ID: 954146246

View in Genome Browser
Species Human (GRCh38)
Location 3:48635664-48635686
Sequence CTGCAGTCCCATCCAGCTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 321}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954146246_954146250 3 Left 954146246 3:48635664-48635686 CCCGGAGCTGGATGGGACTGCAG 0: 1
1: 0
2: 3
3: 38
4: 321
Right 954146250 3:48635690-48635712 TGGAACTAAGCACCCGCGCCGGG 0: 1
1: 0
2: 0
3: 3
4: 37
954146246_954146251 7 Left 954146246 3:48635664-48635686 CCCGGAGCTGGATGGGACTGCAG 0: 1
1: 0
2: 3
3: 38
4: 321
Right 954146251 3:48635694-48635716 ACTAAGCACCCGCGCCGGGCTGG 0: 1
1: 0
2: 0
3: 2
4: 59
954146246_954146249 2 Left 954146246 3:48635664-48635686 CCCGGAGCTGGATGGGACTGCAG 0: 1
1: 0
2: 3
3: 38
4: 321
Right 954146249 3:48635689-48635711 CTGGAACTAAGCACCCGCGCCGG 0: 1
1: 0
2: 0
3: 2
4: 40
954146246_954146255 26 Left 954146246 3:48635664-48635686 CCCGGAGCTGGATGGGACTGCAG 0: 1
1: 0
2: 3
3: 38
4: 321
Right 954146255 3:48635713-48635735 CTGGCCGCAGTCGCGCCCCCAGG 0: 1
1: 0
2: 0
3: 10
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954146246 Original CRISPR CTGCAGTCCCATCCAGCTCC GGG (reversed) Intergenic
900204388 1:1425877-1425899 CTCCAGCCCCAGCCAGCTCCTGG - Intergenic
900308272 1:2021468-2021490 CTGACGTCCAATACAGCTCCAGG - Intronic
901222007 1:7588574-7588596 CTCGGGTCCCATGCAGCTCCAGG + Intronic
901451722 1:9340073-9340095 CTGCATTTCCAGCAAGCTCCTGG + Intronic
901691104 1:10973906-10973928 CTGCAGAGACACCCAGCTCCTGG - Intronic
902078336 1:13804572-13804594 CTGCATTACCAACAAGCTCCGGG + Intronic
902317147 1:15630402-15630424 CAGCAGTCCCACTCATCTCCTGG + Exonic
902477459 1:16695853-16695875 CTGCATTTCTAGCCAGCTCCTGG - Intergenic
902549459 1:17210757-17210779 CAGCAGCCCCAGCCAGCCCCGGG + Intronic
902685877 1:18077432-18077454 CTTCGGTCCCAGCCAGCCCCAGG + Intergenic
903189509 1:21648935-21648957 CTGCAGTACCCCCCAGCTGCTGG - Intronic
903775396 1:25790135-25790157 CTGCAGCCCTAGCCACCTCCTGG + Intergenic
904145961 1:28391474-28391496 CTCCACTCCCACCCAGCTCCTGG - Intronic
905528377 1:38656551-38656573 CTGCGCTCCTCTCCAGCTCCAGG - Intergenic
906178950 1:43801489-43801511 GTGCAGTCACATCCTGTTCCAGG - Intronic
906380441 1:45328961-45328983 CTGAACTCCCAGCCAGCCCCGGG - Intergenic
907307886 1:53523639-53523661 CTGCACTCCCATGGAACTCCAGG - Intronic
907487454 1:54787680-54787702 CTGCTGTCCCACCCATCCCCCGG + Intronic
907672922 1:56492583-56492605 ATGCAGTCCCCTCCAGCCCCTGG - Intergenic
912769633 1:112451858-112451880 CTGCAGTACCTGCCACCTCCAGG + Intronic
913318646 1:117573875-117573897 CTGCATTTCCAACCAGTTCCTGG + Intergenic
