ID: 954141642

View in Genome Browser
Species Human (GRCh38)
Location 3:48609818-48609840
Sequence TGCCGTCCATCAGCCCGAGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 67}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954141639_954141642 -3 Left 954141639 3:48609798-48609820 CCTGCGCACATCAGTCCACCTGC 0: 1
1: 0
2: 0
3: 7
4: 103
Right 954141642 3:48609818-48609840 TGCCGTCCATCAGCCCGAGCAGG 0: 1
1: 0
2: 0
3: 4
4: 67
954141637_954141642 3 Left 954141637 3:48609792-48609814 CCAGTCCCTGCGCACATCAGTCC 0: 1
1: 0
2: 0
3: 10
4: 147
Right 954141642 3:48609818-48609840 TGCCGTCCATCAGCCCGAGCAGG 0: 1
1: 0
2: 0
3: 4
4: 67
954141636_954141642 6 Left 954141636 3:48609789-48609811 CCGCCAGTCCCTGCGCACATCAG 0: 1
1: 0
2: 0
3: 15
4: 198
Right 954141642 3:48609818-48609840 TGCCGTCCATCAGCCCGAGCAGG 0: 1
1: 0
2: 0
3: 4
4: 67
954141635_954141642 14 Left 954141635 3:48609781-48609803 CCGCGCTGCCGCCAGTCCCTGCG 0: 1
1: 0
2: 0
3: 21
4: 267
Right 954141642 3:48609818-48609840 TGCCGTCCATCAGCCCGAGCAGG 0: 1
1: 0
2: 0
3: 4
4: 67
954141638_954141642 -2 Left 954141638 3:48609797-48609819 CCCTGCGCACATCAGTCCACCTG 0: 1
1: 0
2: 0
3: 11
4: 156
Right 954141642 3:48609818-48609840 TGCCGTCCATCAGCCCGAGCAGG 0: 1
1: 0
2: 0
3: 4
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954141642 Original CRISPR TGCCGTCCATCAGCCCGAGC AGG Exonic