ID: 954145418

View in Genome Browser
Species Human (GRCh38)
Location 3:48632038-48632060
Sequence GCCCCACCTGTGGGGCGGCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 180}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954145411_954145418 -4 Left 954145411 3:48632019-48632041 CCGAAGTGGATCAGGCCCAGCCC 0: 1
1: 0
2: 1
3: 11
4: 165
Right 954145418 3:48632038-48632060 GCCCCACCTGTGGGGCGGCCAGG 0: 1
1: 0
2: 0
3: 21
4: 180
954145409_954145418 4 Left 954145409 3:48632011-48632033 CCACGAAGCCGAAGTGGATCAGG 0: 1
1: 0
2: 0
3: 4
4: 44
Right 954145418 3:48632038-48632060 GCCCCACCTGTGGGGCGGCCAGG 0: 1
1: 0
2: 0
3: 21
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954145418 Original CRISPR GCCCCACCTGTGGGGCGGCC AGG Exonic
900176436 1:1293432-1293454 GCCCCAGCACTGGGGCTGCCAGG + Exonic
900550541 1:3252343-3252365 GGCCCACCTGGGGCCCGGCCTGG - Intronic
900616834 1:3569276-3569298 GCCCCGGCTGAGGGGCGGCGGGG - Intronic
901393946 1:8966868-8966890 GCCCCACCTGTGGCTGGGCTTGG + Intronic
901640446 1:10690495-10690517 GCCTCAACTGTGGGGAGGCCAGG - Intronic
901691165 1:10974128-10974150 GCCCCACCTGTGGGCCAGGGAGG + Intronic
901741133 1:11342750-11342772 GCCCCACCTGTGGGGAGAGTAGG - Intergenic
903364619 1:22798312-22798334 GACAGACCTGTGGGGCGCCCTGG - Intronic
904852047 1:33466823-33466845 GCCCCTCCTCTGGGGATGCCTGG + Intergenic
905037775 1:34929235-34929257 GCCCGACCCGAGGGGCGGGCAGG - Intronic
905370668 1:37481118-37481140 GCCCCACCTGGGGAGCTGCTGGG - Intronic
906511415 1:46412236-46412258 GCCTCACCTGTGGCCCTGCCTGG - Exonic
910771319 1:90835522-90835544 GCCCAACCCGTGGGGGCGCCGGG - Intergenic
912496466 1:110095083-110095105 GCCCCAGGAGTGGGGAGGCCAGG - Intergenic
914937627 1:151994155-151994177 GCCCCACCCGCAGGACGGCCGGG - Exonic
916694572 1:167221818-167221840 GCCCCCCCTGGGGGGTGGACTGG + Intronic
916713902 1:167434467-167434489 GCCCCTCCTGTGGGGAGGGAGGG - Intronic
919822169 1:201480530-201480552 GCCCCAGCTGCGGGGCGGGGCGG + Intergenic
1067237877 10:44466943-44466965 GTCCCGCCTGTGGTGCGTCCTGG + Intergenic
1067666999 10:48287558-48287580 GCCCCAGCTGTGGGGCTCACTGG - Intergenic
1073206000 10:101769754-101769776 GCCCCAGCTGGTGGGCGGCTGGG - Intergenic
1076392036 10:130110595-130110617 GCCCTGCCTGTGAGGAGGCCTGG - Intergenic
1076706847 10:132307135-132307157 GCCCCACAGGTGGCGGGGCCCGG - Intronic
1077062553 11:624291-624313 TCCCCACCTGTGGGGCAGGACGG - Intronic
1077231994 11:1461906-1461928 GCTCCACCTCTGGGGGGGCTCGG + Intronic
1077297885 11:1834606-1834628 GCCCCAGCTGTGGTGCGTGCTGG + Intronic
1077299041 11:1838843-1838865 TCCCCACCTGTCCGGCCGCCTGG - Intergenic
1077401096 11:2357854-2357876 GCCCCTCAGGTGGGGCGGCGAGG - Intergenic
1077467131 11:2738700-2738722 GGCCCAGCTGTGGGGCCCCCAGG - Intronic
1081629840 11:44681635-44681657 GCCCCATGGGTGGGGTGGCCTGG + Intergenic
1081873197 11:46392327-46392349 GCCCCTCCTCGCGGGCGGCCCGG - Intergenic
1083618085 11:64036144-64036166 GCCCTACCTGCGCAGCGGCCGGG - Intronic