915451861 1:156010917-156010939 CTGCAGGCTCCTCCAGCACCTGG + Intronic
915907519 1:159889733-159889755 CCGCAGTCCGACACAGCTCCCGG + Intronic
917258600 1:173142468-173142490 CTCCAGTTCCATCCATGTCCCGG + Intergenic
917790715 1:178496993-178497015 CTACAGTCCCCGCCAGCTCCGGG - Intergenic
920012872 1:202882304-202882326 CTGCAGCCTCAACCACCTCCTGG - Intronic
920101474 1:203519699-203519721 CTGCAGCCCCAGCCAACACCAGG + Intergenic
920869190 1:209779458-209779480 CTGGAGTCCCAGCCAGTTCTGGG + Exonic
922803101 1:228372987-228373009 CTGCAGGCTCATCCAGCGGCAGG - Exonic
923050181 1:230385875-230385897 CTGCAGGTCCAGCAAGCTCCCGG - Intronic
923124226 1:231021431-231021453 CTGCAGACCTAACTAGCTCCAGG + Intronic
923881450 1:238108460-238108482 CTGCATTCCCATCCTAGTCCTGG - Intergenic
924044398 1:240012395-240012417 CTGCAGTCACCTGCAACTCCGGG + Intergenic
1063464599 10:6234568-6234590 CCGCATTCCCGTGCAGCTCCAGG + Exonic
1067030522 10:42876564-42876586 CCGCAGTGCCATGCAGCGCCTGG + Intergenic
1068659779 10:59612076-59612098 CTGTGGTCCCAGCTAGCTCCAGG - Intergenic
1068828860 10:61469843-61469865 TTGCAGGCCCCTCCAGCTCACGG - Intergenic
1068870235 10:61935549-61935571 CTCCACTCCCCACCAGCTCCTGG - Intronic
1069907008 10:71737945-71737967 TTGCAGCCCCCTCCTGCTCCTGG + Intronic
1070751844 10:78968516-78968538 GTGGAGTGCCATCCAGGTCCTGG - Intergenic
1071173961 10:82901551-82901573 CTCCACTCCCATCCAGCTCTAGG + Intronic
1071312213 10:84353555-84353577 CTGCAGCCCCATTCAGCTGCAGG + Intronic
1072910305 10:99495070-99495092 CTGCAGTCCCAGCTACATCCAGG + Intergenic
1073059121 10:100722990-100723012 CAGCTGTCCCATCCAGCTCCTGG - Intergenic
1073931213 10:108578987-108579009 CTGTAGTCCCAGCCAGCTACTGG + Intergenic
1073952950 10:108831856-108831878 CTGCAGCTCCATCCATGTCCTGG - Intergenic
1074224240 10:111468002-111468024 GTCAGGTCCCATCCAGCTCCAGG + Intergenic
1075665067 10:124224053-124224075 CCGCAGCCCCTTCCATCTCCTGG - Intergenic
1075730041 10:124630609-124630631 CTGGAGTACCTTCCCGCTCCTGG - Intronic
1075873150 10:125785833-125785855 GTGCCTTCCCCTCCAGCTCCTGG - Intronic
1076723143 10:132401479-132401501 CAGCAGGCCCATCTAGCTCCAGG + Intronic
1077022638 11:425414-425436 CTGCCTTCCAATCCATCTCCTGG - Intronic
1077409370 11:2396267-2396289 CTGCAGGCCCTGCCAGCTACAGG - Intronic
1078445677 11:11403384-11403406 CTGCAGTCACATCCACCCACTGG + Intronic
1078577405 11:12513784-12513806 TTGCAGTCCCATACAACTCAGGG - Intronic
1079239546 11:18712869-18712891 CTGCATTTCCATCGAGCTCTGGG - Intronic
1080605523 11:33861938-33861960 CTGTAGCCCCTTCCAGCTCTGGG + Intronic
1080848483 11:36047045-36047067 CAGCAGCCCCCTCCAGCCCCAGG - Intronic
