ID: 954144573

View in Genome Browser
Species Human (GRCh38)
Location 3:48628184-48628206
Sequence GCTCCTGGAACAGCCGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 88}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954144568_954144573 12 Left 954144568 3:48628149-48628171 CCAGAAGCTGTGGGACCTGCAGC 0: 1
1: 0
2: 4
3: 35
4: 303
Right 954144573 3:48628184-48628206 GCTCCTGGAACAGCCGTGAAAGG 0: 1
1: 0
2: 0
3: 8
4: 88
954144570_954144573 -3 Left 954144570 3:48628164-48628186 CCTGCAGCAGCCAGGCTGAAGCT 0: 1
1: 0
2: 1
3: 32
4: 334
Right 954144573 3:48628184-48628206 GCTCCTGGAACAGCCGTGAAAGG 0: 1
1: 0
2: 0
3: 8
4: 88
954144567_954144573 18 Left 954144567 3:48628143-48628165 CCAGGACCAGAAGCTGTGGGACC 0: 1
1: 0
2: 2
3: 25
4: 242
Right 954144573 3:48628184-48628206 GCTCCTGGAACAGCCGTGAAAGG 0: 1
1: 0
2: 0
3: 8
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954144573 Original CRISPR GCTCCTGGAACAGCCGTGAA AGG Intronic
900547882 1:3238630-3238652 GCTCCCGCAAGAACCGTGAAAGG - Intronic
901526294 1:9824868-9824890 AGGCCTGGAACAGCCGTGGATGG + Intergenic
902618645 1:17637904-17637926 GCTCCTGGAAGAGGCGTGGGGGG - Exonic
902830066 1:19006792-19006814 GATCCTGGTACAGGGGTGAAGGG - Intergenic
904377622 1:30091676-30091698 GCTCATGGAACGGCAGTGACTGG + Intergenic
904997480 1:34642235-34642257 GCTCTTGGAACAGCCCAGGAGGG - Intergenic
907061729 1:51433659-51433681 GCTCTTGTAACATCCCTGAAGGG - Intronic
911354927 1:96804790-96804812 GCTCCTGGAACAGCTGCAACAGG - Exonic
923171429 1:231421414-231421436 TCTCCTGGAACAGCGATGAGCGG + Exonic
1066542638 10:36465001-36465023 GCTCCTGTATCATCCGTGAAGGG + Intergenic
1067946618 10:50693328-50693350 GCAGCTGGAGCAGCCTTGAAGGG + Intergenic
1069839484 10:71330239-71330261 GCTCCTGGAAAAGGAGTGATAGG + Intronic
1070881928 10:79858321-79858343 GCAGCTGGAGCAGCCTTGAAGGG + Intergenic
1071648505 10:87374634-87374656 GCAGCTGGAGCAGCCTTGAAGGG + Intergenic
1076505511 10:130970487-130970509 GCTCCTGCACCAGCCCTGCATGG - Intergenic
1077169179 11:1158769-1158791 GCTCCTGGAACAGCAGGGCAGGG + Intronic
1078200279 11:9176054-9176076 GGTCCTGGAACAGGAATGAAAGG - Intronic
1081710865 11:45214452-45214474 GCTCCAGGAACAGCCTTGGAAGG - Intronic
1082087400 11:48061382-48061404 GCTCCTGGAAAAGCCCTCTATGG + Intronic
1084373030 11:68757092-68757114 GCTACTGGACCAGACGGGAACGG + Exonic
1091202607 11:133793622-133793644 GCTCATGTAACAGCTGTCAAAGG - Intergenic
1096410854 12:51376287-51376309 GCACCTGTAACAGGTGTGAAAGG - Intronic
1098821207 12:75232239-75232261 GCTCCTGGACCATGCTTGAAGGG + Intergenic