1083663634 11:64263482-64263504 GCACCACCTGTGGGCCAGACTGG - Exonic
1083718476 11:64592346-64592368 GCCCCATCTGGGAGGCAGCCTGG - Intronic
1084470658 11:69357221-69357243 GCCCCTGCTGTGTGGCTGCCTGG + Intronic
1084666428 11:70578898-70578920 GCCCATCCTGTGGGGAGGCCAGG - Intronic
1084817545 11:71658108-71658130 GCCCCTCCTGTGGGGAGGAGGGG + Intergenic
1085462078 11:76700278-76700300 GCCCCACCTGTGGCTCAGCCAGG - Intergenic
1091301481 11:134510695-134510717 GCCTCTCCTGTGGGGCACCCGGG - Intergenic
1091305419 11:134532973-134532995 CCCCGACCTGTGGGCTGGCCCGG - Intergenic
1091437186 12:481800-481822 GCCTCAGCTGTGGGGAAGCCTGG + Intronic
1091822529 12:3487038-3487060 GGCCCAGGTGTGGGGCTGCCTGG + Intronic
1091832925 12:3563073-3563095 ACCCCACCTGTGGTCCAGCCTGG - Intronic
1094834781 12:34317240-34317262 GCCCAACCTGTGGGTCCGACAGG + Intergenic
1102229976 12:111255925-111255947 GACCCACATGTGGGGAGGTCTGG - Intronic
1102997675 12:117362265-117362287 TCCACACCTGTGGGGCTCCCAGG - Intronic
1103484683 12:121274469-121274491 GCTCATCCTGGGGGGCGGCCCGG + Exonic
1104552947 12:129774172-129774194 GCCCCTTCTTTGGGGGGGCCTGG - Intronic
1104841877 12:131829456-131829478 GCCCCCCCGCTGGGGCGGCCGGG + Intronic
1104895267 12:132160875-132160897 GCCCCGTCTGTGGGGCTGTCAGG - Intergenic
1110298616 13:73899093-73899115 GCCCCAACTGGGGGGCCTCCTGG - Intronic
1112439412 13:99415387-99415409 GCCCCACCCCTGGGGCTCCCGGG - Intergenic
1119261529 14:73240793-73240815 GCCCCACCTTTGGGGAGGAGGGG + Intronic
1119432298 14:74576152-74576174 GCACCACCTGTTGGGAGGGCTGG + Intronic
1119803691 14:77467949-77467971 GACCCGCCTGTGGGGCAGACTGG + Intronic
1121106485 14:91283322-91283344 GACTCACCTTTGGTGCGGCCTGG + Exonic
1121220765 14:92283826-92283848 CCCCCTCCTGAGGGGCCGCCAGG - Intergenic
1122871265 14:104640119-104640141 GCTCCACCTGCGGCCCGGCCAGG - Intergenic
1123036373 14:105473622-105473644 GCCCCAGCTGAGCGTCGGCCTGG - Intronic
1123827870 15:24101522-24101544 GCCTCACCTGTGTGGGCGCCAGG - Intergenic
1123857358 15:24426992-24427014 GCCTCACCTGTGTGGGCGCCAGG - Intergenic
1124203994 15:27701936-27701958 GCCCCACTACTGGGGCGGCAGGG + Intergenic
1124372873 15:29113444-29113466 GCCCCACCTTTCTGGTGGCCAGG + Intronic
1124392183 15:29269471-29269493 GCCCCACGGCGGGGGCGGCCTGG + Exonic
1125744312 15:41988256-41988278 GTCCCGCCTGTGGAGCAGCCTGG - Intronic
1125903825 15:43371651-43371673 GCCCCACCTGTGGCGGGGCGAGG + Intronic
1127382061 15:58438691-58438713 GCACCTTCTGTGGGGCAGCCGGG - Intronic
1129364877 15:75048177-75048199 GCCCCACCTGAGGAGCAGCCTGG + Intronic
1132642604 16:984645-984667 GCCCCTTCTGTGGGGCGGGTGGG - Intronic
1132675145 16:1118344-1118366 TGCCCACCTGTGGGGGGGCCAGG + Intergenic
1132720981 16:1315470-1315492 GCCCCACCAAGGGGGCGGTCAGG - Intronic
1133236096 16:4388113-4388135 GCCCCACCCGGGGGGCTCCCAGG + Intronic
1134125313 16:11612351-11612373 GGGCCACCTGGGGGGCAGCCTGG + Intronic
1134211349 16:12280005-12280027 TCTCCACCTGTGGGGCTGCTGGG + Intronic
