ID: 954145319

View in Genome Browser
Species Human (GRCh38)
Location 3:48631554-48631576
Sequence TCCAGCTGGCCCTCAAATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 112}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954145308_954145319 -1 Left 954145308 3:48631532-48631554 CCAAGAACCCTCCCAGCCCCCCT 0: 1
1: 0
2: 4
3: 52
4: 592
Right 954145319 3:48631554-48631576 TCCAGCTGGCCCTCAAATACAGG 0: 1
1: 0
2: 0
3: 11
4: 112
954145307_954145319 0 Left 954145307 3:48631531-48631553 CCCAAGAACCCTCCCAGCCCCCC 0: 1
1: 0
2: 1
3: 41
4: 405
Right 954145319 3:48631554-48631576 TCCAGCTGGCCCTCAAATACAGG 0: 1
1: 0
2: 0
3: 11
4: 112
954145306_954145319 8 Left 954145306 3:48631523-48631545 CCACAATACCCAAGAACCCTCCC 0: 1
1: 0
2: 1
3: 9
4: 176
Right 954145319 3:48631554-48631576 TCCAGCTGGCCCTCAAATACAGG 0: 1
1: 0
2: 0
3: 11
4: 112
954145309_954145319 -8 Left 954145309 3:48631539-48631561 CCCTCCCAGCCCCCCTCCAGCTG 0: 1
1: 1
2: 15
3: 115
4: 1054
Right 954145319 3:48631554-48631576 TCCAGCTGGCCCTCAAATACAGG 0: 1
1: 0
2: 0
3: 11
4: 112
954145304_954145319 10 Left 954145304 3:48631521-48631543 CCCCACAATACCCAAGAACCCTC 0: 1
1: 0
2: 2
3: 9
4: 128
Right 954145319 3:48631554-48631576 TCCAGCTGGCCCTCAAATACAGG 0: 1
1: 0
2: 0
3: 11
4: 112
954145305_954145319 9 Left 954145305 3:48631522-48631544 CCCACAATACCCAAGAACCCTCC 0: 1
1: 0
2: 0
3: 5
4: 123
Right 954145319 3:48631554-48631576 TCCAGCTGGCCCTCAAATACAGG 0: 1
1: 0
2: 0
3: 11
4: 112
954145303_954145319 11 Left 954145303 3:48631520-48631542 CCCCCACAATACCCAAGAACCCT 0: 1
1: 0
2: 2
3: 14
4: 172
Right 954145319 3:48631554-48631576 TCCAGCTGGCCCTCAAATACAGG 0: 1
1: 0
2: 0
3: 11
4: 112
954145310_954145319 -9 Left 954145310 3:48631540-48631562 CCTCCCAGCCCCCCTCCAGCTGG 0: 1
1: 0
2: 6
3: 91
4: 828
Right 954145319 3:48631554-48631576 TCCAGCTGGCCCTCAAATACAGG 0: 1
1: 0
2: 0
3: 11
4: 112
954145302_954145319 12 Left 954145302 3:48631519-48631541 CCCCCCACAATACCCAAGAACCC 0: 1
1: 0
2: 0
3: 8
4: 151
Right 954145319 3:48631554-48631576 TCCAGCTGGCCCTCAAATACAGG 0: 1
1: 0
2: 0
3: 11
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954145319 Original CRISPR TCCAGCTGGCCCTCAAATAC AGG Intronic
900327425 1:2115586-2115608 TGCAGCTGGCTCTCAAGTAGGGG - Intronic
900854279 1:5168243-5168265 TCCAGCTGGGGGGCAAATACTGG + Intergenic
905908914 1:41640454-41640476 TGCAGCTGGACCTCAAATGTGGG - Intronic
910622682 1:89273655-89273677 TCGCGCTGGCCCTCAAGCACCGG + Intergenic
910840122 1:91553441-91553463 CCAAGCTGGCCCACAAATGCAGG - Intergenic
911014516 1:93317947-93317969 TCCTGCTGTTCCTCAAATGCTGG + Intergenic
912494281 1:110081399-110081421 TTCAGCTGGCCCACAGAGACTGG - Intergenic
912696979 1:111849121-111849143 TGCAGGTGGCCCTCAGAGACTGG + Intronic
