ID: 954145705

View in Genome Browser
Species Human (GRCh38)
Location 3:48633326-48633348
Sequence GGGGTAACCAGACCAAAACC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 104}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954145695_954145705 20 Left 954145695 3:48633283-48633305 CCGGATAACAGGTCACCCAGGAG 0: 1
1: 0
2: 0
3: 8
4: 107
Right 954145705 3:48633326-48633348 GGGGTAACCAGACCAAAACCGGG 0: 1
1: 0
2: 0
3: 6
4: 104
954145696_954145705 5 Left 954145696 3:48633298-48633320 CCCAGGAGCCAGTCACGCACAGG 0: 1
1: 1
2: 0
3: 16
4: 174
Right 954145705 3:48633326-48633348 GGGGTAACCAGACCAAAACCGGG 0: 1
1: 0
2: 0
3: 6
4: 104
954145698_954145705 4 Left 954145698 3:48633299-48633321 CCAGGAGCCAGTCACGCACAGGA 0: 1
1: 1
2: 1
3: 12
4: 127
Right 954145705 3:48633326-48633348 GGGGTAACCAGACCAAAACCGGG 0: 1
1: 0
2: 0
3: 6
4: 104
954145700_954145705 -3 Left 954145700 3:48633306-48633328 CCAGTCACGCACAGGATACCGGG 0: 1
1: 0
2: 0
3: 2
4: 31
Right 954145705 3:48633326-48633348 GGGGTAACCAGACCAAAACCGGG 0: 1
1: 0
2: 0
3: 6
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954145705 Original CRISPR GGGGTAACCAGACCAAAACC GGG Exonic
901973401 1:12925767-12925789 GGGGCAACAAGAGCAAAACTCGG + Intronic
902011778 1:13275996-13276018 GGGGCAACAAGAGCAAAACTCGG - Intergenic
904214731 1:28910535-28910557 GGGGAAACCATACCCAAATCTGG - Intronic
904814298 1:33183457-33183479 GGGGCCACCTGACCAAAATCAGG - Intergenic
906224736 1:44112342-44112364 GGAGTAACCAGTCCTGAACCTGG - Intergenic
914930780 1:151930918-151930940 GGGAGAACCTGACCAAAAGCGGG - Intergenic
916124621 1:161558244-161558266 CGGGTAGCCAGGCCCAAACCAGG + Intergenic
919107041 1:193166671-193166693 GGGGCAACAAGAGCAAAACTCGG - Intronic
919931591 1:202224778-202224800 GGGGGCAGCAGACCAAAACCAGG - Intronic
922330982 1:224575177-224575199 TGGGGAACCAGATCAGAACCTGG - Intronic
924556527 1:245123662-245123684 TGGGAAACCAGATCAGAACCTGG + Intronic
1064942418 10:20749681-20749703 GTGGGAACAAAACCAAAACCAGG + Intergenic
1066368839 10:34802574-34802596 GGGGGGCCCAAACCAAAACCTGG + Intronic
1068806119 10:61195721-61195743 AGGGGAACAAGAACAAAACCTGG - Intergenic
1069832756 10:71291168-71291190 GTGGTACCCAGACCAGAGCCAGG + Intronic
1070091447 10:73289614-73289636 AGAGTAACAAAACCAAAACCTGG + Intronic
1070255828 10:74812509-74812531 TGGGTAACAAGAGCAAAACTCGG + Intergenic
1071268556 10:83985916-83985938 GGGGTAAAAAGGGCAAAACCGGG - Intergenic
1072896426 10:99371280-99371302 TGGTTAACCACACCACAACCTGG - Intronic
1075290198 10:121222827-121222849 GTGGTAAACTGACCAAAACCAGG - Intergenic
1081299447 11:41432771-41432793 GGTGTAATGAGACCAAAATCAGG + Intronic
1089194929 11:116688669-116688691 GAGGTAACCAAATCAAAATCAGG + Intergenic
1089535849 11:119160482-119160504 GGGGTGACCAGGACAAACCCAGG - Intronic
1097264961 12:57739224-57739246 GCGGTAAACAGAGCAAACCCAGG + Intronic
1098215230 12:68209159-68209181 GGGGTAATCAGACCCAACACCGG + Intronic
1100362234 12:93889557-93889579 GGGGTAGACAGGCCAACACCAGG - Intronic