1136625402 16:31459087-31459109 CCCCCAGCGGTGGTGCGGCCCGG - Exonic
1137577149 16:49607824-49607846 GCCCCACCTGTGGGAATGCGGGG + Intronic
1139229730 16:65272183-65272205 GCCCCATCTGTGGGGCAGCTGGG - Intergenic
1139318561 16:66094317-66094339 GCTCTATCTGTGGGGTGGCCAGG - Intergenic
1139379236 16:66520119-66520141 GACCAACCTGTGGGACGGCCAGG + Intronic
1139558033 16:67724981-67725003 GGCCCACCTGTGGAGAGGACTGG - Exonic
1139650574 16:68360123-68360145 GCCCCACCCGGGGGGCAGGCAGG + Exonic
1140908936 16:79433968-79433990 GCTCCACATGTGGTGGGGCCTGG - Intergenic
1141572213 16:84941043-84941065 GCCCCTCCTGAGAGGCGGCCAGG + Intergenic
1141721557 16:85758871-85758893 GCCACAGCAGTGGGGCTGCCTGG - Intergenic
1142125076 16:88406143-88406165 GTCCCACCTTTGGCGAGGCCGGG - Intergenic
1143125478 17:4638966-4638988 TCCCCACCTGTGGGGCAGGAAGG + Exonic
1144286989 17:13786442-13786464 GACCCAGCAGTGAGGCGGCCAGG - Intergenic
1144528493 17:16012433-16012455 GCACCACCTGTGGTCCAGCCTGG + Intronic
1147384068 17:40071535-40071557 GACCCACCTGTCGGCTGGCCTGG - Intronic
1147978565 17:44261394-44261416 GCCCCACTGATGGGGAGGCCTGG - Intronic
1148838386 17:50478732-50478754 GCGCCACCTGCCGGGCGCCCGGG - Intergenic
1148858716 17:50593081-50593103 CTCCCTCCTGTGGGGCAGCCAGG + Intronic
1149498571 17:57134562-57134584 TCCACACCTGGGGGGAGGCCAGG - Intergenic
1150687840 17:67334983-67335005 GCCCCACCTGTGGTTTGGTCTGG + Intergenic
1151551839 17:74826798-74826820 ACCCCACCTCTGGGGCCTCCAGG - Intronic
1152583418 17:81178911-81178933 GCCCCAGGTTTGGGGAGGCCAGG + Intergenic
1152723448 17:81934013-81934035 GCCACACCAGTGGGGTGGCGGGG - Intronic
1152755168 17:82084184-82084206 GCCCCACGTGGATGGCGGCCAGG - Intronic
1152928763 17:83099666-83099688 CCCCCACCTGAGGAGCGGCCTGG + Intergenic
1154344649 18:13531895-13531917 GGCCCTGCTGGGGGGCGGCCTGG + Intronic
1157492458 18:48133872-48133894 GCCCAACCTGTAGGGCTGCCTGG + Intronic
1158523087 18:58188165-58188187 GACCGTCCTGTGGGGTGGCCTGG - Intronic
1160837642 19:1132211-1132233 GCCCCAGCATTGGGTCGGCCGGG + Intronic
1160943310 19:1630072-1630094 GCCCCACCCGTGGGGGTGGCAGG + Intronic
1161000513 19:1908374-1908396 CCCCCATCTGTGGGGCGCCCCGG + Intronic
1161080481 19:2307832-2307854 GCCCCTCCTCTGGGGCGCCAAGG - Intronic
1161313531 19:3607538-3607560 GCCCGAGCTGGGGGGTGGCCAGG - Intergenic
1162024705 19:7887506-7887528 GCCTCCCAAGTGGGGCGGCCAGG + Intergenic
1162921675 19:13906618-13906640 GCCTCACCTGGGGGGAGGCGGGG - Intronic
1162957594 19:14107779-14107801 GCCCCTTCTCTGGGGAGGCCGGG + Intronic
1163369316 19:16893255-16893277 GCCCCATCTGTGGAACGGGCTGG + Exonic
1163690692 19:18736755-18736777 GGCCTCCCTGTGGGGGGGCCAGG - Intronic
1163807069 19:19405881-19405903 GTTCCGCCTGTGGGGCCGCCCGG - Intronic
1164872349 19:31656598-31656620 CTCCCACCTGTGTGACGGCCGGG + Intergenic
1168151203 19:54449723-54449745 GCCCAGCCTGCGGGACGGCCAGG + Intronic
927809733 2:26174210-26174232 GCCCCTCCTCCGTGGCGGCCAGG + Intronic
929549433 2:42880120-42880142 GCCCCACCTGGGGACCTGCCCGG - Intergenic