1099384718 12:82000142-82000164 GCTCCTGGAACATGCATGGAGGG + Intergenic
1100324307 12:93526519-93526541 ACTCCTGGAAAAGCATTGAATGG + Intergenic
1101861604 12:108486686-108486708 GCTCCTGGAACATCTGGGAGAGG + Intergenic
1106023728 13:25938616-25938638 GCTCCTGGGAGACCCATGAAAGG - Intronic
1107122533 13:36811405-36811427 GCTCATGGAAAAGCCATGGATGG - Intergenic
1107574834 13:41707477-41707499 GTTGTTGGAACAGCCCTGAAGGG - Intronic
1113909266 13:113834504-113834526 GCCCCCGGAACCACCGTGAAGGG + Intronic
1115569516 14:34653458-34653480 GCTCCATGAATAGCAGTGAAAGG + Intergenic
1118288723 14:64501936-64501958 GCTCCTGTTTCAGCCGGGAAGGG - Intronic
1120832368 14:89008704-89008726 GCTCTTGGAAGAGCCTGGAAAGG + Intergenic
1121677495 14:95765855-95765877 GTTACTGGAACAGCAGTGAAAGG - Intergenic
1123896672 15:24837212-24837234 ACTCCTTGTACAGCTGTGAATGG + Intronic
1124363142 15:29053617-29053639 GCTCCGGGAAAAGCAGTCAAGGG - Intronic
1125281098 15:38043329-38043351 GCTCCTGGAACCTCCCTGCAAGG - Intergenic
1127065324 15:55231368-55231390 ACTCCTAGAACAGCAGAGAACGG + Intronic
1128386004 15:67148937-67148959 GCTCCTGGCACAGTTGGGAAGGG + Intronic
1129896161 15:79107583-79107605 GCTCCTGAAACAGCTGAGAGAGG - Intergenic
1131352625 15:91715384-91715406 CCTCTTGGAACAGATGTGAATGG + Intergenic
1132567590 16:630545-630567 GCCCCTGAAACAGCCATGGAGGG + Intronic
1136500477 16:30667565-30667587 GCCCCGGGAGCTGCCGTGAAAGG - Exonic
1140904731 16:79400592-79400614 CCTCCTGGGAAACCCGTGAAGGG - Intergenic
1144667969 17:17114969-17114991 GCCCCTGGGAAAGCCCTGAACGG + Intronic
1145007747 17:19347081-19347103 GCTGCTGGAACAGGGCTGAAGGG + Intronic
1152411831 17:80129152-80129174 GCTCCTGAAACCACTGTGAATGG + Intergenic
1156621219 18:38854230-38854252 GCACCAGGAACAGAGGTGAATGG + Intergenic
1157386171 18:47261268-47261290 GCTGCAGGAACCGCCGAGAAGGG - Intergenic
925737553 2:6977630-6977652 GCTCCTGTAACAGCAATAAAAGG - Intronic
929262491 2:39881373-39881395 GCTCCAGGAACAGCAGCGCAAGG - Intergenic
929809546 2:45178218-45178240 GCTCCTGGACCAGTCACGAAGGG - Intergenic
932330024 2:70893403-70893425 GCTCCTGGCACAGCCCAGGAGGG - Intergenic
938030347 2:127986890-127986912 GCTGCTGGAGCAGCACTGAATGG + Exonic
938945256 2:136206681-136206703 GCTCCTGGGACAGCTGCAAAGGG - Intergenic
946870307 2:224078782-224078804 GCTCCTGGCACAGGCGAGGAAGG - Intergenic
947793054 2:232878599-232878621 CCTCCTCGACCAGCCTTGAAGGG + Intronic
1171881769 20:30622470-30622492 GCTCCTGGCACACCCCTGCAGGG - Intergenic
1173570120 20:44070612-44070634 GCTCCTGGTGCAGCTGTGAGGGG - Intergenic
1174078184 20:47952688-47952710 GCACCTGGCAGAGCCCTGAAAGG - Intergenic