915089415 1:153413336-153413358 TCCAGCTGGCCAACCAATTCTGG + Intergenic
917667182 1:177236495-177236517 CCAAGCTGGCCCTCAAAAATGGG - Intronic
922938900 1:229443948-229443970 TCCAGCTGGTCTTGAACTACTGG + Intronic
923157264 1:231289805-231289827 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
923290748 1:232543305-232543327 TACAGCTGGCCCTTGAACACGGG + Intronic
923315096 1:232772846-232772868 TCCACCTGGCCCCAACATACAGG + Intergenic
923755474 1:236787168-236787190 TGCAGCTGGGCCTCAAACCCAGG - Intergenic
1070305489 10:75236497-75236519 TCCATCTGGCCCCCAAAAGCAGG - Intergenic
1071542525 10:86500184-86500206 TCCAACTGTCCCTCTAAAACTGG + Exonic
1073079656 10:100851065-100851087 TCCACCTGACCCTCAAATGCTGG + Intergenic
1077349569 11:2086187-2086209 TCCACCAGTCCCTCAAATCCTGG - Intergenic
1078675336 11:13407208-13407230 TCCAGCTGTTCATTAAATACTGG + Intronic
1080719059 11:34831561-34831583 GCAAGCTGGCCTTGAAATACCGG - Intergenic
1085412893 11:76302057-76302079 TCCCTCTGCCCCTCAAATCCAGG + Intergenic
1086397778 11:86433851-86433873 TCCAGCTGGCCCACAAGCGCCGG + Intergenic
1087144492 11:94798683-94798705 TCCACCTGTCCCTTAAATTCTGG - Intronic
1090223153 11:125048661-125048683 TCCCCCTGGCCCCCAAACACAGG + Intergenic
1092120842 12:6042721-6042743 GACAGCGGGACCTCAAATACAGG - Intronic
1092530301 12:9338560-9338582 TCCAGCTGACACTTATATACAGG - Intergenic
1095444989 12:42274032-42274054 TCCAGCTGGCCCGCAAGCACTGG + Intronic
1098515964 12:71376888-71376910 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1101695836 12:107125455-107125477 ACCAGCTGGCCTTGAACTACTGG - Intergenic
1102661786 12:114535300-114535322 TTCAGCTGGGCCACAAGTACTGG - Intergenic
1102798727 12:115712872-115712894 TCCACCTGGAGCTCAAACACGGG + Intergenic
1108798507 13:54064183-54064205 TCCAACTGGACAACAAATACTGG + Intergenic
1110260347 13:73477539-73477561 TCCAGCTGCCTCTTAAATGCAGG + Intergenic
1116452327 14:45080467-45080489 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1118690947 14:68339221-68339243 TTAAGCTGGCCCACAAGTACAGG - Intronic
1118888334 14:69885832-69885854 TTAAGCTGGCCCACAAGTACAGG - Intronic
1121009838 14:90513381-90513403 TCCACCTGTCCCTCACACACTGG - Intergenic
1121778083 14:96603937-96603959 TCTAGTTGGACCTCAAAAACAGG - Intergenic
1124650496 15:31470240-31470262 CTAAGCTGGCCATCAAATACTGG + Intergenic
1126424843 15:48516231-48516253 TCCTCCTGGACCTCAAATTCCGG - Exonic
1129190408 15:73934130-73934152 TCCAGCTGGCCCACAAGCAGGGG - Intronic
1135156605 16:20058222-20058244 TCCAGGTGGAACTCAAATCCAGG + Intronic
1141465768 16:84204911-84204933 TCCAGCTGGTCCGCAAGTGCCGG + Intergenic
1144130822 17:12246052-12246074 TCAAGCTGGCTCTCAACTTCAGG - Intergenic
1146623071 17:34415294-34415316 TCCAGCCGTCCCTCAAGTCCGGG - Intergenic
1151727635 17:75893873-75893895 TCCACATGGCCCTCATCTACCGG + Intronic