932209628 2:69915711-69915733 GGCCCACCTGGGGGCCGGCCGGG - Intronic
932625556 2:73293324-73293346 GCGCCGGCTGTGGGGCGCCCGGG + Exonic
937847871 2:126601452-126601474 GAGTCACCTGTGGGGAGGCCTGG + Intergenic
938176139 2:129131862-129131884 GGCCCAACTGTGGGACAGCCTGG - Intergenic
938383237 2:130848233-130848255 GCCCACCCTGTGGGGCAGCAGGG + Intronic
940485598 2:154291627-154291649 GCAGCACCCGTGGGCCGGCCGGG - Intronic
944451746 2:199850916-199850938 GCGAGACCTGTGGGGAGGCCGGG - Exonic
945000637 2:205346363-205346385 GCCTCAGCTGTGGGGAGGCAAGG - Intronic
948425856 2:237886204-237886226 GACACCCCCGTGGGGCGGCCTGG - Intronic
948483992 2:238268397-238268419 CCCCCACCAGTGGGGCAGCCTGG + Intronic
948806168 2:240454169-240454191 GCCCCACCTGCGAGGTGGACCGG - Intronic
1169129680 20:3159656-3159678 GCTCCAGCTCTGGGCCGGCCGGG + Intronic
1175540169 20:59743356-59743378 GCCCCTCCTGTGTAGGGGCCAGG - Intronic
1175552194 20:59824768-59824790 GCCCCACCAGTGGGGGGGCGGGG + Intronic
1175697312 20:61112150-61112172 CCCCCACCTCTGGGGCGGAGGGG + Intergenic
1175825486 20:61934367-61934389 GCCCCTCCAGCGGGGTGGCCTGG + Intronic
1175839564 20:62018565-62018587 GTCCCATCTGTGGGGCGGGGTGG - Intronic
1175918920 20:62440927-62440949 CCCCCACCTGTGGTGATGCCGGG + Intergenic
1175928846 20:62484182-62484204 GCTCCACCTGTGGGCGGGTCTGG + Intergenic
1179112289 21:38457724-38457746 GAGCCACCTGTGGGGTGGGCGGG + Intronic
1179489892 21:41734396-41734418 GCCCCACCTGCAGAGCTGCCGGG + Intergenic
1179902819 21:44402712-44402734 GCCCCACCTGGGGGGCAGCTTGG - Intronic
1180049344 21:45324201-45324223 GCCCCACCTGTGTGGGGTCCTGG - Intergenic
1180060797 21:45383894-45383916 GCCCCACCTGCAGGGCAGGCAGG - Intergenic
1180711527 22:17842480-17842502 GCCCCACCACTGAGGGGGCCTGG + Intronic
1181462563 22:23094302-23094324 GCCCCTCGTGTGGGGAGGCCTGG + Intronic
1182097722 22:27637373-27637395 CCCCCTCCTGTGGGGCCTCCTGG - Intergenic
1183256540 22:36765916-36765938 GCCCCAGCTCTGGGGTGCCCAGG - Intronic
1183457584 22:37931014-37931036 GCCCCACTGGTGGGGGTGCCTGG - Intronic
1184649600 22:45913505-45913527 TCCCCACCCCTGGGGGGGCCTGG + Intergenic
1203259844 22_KI270733v1_random:167549-167571 GACCCACCCGGGGGGCGGCGGGG + Intergenic
950116042 3:10450793-10450815 GCGGCATCTGTGGGGCTGCCAGG + Intronic
950683586 3:14601826-14601848 GCCCAACCTGGGGGGCAGACTGG + Intergenic
954145418 3:48632038-48632060 GCCCCACCTGTGGGGCGGCCAGG + Exonic
956717204 3:72088781-72088803 TCCCAGACTGTGGGGCGGCCGGG - Intergenic
962369251 3:134807094-134807116 GCCCCATCTCTGGGGTGTCCAGG + Intronic
962844220 3:139260936-139260958 GCCACACCTGTGGGGCTGTTTGG + Intronic
966743528 3:183254480-183254502 GCCGCACCTGGGCGGCGGCCCGG - Intronic
968579969 4:1385256-1385278 GCGGCCCCTGTGGGGCTGCCAGG - Intronic
968813964 4:2812314-2812336 GGCACAGCTGTGGGGCAGCCAGG + Intronic
969302150 4:6303465-6303487 GCCGTAACTGTGGGGTGGCCTGG + Intergenic
969559614 4:7939084-7939106 GCCCCACTCGCAGGGCGGCCGGG + Exonic
