ID: 954145537

View in Genome Browser
Species Human (GRCh38)
Location 3:48632625-48632647
Sequence CAGTAGACACAGGTGGGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 228}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954145537_954145552 16 Left 954145537 3:48632625-48632647 CCCTGTCCCACCTGTGTCTACTG 0: 1
1: 0
2: 1
3: 21
4: 228
Right 954145552 3:48632664-48632686 GCTCTCTGTGGAGTAGGGAAGGG 0: 1
1: 2
2: 2
3: 35
4: 293
954145537_954145556 27 Left 954145537 3:48632625-48632647 CCCTGTCCCACCTGTGTCTACTG 0: 1
1: 0
2: 1
3: 21
4: 228
Right 954145556 3:48632675-48632697 AGTAGGGAAGGGGTCAGGGCTGG 0: 1
1: 0
2: 3
3: 68
4: 696
954145537_954145550 11 Left 954145537 3:48632625-48632647 CCCTGTCCCACCTGTGTCTACTG 0: 1
1: 0
2: 1
3: 21
4: 228
Right 954145550 3:48632659-48632681 CAGAGGCTCTCTGTGGAGTAGGG 0: 1
1: 0
2: 0
3: 12
4: 242
954145537_954145551 15 Left 954145537 3:48632625-48632647 CCCTGTCCCACCTGTGTCTACTG 0: 1
1: 0
2: 1
3: 21
4: 228
Right 954145551 3:48632663-48632685 GGCTCTCTGTGGAGTAGGGAAGG 0: 1
1: 0
2: 2
3: 20
4: 283
954145537_954145553 17 Left 954145537 3:48632625-48632647 CCCTGTCCCACCTGTGTCTACTG 0: 1
1: 0
2: 1
3: 21
4: 228
Right 954145553 3:48632665-48632687 CTCTCTGTGGAGTAGGGAAGGGG 0: 1
1: 1
2: 4
3: 47
4: 735
954145537_954145545 -6 Left 954145537 3:48632625-48632647 CCCTGTCCCACCTGTGTCTACTG 0: 1
1: 0
2: 1
3: 21
4: 228
Right 954145545 3:48632642-48632664 CTACTGGTCCCGGGACACAGAGG 0: 1
1: 0
2: 0
3: 9
4: 109
954145537_954145549 10 Left 954145537 3:48632625-48632647 CCCTGTCCCACCTGTGTCTACTG 0: 1
1: 0
2: 1
3: 21
4: 228
Right 954145549 3:48632658-48632680 ACAGAGGCTCTCTGTGGAGTAGG 0: 1
1: 0
2: 0
3: 24
4: 264
954145537_954145554 22 Left 954145537 3:48632625-48632647 CCCTGTCCCACCTGTGTCTACTG 0: 1
1: 0
2: 1
3: 21
4: 228
Right 954145554 3:48632670-48632692 TGTGGAGTAGGGAAGGGGTCAGG 0: 1
1: 0
2: 4
3: 64
4: 618
954145537_954145555 23 Left 954145537 3:48632625-48632647 CCCTGTCCCACCTGTGTCTACTG 0: 1
1: 0
2: 1
3: 21
4: 228
Right 954145555 3:48632671-48632693 GTGGAGTAGGGAAGGGGTCAGGG 0: 1
1: 0
2: 6
3: 51
4: 607
954145537_954145548 4 Left 954145537 3:48632625-48632647 CCCTGTCCCACCTGTGTCTACTG 0: 1
1: 0
2: 1
3: 21
4: 228
Right 954145548 3:48632652-48632674 CGGGACACAGAGGCTCTCTGTGG 0: 1
1: 0
2: 1
3: 27
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954145537 Original CRISPR CAGTAGACACAGGTGGGACA GGG (reversed) Intronic
900466975 1:2830477-2830499 CAGTAGACTCACGTGGCCCATGG - Intergenic
900618260 1:3575219-3575241 CAGCGCACACAGGTGGGACCCGG + Intronic
901336675 1:8455118-8455140 CAGCAGAGCCAGGAGGGACACGG + Intronic
901435970 1:9247623-9247645 CAGAAGAGACAGGGTGGACAAGG - Intronic
901789304 1:11646086-11646108 CAGTCCAGTCAGGTGGGACAGGG - Intergenic
902585456 1:17436567-17436589 CTGGAGACAGAGGTGGGCCAGGG + Intronic
902615563 1:17621736-17621758 CAGTGGTCCCAGGTGGGACCTGG + Intronic
