTCCCTGGCTGTCACAGGCTGG + Intronic
1186680677 X:11870534-11870556 GCTGCCTCCCAGACAAAAGCAGG + Intergenic
1186817260 X:13250072-13250094 TCTGCATGGCAGACACAAGCAGG + Intergenic
1188024939 X:25198255-25198277 GCTGCCTGGAAATCTCAAGTAGG - Intergenic
1189346759 X:40247845-40247867 CTTTCCAGGCAGTCACAAGCAGG - Intergenic
1189806772 X:44743161-44743183 GCTGGCTGTCAGTCAGGAGCTGG - Intergenic
1192593338 X:72380449-72380471 GCAGCCTGGCAGCCACCAGAGGG - Intronic
1192636404 X:72823731-72823753 GCAGCCTGGCAGCCACCAGAGGG - Intronic
1192645310 X:72897083-72897105 GCAGCCTGGCAGCCACCAGAGGG + Intronic
1199929111 X:152500465-152500487 GCTGCCTTGCTGTGAAAAGCTGG + Intergenic
1201897332 Y:19005783-19005805 TCTGCAAGGCAGTCACAGGCCGG + Intergenic