981161993 4:141509494-141509516 GCTCCACCTCTGGGGGGGCAGGG - Intergenic
985631419 5:1016009-1016031 GCCCTTCCTGTGGGGCTGCTGGG + Intronic
992098424 5:73382520-73382542 GCCCGGCCTTTGCGGCGGCCAGG - Intergenic
997309211 5:132866195-132866217 TCCTCTGCTGTGGGGCGGCCCGG + Intronic
999144038 5:149381005-149381027 GCCCCACTGGCCGGGCGGCCTGG + Intronic
1002164792 5:177337557-177337579 GCCCAGCCTGTGGGGCGAGCAGG + Intronic
1002494524 5:179602744-179602766 GACCCACCTGTGAGGCAGACAGG - Intronic
1004241355 6:13925067-13925089 GCCCCAGCGTTGGGGAGGCCCGG - Intronic
1018774423 6:166999663-166999685 ACCCCCTCTGTGGGGCGGGCAGG - Intronic
1018921557 6:168179395-168179417 GGACCACCTGTGGGGCCACCTGG + Intergenic
1019433509 7:1010481-1010503 GCCCTCCCTGGGGGCCGGCCCGG - Intronic
1019640106 7:2098810-2098832 GGCCCACCTCTGGGGACGCCGGG - Intronic
1020347659 7:7182773-7182795 GCCCCTCCTGGGGGGCGGAGAGG - Exonic
1023984922 7:45088821-45088843 GCCTCACCTGTGCGGGGCCCGGG + Exonic
1024473482 7:49787534-49787556 GCCCCACCCGTGGGGAGCCTGGG + Intronic
1026902284 7:74043872-74043894 GCCACAGGTGTGGGGCTGCCAGG + Exonic
1032840329 7:135708244-135708266 CCGCCACCTGTAGGGAGGCCAGG + Exonic
1033226984 7:139570267-139570289 GACCCAGCTGTGGGGCGGGGGGG + Exonic
1034441051 7:151086342-151086364 GCCCCTCCTGCGCGCCGGCCCGG - Intronic
1036654858 8:10671497-10671519 GCGCCGCCTGTGGGGTGTCCAGG - Intronic
1037730154 8:21517355-21517377 GCCCCACCTGAGAGGCTGCCTGG - Intergenic
1037906445 8:22718573-22718595 GCCCCAGCTGGGTGGCTGCCAGG + Intronic
1039961907 8:42254839-42254861 TCCCAGACTGTGGGGCGGCCGGG - Intergenic
1040296728 8:46152728-46152750 CCCCCACCTGAGGGGCTCCCGGG + Intergenic
1048306563 8:133288743-133288765 GCCCCACCTTTGGAGTGGCTTGG + Intronic
1049069357 8:140345002-140345024 GCCCAAGCAGTGGGGCGGGCAGG + Intronic
1049432511 8:142571805-142571827 GTCCCACCTGCGGGGTGTCCAGG + Intergenic
1049618277 8:143585961-143585983 GCCGCTCCTGTGGGGCCGGCTGG - Intronic
1049643431 8:143725708-143725730 GCCCCAGCGTTGGGGAGGCCAGG + Exonic
1049655594 8:143795576-143795598 GTCCCACCTCTGGGGCAGGCTGG + Intronic
1049693703 8:143973596-143973618 GCCCCGCCCGTGGGGCATCCTGG - Intronic
1049779753 8:144423507-144423529 CCCCGACCTGTGTGGTGGCCCGG - Intergenic
1055654658 9:78440368-78440390 GCCCCATCAGCGGGGTGGCCAGG - Intergenic
1057921931 9:99104971-99104993 GCCCCGCCTGCGGGCCCGCCAGG - Intronic
1060889535 9:127179319-127179341 GCTGCAGCTGTGGGGTGGCCTGG + Intronic
1061682349 9:132249257-132249279 GCCGCCCCTGTGGGGCAGCAAGG - Intergenic
1061954502 9:133954610-133954632 CACACACCTGTGGGGCGGGCGGG + Intronic
1062035001 9:134379095-134379117 GCCCAGCCTGTGGGGCCACCCGG + Intronic
1062104112 9:134743477-134743499 GTCCCACCTGCTGGGGGGCCTGG + Intronic
1062609382 9:137367165-137367187 GCCCCACAGGTGAGGCTGCCTGG + Intronic
1185457972 X:319936-319958 GACCCACCTGGGCGGCGACCGGG - Intergenic
1196340231 X:114586297-114586319 CCCCCACCTGTGGGGTGGAATGG - Intronic
1198583689 X:138096185-138096207 GCCCCGCCACTGGGGAGGCCAGG - Intergenic