903273666 1:22207760-22207782 CAGGAGAGAGAGGTGGGAAAGGG - Intergenic
903932953 1:26874423-26874445 CAGTAGGCTGAGGTGGGAGATGG + Intergenic
904260480 1:29284886-29284908 TAGAAGCCACTGGTGGGACAGGG - Intronic
905510885 1:38518860-38518882 TAGTAGACACTGGGGAGACAAGG + Intergenic
905806226 1:40879703-40879725 CAGTAGCCACATGTGGCTCATGG + Intergenic
906725854 1:48043690-48043712 ACATAGACACAGGTAGGACATGG - Intergenic
909603990 1:77490332-77490354 CAGTAGTCACAGGTGGGAGCAGG + Intronic
909702737 1:78545326-78545348 CAGGAGACTGAGGTGGGAGATGG - Intergenic
909823940 1:80101567-80101589 CAGGAGACAAAGGTGGGACTAGG - Intergenic
910108570 1:83657712-83657734 CAGTAGACACAAGTGGGTCCTGG + Intergenic
910196212 1:84642268-84642290 CTGTAGCTACAGTTGGGACACGG + Intergenic
911050286 1:93665191-93665213 CTGTAGACAGAGGAGGTACATGG - Intronic
911791200 1:102017365-102017387 CACAAGATACATGTGGGACACGG + Intergenic
913137423 1:115906183-115906205 CAGGACCCAAAGGTGGGACATGG + Intergenic
914220764 1:145679978-145680000 AAGTAGACAGAGCTGGGATAAGG - Intronic
914239991 1:145846804-145846826 CAGATGACACAGCAGGGACATGG - Intronic
914473339 1:148002851-148002873 AAGTAGACAGAGCTGGGATAAGG - Intergenic
915141655 1:153771952-153771974 CAAGAGACAGAGGTGGGACACGG + Exonic
915700919 1:157795888-157795910 TAATAGACACAGGAGTGACAGGG - Exonic
916015987 1:160750328-160750350 CAGGAGACACAGGAGGACCATGG - Exonic
918861515 1:189832249-189832271 CACTAGACACAGTTGGTAGATGG - Intergenic
919502158 1:198350586-198350608 CAGTAGACAGGGGAGGGTCAAGG - Intergenic
920761202 1:208785158-208785180 CAGTAGACACAGGAGTGATATGG + Intergenic
921557557 1:216616758-216616780 CATTAGACACAGGAGATACAGGG + Intronic
923140727 1:231160362-231160384 CAGTAGCCACAGATGGGAGATGG - Intergenic
1063034458 10:2271717-2271739 GAGTAGACACAGCTTGGCCAAGG + Intergenic
1064771028 10:18722981-18723003 CTCCACACACAGGTGGGACAAGG + Intergenic
1067102396 10:43342822-43342844 CAGCAGGCACTGGGGGGACAGGG - Intergenic
1067287075 10:44914520-44914542 AAGCAGACACAGCTGGGAAATGG + Intronic
1068566234 10:58578789-58578811 CTGCACACACAGGTGGGAGAGGG - Intronic
1069292580 10:66799600-66799622 CATTAGAGAAATGTGGGACACGG + Intronic
1069838805 10:71326597-71326619 CAGTGGACAGAGGAGGGGCAGGG - Intronic
1070268759 10:74931307-74931329 CAGTAGACACGGGTGGAAAGGGG - Intronic
1070606967 10:77905526-77905548 TAGTTGACACAGCAGGGACAAGG - Intronic
1072866648 10:99068994-99069016 CAGTAAAGACAGCTGGGACTTGG - Intronic
1072958604 10:99908942-99908964 CAGCAGGCACAGGTGGGAACTGG - Exonic
1073440003 10:103546927-103546949 CAGGACACAGAGGTGGGAAATGG - Intronic
1073848897 10:107591620-107591642 CAGAAGACATAGGGAGGACAGGG + Intergenic
1074688927 10:115985970-115985992 CAGTAGAAAGAGGTGGCAAAAGG + Intergenic
1074962616 10:118461732-118461754 CAGTAGAGACTGGTAGGACATGG + Intergenic