1083445554 11:62706154-62706176 CGCCAGTCCCCTCCAGCTCGGGG + Intronic
1083446332 11:62710034-62710056 CTTCAGGCTTATCCAGCTCCTGG - Intronic
1084435111 11:69134976-69134998 CTGCTGTCCTTTCCAGCCCCGGG + Intergenic
1084729413 11:71063976-71063998 CTGCAGTTCCCACCAGCTGCTGG + Intronic
1084937956 11:72597163-72597185 CTACAGCCCCATCCAGCATCAGG + Intronic
1085024373 11:73228082-73228104 CTGCAGCCCGGTCCAGGTCCAGG + Exonic
1085726783 11:78961561-78961583 CTGAAGCCCCAGCCAGCTGCAGG - Intronic
1089126967 11:116183327-116183349 CTGCCTTCCCCTCCTGCTCCAGG - Intergenic
1089360021 11:117879483-117879505 ATGCTGTCCTCTCCAGCTCCAGG - Intergenic
1090802001 11:130178852-130178874 CTGCAGACCCAGCCAGCTGCTGG - Intronic
1091219784 11:133923393-133923415 CTGCTGTCCCTGCCAGCTCTAGG - Intronic
1091893860 12:4084563-4084585 AGGCAGTCCCTTCCACCTCCAGG + Intergenic
1096665324 12:53160421-53160443 CAGCAGTGCCATCTGGCTCCAGG - Intronic
1104949376 12:132432256-132432278 CTGCAGCCACAGCCAGCACCTGG + Intergenic
1105243530 13:18628384-18628406 CTGCAGCCCCGCCCATCTCCTGG + Intergenic
1105844028 13:24279505-24279527 CTGGGTTCCCATCCAGCTTCGGG - Intronic
1106356640 13:28989761-28989783 CTGCAGTCCCATGCAGCAGCTGG - Intronic
1108079333 13:46718010-46718032 AAGCTGTCCCATCCAGCTCCAGG - Intronic
1108718380 13:53104963-53104985 CTGCAGACCCATGCAGATACAGG - Intergenic
1113120590 13:106919884-106919906 CTGCAGTCCCACGCAGCCCCTGG + Intergenic
1113727037 13:112612525-112612547 CTGTAATCCTGTCCAGCTCCTGG + Intergenic
1113986948 13:114324960-114324982 CATCAGTCTCACCCAGCTCCTGG + Exonic
1114586172 14:23816033-23816055 CTGTACTCCCACCCAGCTACTGG - Intergenic
1115328435 14:32167756-32167778 ATGCAGTACAAACCAGCTCCAGG - Intergenic
1117012743 14:51487499-51487521 CTGCATTTCCAACCAGCTCCAGG + Intergenic
1117603580 14:57400944-57400966 CTGGAGACCACTCCAGCTCCTGG + Intronic
1118197111 14:63637651-63637673 CTCCAGTCTCATCCAGGTCATGG - Intronic
1118332281 14:64823867-64823889 CTGCTGTCCCATCAAGCACGTGG + Intronic
1118377728 14:65191607-65191629 CTACAGTTCCCTCCAGGTCCTGG - Intergenic
1118796824 14:69152231-69152253 CTGCAGACCCCGCCAGCCCCCGG + Intronic
1119212298 14:72841249-72841271 GTGCCTTCCCATCCAGCCCCAGG - Intronic
1122208997 14:100162815-100162837 GTGGAGGCCCATCCTGCTCCTGG - Intergenic
1122636234 14:103130964-103130986 CTGCCCTCCCTGCCAGCTCCTGG - Intronic
1122975703 14:105169861-105169883 CTGCACAGCCACCCAGCTCCGGG - Intergenic
1124658370 15:31526303-31526325 CAGAAGTCACCTCCAGCTCCAGG - Intronic
1125930194 15:43594477-43594499 CTGCACAGCCCTCCAGCTCCAGG - Intronic
1125943362 15:43694309-43694331 CTGCACAGCCCTCCAGCTCCAGG - Intronic