1155028902 18:21967143-21967165 TCCAGCTGGCCTTGAAATCCTGG - Intergenic
1156842505 18:41626399-41626421 ACCAGCTGGGCCTGAAAGACAGG + Intergenic
1156986096 18:43353118-43353140 TCCAGCTGGCTCTCCAAAAGAGG - Intergenic
1160237524 18:77097824-77097846 TCCAGGTGTCCCCCTAATACCGG - Intronic
1161425740 19:4202038-4202060 TCCACCTGGCCGCCAAATACGGG + Exonic
1163083859 19:14964636-14964658 TGCAGATGGCCCTCAAATCCAGG + Intronic
1166040090 19:40197074-40197096 TCCAGCTGGTCCGCAAATGCAGG - Intronic
1166412678 19:42566658-42566680 TACAACTGACCTTCAAATACGGG - Intergenic
1167151858 19:47714651-47714673 TCAAGCTGGGACTCAAACACAGG - Intronic
925118100 2:1397518-1397540 TCCAGCTGCAGCTCAAATTCAGG + Intronic
925338545 2:3116378-3116400 TTCAGCAGGCCCTCACATAGTGG + Intergenic
926428276 2:12759696-12759718 TGGAGCTGACCCTAAAATACAGG + Intergenic
927998029 2:27500051-27500073 TGCACCTGGCCCTAAAATAAAGG + Intronic
928229151 2:29481068-29481090 TGAAGCTGGTCCTCAAACACAGG - Intronic
929070023 2:38020543-38020565 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
929711102 2:44267414-44267436 TGGAGCTGGGCCTCAAAGACAGG + Intergenic
933218825 2:79664405-79664427 TCCAACTGGCACTGGAATACAGG + Intronic
935862039 2:107342078-107342100 CACAGCTGGCACTCAAATATTGG + Intergenic
936267428 2:111021268-111021290 TGCAGCTGGCCCCCGAATCCGGG + Intronic
939476404 2:142693613-142693635 TCCTGCTGGCCCCCAGATTCTGG - Intergenic
942317630 2:174709897-174709919 TCCAGCTGGCCCGCAAGCGCGGG + Intergenic
942686633 2:178539613-178539635 TCCAGCTGACCCTCACAGAGCGG + Exonic
947411959 2:229850749-229850771 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
948571671 2:238921723-238921745 TCCAGGGGCCCCTCTAATACAGG - Intergenic
1171041575 20:21769061-21769083 TCTAGCTGGCCCTGGAATCCTGG + Intergenic
1171458797 20:25286960-25286982 TGCAGCTGCCCCTTAAATGCTGG - Intronic
1171561901 20:26134415-26134437 TCCAGCTGGCCAACAATTGCTGG + Intergenic
1173256362 20:41396486-41396508 TCCAGCTGGCTCTCAGAAGCAGG - Intergenic
1173339103 20:42137973-42137995 TTCATCTGGCCCTCTAATCCAGG + Intronic
1174231517 20:49049004-49049026 TCCCACAGGCCCTCAATTACAGG - Intronic
1174270969 20:49368113-49368135 TACAGATGGCCCTCAAAATCAGG - Exonic
1174733129 20:52937797-52937819 TCCAGCAGGCTCTCAGATAGTGG - Intergenic
1184558410 22:45246635-45246657 TGCAGCAGCCCCTCTAATACGGG + Intergenic
949769961 3:7568629-7568651 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
951088466 3:18542809-18542831 TCTGTCTGGCTCTCAAATACTGG - Intergenic
953002857 3:38951183-38951205 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
953328264 3:42030792-42030814 TCCACCTAGTTCTCAAATACCGG - Intronic
954145319 3:48631554-48631576 TCCAGCTGGCCCTCAAATACAGG + Intronic