1075159565 10:120011491-120011513 CAGGTGGCACAGGAGGGACAAGG + Intergenic
1076271370 10:129155193-129155215 CAGGAGAAGCAGGTGGAACAAGG + Intergenic
1076816962 10:132919811-132919833 CAGCAGTGACAGGCGGGACAGGG + Intronic
1085311182 11:75517834-75517856 CAGTTCTCCCAGGTGGGACAGGG + Intronic
1085591728 11:77768909-77768931 CAGTAGACACATGTGGCTAATGG - Intronic
1085693807 11:78687138-78687160 CAGTTCACACAGGTGGGAACTGG + Intronic
1088596020 11:111440852-111440874 CAGAAGTCAGAGGTGGGTCATGG + Intronic
1090030577 11:123202737-123202759 TGGCAGAAACAGGTGGGACAGGG + Intergenic
1090820167 11:130334977-130334999 CAGGAGGCACAGCTGGGCCAGGG + Intergenic
1090928552 11:131274798-131274820 CAGTGGACACAGGATGGCCAAGG + Intergenic
1091218283 11:133916812-133916834 GAGGAGTCACAGCTGGGACAGGG + Intronic
1091466854 12:692255-692277 CAGGAGGCACAGCTGGGCCAGGG + Intergenic
1092257880 12:6937064-6937086 CCGTAGGCACCGGTGGGAAAGGG - Exonic
1092590296 12:9947052-9947074 CATTAGTCACAGATGGGAAAGGG - Intergenic
1095719859 12:45388533-45388555 CAGTAGACACAGGAGATAAATGG + Intronic
1095796241 12:46221930-46221952 CAGAAGACAGAGATGAGACAGGG + Intronic
1096088123 12:48880004-48880026 CAGAAGACACAGGTGATACAGGG - Intergenic
1096876988 12:54637091-54637113 TGGGAGACACAGGTGGGAGATGG + Intergenic
1096908234 12:54956258-54956280 CAGAAGAGACAGGAGGGACTAGG - Intronic
1100401703 12:94236316-94236338 CAGCACACACAGGTGCTACACGG - Intronic
1100402865 12:94247357-94247379 CACTAGACACAAGGAGGACAAGG - Intronic
1101614863 12:106326326-106326348 AAGGAGACTCAGGTGGGCCATGG + Intronic
1103247423 12:119470164-119470186 CAGTAGAACAAAGTGGGACATGG - Intronic
1106415269 13:29541048-29541070 CTGCAGCCACAGGTGGGAGAAGG + Intronic
1113186163 13:107687826-107687848 CAGTAGCCACATGTAGCACATGG + Intronic
1113707902 13:112446027-112446049 CAGTGGTCAGAGGTGGGGCAGGG + Intergenic
1118037148 14:61880054-61880076 CTGCAGACAGAGGTGGGAAATGG - Intergenic
1119401274 14:74364282-74364304 CAGTAGCCTCAGGTGTGACCTGG - Intergenic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1120256936 14:82132496-82132518 CAGAAAAAACAGGAGGGACAAGG - Intergenic
1120854567 14:89201577-89201599 CAGAAGCCAGAGGTGGGACCAGG + Intronic
1121010809 14:90519048-90519070 CAGAAGACACAGAAGGCACAGGG - Intergenic
1122272991 14:100576655-100576677 CAGGGGACACAGATGGTACAGGG + Intronic
1125577652 15:40766393-40766415 CAGTAGTCACAGTTTAGACATGG - Exonic
1126509555 15:49453525-49453547 CAGTAGCCACATGTGGCACATGG + Intronic
1126902339 15:53327143-53327165 GAGGAGACAAATGTGGGACATGG + Intergenic
1127695390 15:61441833-61441855 CAGCATAGAAAGGTGGGACAAGG - Intergenic
1128146071 15:65333154-65333176 CAGGAGACTGGGGTGGGACAGGG + Intronic
1128257973 15:66212309-66212331 CAGCACACAGAGGTGGGACTTGG + Intronic
1130106726 15:80934356-80934378 CAGTGGCCACATGAGGGACAGGG + Intronic
1130886445 15:88096477-88096499 CAGGAGACTCAGGTGGGCCAGGG - Intronic