1126429571 15:48566975-48566997 CTGCATTTCCATCAAACTCCCGG - Intronic
1127918797 15:63476878-63476900 CTGCCTTTCCATCCGGCTCCTGG - Intergenic
1128880759 15:71240468-71240490 CTGCATTTCCAACAAGCTCCTGG - Intronic
1129456178 15:75677174-75677196 CTGCAGTCCCAGCTGGCTGCAGG - Exonic
1129707850 15:77804912-77804934 CAGCACTCCCATCCAGCCCTTGG - Intronic
1129800311 15:78408905-78408927 CTGTTCTCCCATCCAGCTCATGG + Intergenic
1130217591 15:81986919-81986941 CAGCAGTGCCTTCCAGCTCTTGG - Intergenic
1131095132 15:89649762-89649784 CAGCCGTGACATCCAGCTCCGGG - Exonic
1131193991 15:90340517-90340539 CTGCAGCCTCCTCCACCTCCCGG + Intergenic
1133424065 16:5672391-5672413 CTTCAGTGCCCTCCTGCTCCAGG + Intergenic
1134018134 16:10903543-10903565 CTGGAGTTACATCTAGCTCCTGG - Intronic
1135104130 16:19632640-19632662 CTGCAGCCCAATCCAGCCCAGGG - Intronic
1135134253 16:19876084-19876106 CTCTAATCCCATCCAGCCCCAGG + Intronic
1138346151 16:56321457-56321479 CTCTAGTCCCAGCCAGCCCCAGG - Intronic
1138445095 16:57058610-57058632 CTGGAGTGACAGCCAGCTCCAGG + Intronic
1138641911 16:58394422-58394444 CTGCAGCCTCCTCCACCTCCTGG + Intronic
1139045698 16:63056600-63056622 CTGCATTCCTAACAAGCTCCTGG - Intergenic
1139670733 16:68491166-68491188 CTGCAGTCCCCACCCGCACCTGG - Intergenic
1140217941 16:73023335-73023357 CTCCAGCCCCTTCCACCTCCAGG - Intronic
1141355389 16:83340653-83340675 CTGCATTTCTAACCAGCTCCTGG + Intronic
1141752510 16:85968304-85968326 CTGCATTTCCAGCCAGCTCTCGG + Intergenic
1141857156 16:86691219-86691241 CTGCAGTCCAAGCCAACACCTGG + Intergenic
1141900009 16:86984983-86985005 CTCCAGAGCCATCCAGCGCCTGG + Intergenic
1142343341 16:89538123-89538145 CTGCATCCCCATCCCGCTCCCGG - Intronic
1142539606 17:647928-647950 CAGCGGCCCCATCCTGCTCCTGG - Intronic
1142918603 17:3164152-3164174 CTGCAATCTCTTCCACCTCCCGG - Intergenic
1143358180 17:6346588-6346610 CTCCAGTCTCAGACAGCTCCTGG + Intergenic
1143645738 17:8228867-8228889 CGGCAGTCCCATCCTCCACCAGG + Exonic
1143881162 17:10031132-10031154 CTCCAGACCTATCCAGCTCCTGG + Intronic
1144176930 17:12716515-12716537 CTTCATGCCCATCCAGTTCCTGG + Intronic
1144732946 17:17539328-17539350 CAGCACTTCCAGCCAGCTCCAGG + Intronic
1145961226 17:28887561-28887583 CTGCTCTCCCTTCCTGCTCCAGG - Intronic
1145973127 17:28968596-28968618 CTACAGCCCCATCCACTTCCAGG + Intronic
1145998027 17:29115578-29115600 CAGCAGTCCCCTCCCGCCCCAGG + Intronic
1146912685 17:36658469-36658491 CTGCAGGTCCCTCGAGCTCCCGG - Intergenic
1147191786 17:38742174-38742196 CTGCTGTCCCTTCCAGGTGCAGG - Intronic
1148472169 17:47901649-47901671 GTGCAGTCCAGTCCTGCTCCTGG - Intronic
1148913007 17:50953330-50953352 CTCCTGTCCCACCCAGCTCATGG + Intergenic