1101338540 12:103819662-103819684 GGGATAAGCAGACGAAAAGCTGG - Intronic
1106280731 13:28267091-28267113 GTGTTAACAAGACGAAAACCTGG - Exonic
1106380638 13:29235118-29235140 TGGGCAACAAGAGCAAAACCAGG - Intronic
1110619312 13:77577588-77577610 AGGGAAATCAGATCAAAACCTGG - Intronic
1112975141 13:105308578-105308600 GGGTTAACCACCCCAAAATCTGG + Intergenic
1113000871 13:105634817-105634839 GGGTTAAACTGACAAAAACCAGG + Intergenic
1116801878 14:49452178-49452200 GTGGGAACCAGTCCAAGACCTGG - Intergenic
1116938677 14:50769276-50769298 GTGGTACCCAGATCTAAACCAGG + Intronic
1118783580 14:69026965-69026987 GGACTAACCAGCCCAAACCCAGG - Intergenic
1120725408 14:87934027-87934049 GTGGTTACAAGACCAAAACTTGG + Exonic
1121305305 14:92902919-92902941 GTGGAAACCCGACCCAAACCCGG + Intergenic
1128020645 15:64387524-64387546 GGGGAAAACAAACCAATACCCGG - Intronic
1128631445 15:69272545-69272567 GGAGTAACCTGAGCAAAAACAGG + Intergenic
1130714045 15:86314253-86314275 GGAGTTACCACACCTAAACCAGG + Intronic
1133461243 16:5988468-5988490 GTGGTAACCAGACCTAAGACAGG - Intergenic
1134327387 16:13219562-13219584 AAGGTAATCAGAGCAAAACCTGG - Intronic
1135831618 16:25779214-25779236 TGGGTCACCAAACCAAAATCAGG + Intronic
1136519983 16:30789018-30789040 TGGGCAACAAGACCAAAACTCGG + Intergenic
1148173987 17:45548555-45548577 GGGGTAACAAATCCAACACCAGG - Intergenic
1148275280 17:46296892-46296914 GGGGTAACAAATCCAACACCAGG + Exonic
1148297386 17:46514471-46514493 GGGGTAACAAATCCAACACCAGG + Exonic
1148361940 17:47018951-47018973 GGGGTAACAAATCCAACACCAGG + Intronic
1150405201 17:64895477-64895499 GGGGTAACAAATCCAACACCAGG - Exonic
1155650897 18:28140281-28140303 AGAGTAACCAGACAAAAAACAGG + Intronic
927601234 2:24443417-24443439 TGCGTAACAAGAACAAAACCTGG - Intergenic
932050001 2:68388951-68388973 GGCATGACAAGACCAAAACCTGG + Intronic
932068331 2:68590240-68590262 GGGGTAAACAGCCCAAAGACAGG + Intronic
940010291 2:149047173-149047195 GGCGTTGCCAGACCAAAACTTGG - Intronic
944236951 2:197449645-197449667 TGGGTAACAAGAGCAAAACGCGG - Intergenic
944244584 2:197518115-197518137 TGGGTAACAAGAGCAAAACTCGG + Intronic
947561207 2:231154087-231154109 GGGGCAACAAGAGCAAAACTCGG + Intronic
1173305580 20:41844908-41844930 GGGGTAACCTGCCCCAAACCAGG - Intergenic
1175861147 20:62151146-62151168 GGGGCTACCAGGCAAAAACCTGG - Intronic
1177895569 21:26852972-26852994 GTGATAGCCAAACCAAAACCAGG + Intergenic
1178755567 21:35346010-35346032 GAGGTACCCAGACTCAAACCAGG - Intronic
1181363627 22:22357500-22357522 GGGGTAATCAGAGCAGAACCAGG + Intergenic
1181418826 22:22782308-22782330 TGGGCAACCAGAGCAAAACTTGG + Intronic
1181466037 22:23111176-23111198 GGGGCAGACAGACAAAAACCAGG - Intronic
1181654105 22:24280985-24281007 GGGGTAAACAAACCACAATCCGG - Intronic
1182088184 22:27575808-27575830 GGGTGAAACAGACCAAAGCCCGG + Intergenic
1183721503 22:39565361-39565383 GGAGTAAGCAGACCAGAACTGGG + Intergenic
1184598960 22:45531592-45531614 GGGTAAACCAAAGCAAAACCTGG - Intronic