1131125006 15:89852555-89852577 CAGAAGACACAGGTAGGATCGGG - Intronic
1131522483 15:93126900-93126922 CAGTGGACACAGCTGGAGCAGGG + Intergenic
1131666058 15:94572260-94572282 CAGTGGAGGCAGGTGGCACAGGG - Intergenic
1132484678 16:184438-184460 CAGGAGGCAAAGGTGGTACAAGG + Intergenic
1133703034 16:8326693-8326715 TAGTAGACACAGGTGGCAGGAGG - Intergenic
1136280241 16:29204105-29204127 CAGCAGCCACAAGTGGGACTCGG - Intergenic
1139458727 16:67105369-67105391 CAGTACACAGTGGTGGGACAGGG + Intergenic
1140808484 16:78554849-78554871 CTGAAGACAGAGGTGGGACCTGG + Intronic
1141305367 16:82857864-82857886 CAGTAGCCACCGGTGGTTCATGG + Intronic
1143138469 17:4726002-4726024 CCATAGACACAGGTAGGAGAGGG - Intergenic
1143437609 17:6940702-6940724 TAATAGACAGTGGTGGGACAGGG + Intronic
1144947526 17:18977573-18977595 AAGGAGGCACAGGTGGGTCAGGG - Exonic
1147418795 17:40311797-40311819 CAGGAATCCCAGGTGGGACAGGG + Intronic
1150852269 17:68714971-68714993 CAGTAGTCACAGGGGGGACACGG - Intergenic
1151455834 17:74225342-74225364 CAGAAGACACAGGGGGCAGATGG + Intronic
1151517136 17:74603904-74603926 CAGCAGACACAGCTGGGCCTGGG + Intergenic
1155545906 18:26914648-26914670 TAGGAGACACAGATGGGACACGG + Exonic
1155835750 18:30581944-30581966 CACTAGAAACAGGAGGGTCATGG - Intergenic
1155981969 18:32189488-32189510 AAGCAAACACTGGTGGGACATGG - Intronic
1157619553 18:49008484-49008506 CAGGGGACCCAGGTGGGGCAGGG - Intergenic
1160920060 19:1515390-1515412 CAGAGGACAGAGGTGGGAGACGG - Intergenic
1161615307 19:5266878-5266900 CAGTAGACAGATGTGGGAACGGG - Intronic
1162123554 19:8486856-8486878 TAATAGATACATGTGGGACAAGG - Intronic
1162387006 19:10365679-10365701 CAGCAGCCTCAGGTGGCACACGG + Exonic
1163741806 19:19018878-19018900 CTGTAGTCACAGGTGAGAGAAGG + Intronic
1167276079 19:48540492-48540514 CAGTAGGCACAGGTGGGGAAGGG - Intergenic
1167522152 19:49961318-49961340 CAGGGGACACAGGTGAGTCACGG + Intergenic
1167523229 19:49969407-49969429 CAGGGGACACAGGTGAGTCATGG - Intergenic
925641113 2:5986661-5986683 CAGCAGACACGGGTGGGAGAGGG - Intergenic
926002214 2:9342839-9342861 CAGAAGACACAGGGAGGTCACGG - Intronic
927842637 2:26455265-26455287 CGGGAGACACGGGTGGGGCAGGG + Intronic
928103666 2:28453766-28453788 CTGTGGACAGAGGTGGGCCAGGG + Intergenic
929933565 2:46277033-46277055 AAGTAGAAACGGGTGGGAAATGG - Intergenic
931124244 2:59256139-59256161 CAGTAGAAACAGTTGCTACATGG + Intergenic
931931570 2:67142822-67142844 AAATACTCACAGGTGGGACAAGG + Intergenic
932065301 2:68551495-68551517 TAGAAGAAACATGTGGGACATGG - Intronic
934087315 2:88520672-88520694 CAGCAGAGCCAGGAGGGACAAGG - Intergenic
938199014 2:129357648-129357670 CTGTAGACTGATGTGGGACAGGG + Intergenic
938267188 2:129936441-129936463 CAGAAGGGACAGGAGGGACAGGG + Intergenic
938553006 2:132398017-132398039 AAGCAGACACAGATGAGACATGG - Intergenic
938732699 2:134158703-134158725 GGGGAGGCACAGGTGGGACAGGG - Intronic