1178574397 21:33772131-33772153 TCTCCTGGAACAGCAGCGCAAGG + Exonic
1180788138 22:18558329-18558351 GCTCCTGGCACACCAGTGCATGG - Intergenic
1181233600 22:21436989-21437011 GCTCCTGGCACACCAGTGCATGG + Intronic
1181245050 22:21497854-21497876 GCTCCTGGCACACCAGTGCATGG - Intergenic
1183331372 22:37223790-37223812 GCTCCTGGAACTTCCCTGCAGGG - Intergenic
1185111404 22:48902171-48902193 ACACCTGGAAACGCCGTGAAGGG + Intergenic
1185111507 22:48902597-48902619 ACACCTGGAAACGCCGTGAAGGG - Intergenic
949760025 3:7459864-7459886 GCTCCTGGAACTACCAAGAACGG - Intronic
950512310 3:13438322-13438344 GTCCCGGGAACTGCCGTGAAGGG + Intergenic
953213672 3:40898121-40898143 TCTCCTGGAAGAGCCAAGAAAGG + Intergenic
954144573 3:48628184-48628206 GCTCCTGGAACAGCCGTGAAAGG + Intronic
956681592 3:71785947-71785969 GCTCCAGGCACAGCCGTTCAGGG + Intergenic
968894113 4:3388724-3388746 GCTCCTGTCACTGCCGTGGAGGG - Intronic
969216843 4:5729946-5729968 GCTCCTGGAAGCGCCATGGAAGG - Intronic
972589286 4:40469314-40469336 GTTACTTGAATAGCCGTGAAAGG - Intronic
985399392 4:189579464-189579486 GTTCCCACAACAGCCGTGAAAGG - Intergenic
991967391 5:72107059-72107081 GCTCCTGCTGCAGCCGTGAAGGG - Intergenic
993131654 5:83905725-83905747 CCTCCTGGAAGGGCTGTGAAAGG + Intergenic
994149374 5:96431323-96431345 GCTCCGGGAACAGAAGTCAAAGG - Intronic
998647201 5:144075763-144075785 GCTCCTGGAAAAGGGGTGAATGG + Intergenic
999388633 5:151173983-151174005 GCCCCTGGAACAGCACTGCAGGG + Intergenic
1003248062 6:4400900-4400922 GCTCCTGGGAGAGCCCTGAAGGG + Intergenic
1004534508 6:16487052-16487074 GTTCCTGGGTCAGCCTTGAAAGG - Intronic
1008539907 6:52537557-52537579 GCCCCTTGAACAGCTGGGAATGG - Intronic
1020246579 7:6434067-6434089 GCTCCAGGACCAGCCCTGAATGG + Intronic
1021907631 7:25351581-25351603 GCTCCTGGACCATCCATGGATGG + Intergenic
1023280301 7:38562469-38562491 GCTACTGGCACAGCAGAGAAGGG + Intronic
1036780558 8:11644073-11644095 CCTCCTGGGACTGCTGTGAAGGG - Intergenic
1037757907 8:21723320-21723342 TCTCCTGGCAGAGCCCTGAAGGG - Intronic
1037765020 8:21767437-21767459 GCTCCTGTAACCCCCGTGCACGG - Intronic
1048856552 8:138691069-138691091 GCTTCTGGCACAGAGGTGAAAGG + Intronic
1053277196 9:36792062-36792084 TCTCCTGGAACTGCCATCAAAGG - Intergenic
1055147391 9:72953011-72953033 GCTCCTGGAACACAGGTGACTGG + Exonic
1059703206 9:116795729-116795751 GCTCCTGGAACTGGGGGGAAAGG + Intronic
1193941253 X:87682705-87682727 GTTCCTGGAAAAGCAGAGAAGGG - Intergenic
1198051890 X:132958383-132958405 GCTCCTGGACAAGCCCCGAAAGG - Exonic
1200171988 X:154083728-154083750 TCTCCTGGGACAGAAGTGAAGGG + Intronic