950496169 3:13335756-13335778 GGGGTTAGCAGACCCAACCCAGG - Intronic
952075781 3:29695973-29695995 GGGGTCACTAAACCAAGACCAGG + Intronic
954145705 3:48633326-48633348 GGGGTAACCAGACCAAAACCGGG + Exonic
956777220 3:72575334-72575356 GGGGAAAACAAACAAAAACCAGG + Intergenic
957377374 3:79375926-79375948 GTGGTACTCAGACCCAAACCTGG - Intronic
958581448 3:96030931-96030953 GGGGTAATCAGACAACTACCTGG + Intergenic
960867814 3:122219612-122219634 GTGGTAACCAGTTCAGAACCTGG + Intronic
966379325 3:179327164-179327186 TGGGTAACAAGAGCAAAACTCGG + Intronic
967350903 3:188512533-188512555 TGGGCAACAAGAGCAAAACCCGG + Intronic
974730319 4:65855790-65855812 GGGGGAAACAAACCCAAACCGGG + Intergenic
978291062 4:107141212-107141234 GGGGTTTCCAGAACACAACCTGG + Intronic
978525669 4:109662337-109662359 GGGGCAGGCAGACCCAAACCTGG + Intronic
979194221 4:117900692-117900714 GGGTTCACCAGGCCAAAAGCAGG + Intergenic
984188773 4:176579367-176579389 GGTGTAAACAGACCAACAGCAGG - Intergenic
988511321 5:31867066-31867088 GGTGTAACCAGAGCAAAATGAGG - Intronic
990532700 5:56689617-56689639 TGGGGAAACAGAGCAAAACCGGG - Intergenic
993617433 5:90131068-90131090 AGGGTCACCAGACAAAAAGCAGG + Intergenic
995687784 5:114789721-114789743 GTGGCAACTAGACAAAAACCAGG + Intergenic
995735908 5:115298670-115298692 GGGGTAGGTAGACCAAAGCCTGG + Intergenic
1013603844 6:111730301-111730323 GGGATAACCGAACCAAAAGCAGG + Intronic
1013849244 6:114494082-114494104 GGGGTAACCTGAATAAAATCAGG + Intergenic
1015028040 6:128560976-128560998 GGGGTAAGCAGAGCAAGAACAGG - Intergenic
1018159497 6:161024759-161024781 GGGGTAACCTGACAACAAACAGG - Intronic
1018548252 6:164962547-164962569 GTGGTGACCAGACCAATATCTGG - Intergenic
1023526524 7:41109326-41109348 GGGGAATCCAGACCAAAAGTTGG - Intergenic
1024380680 7:48692467-48692489 GGGAAAAGCAGAACAAAACCAGG - Intergenic
1024407711 7:49001751-49001773 GGGGGAAGCACACCAAAACCCGG - Intergenic
1027477326 7:78649698-78649720 GGGATGACCAGGCCAAAACATGG - Intronic
1030588793 7:111453695-111453717 GGGATAACCAGACAATTACCTGG - Intronic
1031373660 7:120997896-120997918 TGGGTAACAAGAGCAAAACTCGG + Intronic
1042723540 8:71848794-71848816 GGGTTATCCAGACCTAACCCTGG - Intronic
1046932268 8:119853743-119853765 GGGGTACTCAGAACAAAACAAGG - Intronic
1051299618 9:15634449-15634471 GGGTGCACCAGACCAAAATCAGG - Intronic
1051864061 9:21659056-21659078 GGGGAAAACAGACAGAAACCAGG + Intergenic
1052529290 9:29659748-29659770 GGGGTGATCAGACCAACACCAGG + Intergenic
1055258939 9:74409439-74409461 GGGAGAAACAGACCAAGACCAGG - Intergenic
1056307715 9:85306871-85306893 GGTATAACCATACCAAACCCTGG - Intergenic
1061364836 9:130167125-130167147 GGGGTCACCAGACGAGGACCAGG - Intergenic
1188837743 X:34978805-34978827 GGGGGAAACAGAACAAAGCCAGG + Intergenic
1190200304 X:48355418-48355440 GGAGAAATCAGACGAAAACCAGG + Intronic
1191822197 X:65323311-65323333 GGGGTGATCAGACCCAACCCAGG + Intergenic
1193213338 X:78834753-78834775 GTGGTAGACAGAACAAAACCAGG - Intergenic
1193820757 X:86161379-86161401 GGTGTTAGCAGATCAAAACCTGG + Intronic