940124920 2:150311993-150312015 CAGGAGGCACAGGAGGCACAGGG - Intergenic
940847297 2:158655933-158655955 CAGAAGACAGAGTTGGGTCAAGG - Intronic
942037005 2:172019916-172019938 CAGTAGGTATAGGTGAGACATGG + Intronic
944026761 2:195179741-195179763 CAGTAGACAGAGGAGAGAGAAGG + Intergenic
945960506 2:216129362-216129384 CAGTATACACATGTGGGCAAAGG + Intronic
947219965 2:227782462-227782484 CAGTAGACAACCATGGGACAAGG - Intergenic
948995079 2:241573914-241573936 CAGGAGATACAGGCTGGACATGG + Exonic
1169099969 20:2939052-2939074 CAGTCGACAAAAGTGGGACAGGG - Intronic
1169463693 20:5819150-5819172 AAGTAGACACTGGCGGGGCACGG - Intronic
1170002200 20:11627130-11627152 TAGTAGACACTGGGGGGACCAGG - Intergenic
1171451165 20:25237137-25237159 CAGTAGCCACAGGTTGGAAGAGG + Intergenic
1172627947 20:36359341-36359363 CAGTAGCCACACGTGGCTCACGG + Intronic
1174449417 20:50610165-50610187 CAGGAGAGGCAGGTGAGACAGGG - Intronic
1174449429 20:50610210-50610232 CAGGAGAGGCAGGTGAGACAGGG - Intronic
1175626063 20:60489162-60489184 GAGTGGACACAGATGTGACATGG + Intergenic
1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG + Intronic
1176191991 20:63815905-63815927 CAGTGGACACAGGTGGGCACAGG + Intronic
1177957869 21:27623321-27623343 CATAAGACACAGGTGTGAGAAGG + Intergenic
1179680913 21:43020777-43020799 CAGGAGGCACAGGTGGGAACAGG + Intronic
1180792821 22:18586009-18586031 CACCAGGCACAGGTGGGAGAAGG - Intergenic
1181010127 22:20035392-20035414 CAGTGCTCACAGCTGGGACATGG - Intronic
1181228915 22:21409310-21409332 CACCAGGCACAGGTGGGAGAAGG + Intergenic
1181249736 22:21525555-21525577 CACCAGGCACAGGTGGGAGAAGG - Intergenic
1181360603 22:22331177-22331199 CAGTAGTCACCTGTGTGACAGGG - Intergenic
1181849161 22:25737453-25737475 CAGAAGACACAGTTGGGTCAGGG + Intergenic
1182828978 22:33289535-33289557 CAGTAGGCTCAGCTGTGACAGGG - Intronic
1183690115 22:39383528-39383550 CAGTGGACACTGGGTGGACAGGG - Exonic
1184615724 22:45637020-45637042 CAGAAGACAGAGGTGGAGCAGGG - Intergenic
1184658274 22:45952923-45952945 CAGCAGACACAGCTGGGAGGCGG - Intronic
949097418 3:101839-101861 CAGTAGTCACATGTGACACAAGG + Intergenic
950668984 3:14513936-14513958 GAGGATACACAGGTGGGCCAGGG - Intronic
950739427 3:15038164-15038186 CAGTAGATACAGGTGGAAAGGGG - Intronic
953706336 3:45233843-45233865 CAGGAGACTCAGGTGTGAGATGG + Intergenic
953981476 3:47415271-47415293 AAGAAGGCACAGGAGGGACATGG + Intronic
954145537 3:48632625-48632647 CAGTAGACACAGGTGGGACAGGG - Intronic
954221662 3:49158647-49158669 GAGTGGGCACCGGTGGGACAGGG - Intergenic
955748259 3:62161702-62161724 CTGTAGCCACAGGAGGGGCATGG + Intronic
955918692 3:63931877-63931899 AAGTAGACACAGGAAGGACGAGG + Intronic
957157550 3:76564695-76564717 CAGTACACACAGGTGGGGACAGG + Intronic
958832638 3:99108194-99108216 AAGGAGACACAGGGGGAACAAGG - Intergenic