954880915 3:53835569-53835591 TCCATCTGGCCTTCTAGTACTGG + Intronic
958903137 3:99911784-99911806 TCCACCTGGGCCTCAAAGACAGG + Intronic
960282104 3:115791593-115791615 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
962758219 3:138484680-138484702 TCCAGCTGGCCCGCAAGCACCGG - Intergenic
967336260 3:188348036-188348058 TCCTGCTGACCTTCAAATACAGG - Intronic
968685187 4:1953093-1953115 TCCAGCTTCACCTGAAATACAGG - Intronic
975458327 4:74619729-74619751 TCCATCTTGCCCCCAAATTCAGG - Intergenic
981146806 4:141333522-141333544 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
984923436 4:184785852-184785874 TACAGCAGGTCCTCAAATAACGG + Intronic
986912420 5:12574273-12574295 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
989456150 5:41646725-41646747 TGCAACTGTCCCCCAAATACAGG - Intergenic
991222103 5:64228302-64228324 TCCAGCTGGCCTTGAACTCCTGG - Intronic
992717881 5:79529582-79529604 TTAAGCTGGCCCACAAGTACAGG + Intergenic
993822003 5:92631365-92631387 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
997847859 5:137304402-137304424 TCCAGAAGGCCCTCAAATGAAGG + Intronic
999327141 5:150650368-150650390 TCCATCTGGCCCTCAAGGAGGGG - Exonic
999756896 5:154671175-154671197 TTCAGCTGAACCTCAAATCCTGG + Intergenic
1002090399 5:176802295-176802317 TCCAGCTGGGCCCTAAAGACTGG - Intergenic
1002417405 5:179127708-179127730 TGAAGCAGGCCCACAAATACAGG + Intronic
1002668589 5:180846364-180846386 TTCAGCTGGAGCTCAAGTACGGG + Intergenic
1004906184 6:20239095-20239117 TCGCGCTGGCCCACAAGTACCGG - Intergenic
1004986652 6:21090344-21090366 CCCAGTTGGCTCTTAAATACAGG - Intronic
1005433297 6:25781141-25781163 TCCAGCTGACCATTAAATACTGG - Exonic
1009591126 6:65672493-65672515 TGGAGCTGGTCCACAAATACTGG + Intronic
1014083253 6:117312481-117312503 TCCAGCAGGGACTCAGATACGGG - Intronic
1017551051 6:155507808-155507830 TCCAGCTGGCACTCAACTCATGG - Intergenic
1018275808 6:162130113-162130135 TCTTTCTGGCCCCCAAATACAGG + Intronic
1023752040 7:43381957-43381979 CCCAGCTGAGCCTCAAATTCTGG + Intronic
1023844717 7:44114127-44114149 TCCAGCTGGGTCTCAAACTCAGG - Exonic
1034386878 7:150747634-150747656 CCCAGCTTGCACTCAAACACAGG + Intronic
1034632168 7:152539188-152539210 TCCAGCTGGCCCGCAAGCGCTGG + Intergenic
1036217506 8:6892933-6892955 TGCAGCTGGCCCTGAAAAACGGG + Intergenic
1042107905 8:65348447-65348469 TCCAGCTTCGCCTCACATACAGG - Intergenic
1042492937 8:69422186-69422208 TCCAACTGGTAATCAAATACTGG + Intergenic
1044906197 8:97006381-97006403 TCCAGCAGGCACTCTCATACAGG + Intronic
1049302975 8:141881570-141881592 TCCAGCTCCCACTCAAAGACAGG + Intergenic
1054957355 9:70928054-70928076 TCCAGATGGCCTACAAATATGGG - Intronic
1062204482 9:135328604-135328626 TCCAGCTGGCCCCCAACTGTGGG - Intergenic
1062293089 9:135806253-135806275 TCCAGCTGGCCCACTTGTACTGG + Intergenic