961487816 3:127229459-127229481 CAGTAGACTGAGGGGTGACATGG - Intergenic
963103019 3:141623621-141623643 CAGCAGCCACAGGCGGGCCAAGG - Intergenic
966396504 3:179509583-179509605 CTGCAAACCCAGGTGGGACAGGG - Intergenic
967451772 3:189632377-189632399 CAACAGACACAGGTGGTAAATGG - Intronic
967788216 3:193520163-193520185 AAGGAGACAAAGGTGGGAAAGGG + Intronic
968548932 4:1212684-1212706 CAGTGGACACAGGAGTGCCATGG - Intronic
969656985 4:8504244-8504266 CAGGAGACTTAGGTGGGCCATGG - Intergenic
969709817 4:8836269-8836291 CAGGAAACACAGGTGGGGAATGG - Intergenic
969931984 4:10639726-10639748 CAGTAGCCACATGTGGCAAACGG + Intronic
971849340 4:31963079-31963101 TAGAAGACAAAGGTGGGAGAAGG - Intergenic
972469306 4:39388393-39388415 AAAAAGACACAGGTGGGAAAAGG + Intergenic
973623844 4:52751735-52751757 CAGTGGACACAGGTGGCCAATGG - Intergenic
975306939 4:72860680-72860702 CAGTAGACACAGCAGGCAGATGG - Intergenic
975818497 4:78244882-78244904 CAGAAGACTCAGGTGGGGGATGG - Intronic
975822198 4:78282974-78282996 CAGTAGAAACAGAGGAGACATGG - Intronic
977105411 4:92876758-92876780 CAGAACACACAGGGAGGACAGGG + Intronic
980213540 4:129821292-129821314 CAGTAGACACCAGTAGGAGAGGG + Intergenic
980784419 4:137533449-137533471 CAGTGAATACAGGGGGGACATGG + Intergenic
984432367 4:179665199-179665221 GAGTAGTAACAGGTGGCACATGG - Intergenic
985636311 5:1037554-1037576 CAGGACACACAGTGGGGACAAGG + Intronic
986450788 5:7862337-7862359 CAGTAGCCACATGTGGCTCATGG - Intronic
986524018 5:8653233-8653255 GAGTACACACATGTAGGACAGGG + Intergenic
988576745 5:32433192-32433214 CAGTGGACGCAGATGGGAAATGG - Intronic
989992723 5:50787005-50787027 CAGGAGACACAGGTTTGAAAAGG - Intronic
990267299 5:54091498-54091520 CAGTAAGCAAAGGTGGGGCATGG + Intronic
991623811 5:68576014-68576036 AAGTAGAAACAGGTGGGGCATGG - Intergenic
996975380 5:129427072-129427094 CAGTTTACACAGGTGGGAAGTGG + Intergenic
999665785 5:153911405-153911427 CAGTAGCCATAGGTGGGGAAGGG - Intergenic
1004881293 6:20011013-20011035 CAGAAGAAACACGTGTGACAGGG - Intergenic
1005670280 6:28098914-28098936 CAGGAGATACAGCTGGGCCAGGG - Intergenic
1007902332 6:45423156-45423178 CAGCGGGCACAGGTGGGAGAGGG - Intronic
1008389084 6:50928524-50928546 GAGAAGATACAGGTGGGGCAAGG - Intergenic
1010841951 6:80657117-80657139 CAATAGACTCAGGAGGGAAAGGG + Intergenic
1011594140 6:88999942-88999964 CAGGAGATACAGCTGGGTCAGGG - Intergenic
1014796061 6:125725597-125725619 CAGCAGACAGAGCTGGGAAATGG - Intergenic
1016873171 6:148838721-148838743 CTGTAGAGACAGGGGTGACAGGG - Intronic
1016896175 6:149055542-149055564 CATTAGAGACAGGTGGGGGAGGG - Intronic
1017045365 6:150342244-150342266 CAGAAGGCACAGTTGGGTCAGGG + Intergenic
1017742385 6:157418177-157418199 CATAAGACACGCGTGGGACAGGG - Intronic
1018985504 6:168633647-168633669 CAGGAGACACAGAAGGGCCAAGG + Intronic
1020187509 7:5970425-5970447 CCGTAGACACAGGAGAGAGATGG - Intronic
1020295407 7:6754345-6754367 CCGTAGACACAGGAGAGAGATGG + Intronic
1021638687 7:22717010-22717032 TATTAGACAGAGGTGGGGCAAGG - Intergenic
1022303802 7:29127641-29127663 CAGGAGAAAAAGGTGGGAAAAGG - Intronic
1022598991 7:31738773-31738795 CAGGTGACACAGGTGGCACCTGG - Intergenic
1022741210 7:33123265-33123287 CAGTGGACTCAGGGGGCACATGG - Intergenic
1022802875 7:33792574-33792596 CAGTACACTGTGGTGGGACAGGG + Intergenic
1023458702 7:40369700-40369722 CAGTTGACATGGGTGGGAAATGG + Intronic
1026738009 7:72961037-72961059 AAGCAGACACAGGTGGCACAGGG + Intronic
1026789046 7:73319832-73319854 AAGCAGACACAGGTGGCACAGGG + Intronic
1027105725 7:75404031-75404053 AAGCAGACACAGGTGGCACAGGG - Intronic
1031164803 7:118214985-118215007 CTGAAAACACAGCTGGGACATGG - Intronic
1033977355 7:147117598-147117620 CAAGAGAAACAGGTGAGACAGGG - Intronic
1034293180 7:149948408-149948430 CAGAAGAGGCAGGTGGGACTTGG + Intergenic
1034498091 7:151433807-151433829 CAGTAGCCACAGCCAGGACAGGG - Intronic
1034812894 7:154148471-154148493 CAGAAGAGGCAGGTGGGACTTGG - Intronic
1035247534 7:157573621-157573643 CAGTAGACAGCGGTGGCTCATGG + Intronic
1035377629 7:158415920-158415942 CAGCAGACACAGGGGTGGCAGGG - Intronic
1035485665 7:159223213-159223235 CAGTAGGCACAGTTAGGGCAGGG + Intergenic
1037516633 8:19638269-19638291 CAGCAGACACAGTTGAGGCAGGG - Intronic
1037650931 8:20837947-20837969 CATTTGACACAGGAGGGACCTGG - Intergenic
1038134285 8:24768838-24768860 CAGCTGTCAGAGGTGGGACAGGG + Intergenic
1038779211 8:30556504-30556526 CAGGAGACACAGGAGGGGGAGGG - Intronic
1039477057 8:37844618-37844640 CAGTGGAGACAGGGGGTACAGGG + Exonic
1045455930 8:102378869-102378891 CAGTAGATACAGGGGGGTTAGGG + Intronic
1048528367 8:135225218-135225240 CATTAGACCCAGGTGGCAAATGG - Intergenic
1049311490 8:141936073-141936095 CAGGAGACCCAGGAGGGACCAGG - Intergenic
1052553797 9:29986672-29986694 CAGTGGACACTGATGGGAGAGGG + Intergenic
1057198567 9:93128425-93128447 AAGTGGACAGTGGTGGGACAGGG - Intronic
1057317450 9:93978921-93978943 CAGGACACACAAGTGAGACAGGG + Intergenic
1060766614 9:126298718-126298740 CAGTAGAAACAGCTGGAGCAAGG - Intergenic
1060799054 9:126532237-126532259 CAGAAGCCACAGGAGGGCCAGGG - Intergenic
1060891987 9:127194954-127194976 CAGCTGTCACAGGTGGGGCAAGG - Intronic
1061406719 9:130396302-130396324 CAGGAGCCCCAGGTGGGAGAGGG + Intronic
1186199232 X:7139544-7139566 CAGCTGACACAAGTGGGAGAGGG + Intronic
1187312621 X:18160240-18160262 CAGCAGACAAGGGTGGGACTAGG - Intergenic
1188170062 X:26912678-26912700 CACTAGAAACAGGTGATACAAGG - Intergenic
1189991762 X:46602504-46602526 CAGTAGCTTCAGGTGGGACCTGG - Intronic
1196075470 X:111570921-111570943 CAGGAGGCACAGCTGGGTCAGGG - Intergenic
1196176675 X:112646176-112646198 CTGAAGACTCTGGTGGGACAGGG + Intronic
1197889549 X:131255590-131255612 CAGGAGAAACAGGTGGTATATGG - Intergenic
1199173667 X:144759230-144759252 CTCTAGACACATGTGGGACCAGG + Intergenic