1150435060 17:65147273-65147295 GTGCAGACCCAGGCAGCTCCAGG - Intronic
1151606056 17:75136833-75136855 CTACGGCCCCTTCCAGCTCCGGG + Intronic
1151927588 17:77210333-77210355 CTGCAGGCCCCTCCTGCTTCAGG - Intronic
1152298837 17:79483883-79483905 CTTCAGTCCCCTCCATATCCCGG - Intronic
1152496517 17:80676591-80676613 CTGCAGACCCCTCCAGATGCTGG - Intronic
1152599263 17:81253266-81253288 CTGCACTGCCAAGCAGCTCCAGG + Intronic
1152903491 17:82958187-82958209 CTTCTGGCCCGTCCAGCTCCTGG - Intronic
1203165463 17_GL000205v2_random:89128-89150 CTACACTCCCAGCCAGCACCGGG - Intergenic
1153307485 18:3645486-3645508 CTGCAGTCACATCTGACTCCTGG + Intronic
1154445407 18:14431497-14431519 CTGCAGCCCCGCCCATCTCCTGG - Intergenic
1155333167 18:24738308-24738330 CTGCTTTCTCCTCCAGCTCCAGG - Intergenic
1158474332 18:57766669-57766691 CTTCATTTCCATCAAGCTCCCGG + Intronic
1158722539 18:59938395-59938417 CTGCAGTCCCAGCTAGTTGCCGG - Intergenic
1160019940 18:75172619-75172641 CTGCAGCCCCCACCGGCTCCAGG + Intergenic
1160427486 18:78788121-78788143 CCCCACTCCCATCCACCTCCTGG + Intergenic
1160874055 19:1289085-1289107 CTGGAGTCGCATCCGGCTGCAGG + Intronic
1161381763 19:3969211-3969233 CTGCAGCCTCCTCCAACTCCTGG + Intronic
1161741768 19:6025249-6025271 CCCCAGTCCCATCCTGCTACAGG + Intronic
1162371039 19:10279556-10279578 CTGCAGCCTCCTCCACCTCCTGG + Intronic
1162536787 19:11267311-11267333 CTCCCGTCCCCTCCAGCCCCTGG + Intergenic
1163158591 19:15452148-15452170 AGGAAGTCCCTTCCAGCTCCTGG + Intronic
1163440809 19:17321804-17321826 CTGCTGTACCTCCCAGCTCCCGG + Exonic
1163683509 19:18697086-18697108 CTGGACCCCCATCCAGCTGCTGG - Intronic
1164564322 19:29314998-29315020 ATGCAGGCCCAACAAGCTCCTGG + Intergenic
1164669456 19:30064352-30064374 CTGCTTTCCTAGCCAGCTCCCGG - Intergenic
1165404833 19:35623135-35623157 CTGCTGCCCCACTCAGCTCCTGG + Exonic
1165792251 19:38499523-38499545 CACAGGTCCCATCCAGCTCCAGG - Intronic
1166500727 19:43339178-43339200 CTGGAGTCCCTTCCAACTGCTGG - Intergenic
1166509364 19:43394227-43394249 CTGGAGTCCCTTCCAACTGCTGG + Intergenic
1168146163 19:54420960-54420982 CCCCAGTCACACCCAGCTCCGGG - Intronic
1168489516 19:56796475-56796497 CAGCAGTGGCATCCAGCTTCGGG - Intronic
1202711479 1_KI270714v1_random:21679-21701 CTGCATTTCTAGCCAGCTCCTGG - Intergenic
925971982 2:9112380-9112402 CGGCCTTCCCCTCCAGCTCCAGG + Intergenic
928156707 2:28883432-28883454 CTCCATTCCCATCCAGCCCCAGG + Intergenic
928419595 2:31128062-31128084 CTGCAGTTCCAGTAAGCTCCTGG - Intronic
929889672 2:45908540-45908562 CTGCATTTCAAACCAGCTCCTGG + Intronic
930044518 2:47157284-47157306 CTGCATTTCCAACAAGCTCCTGG + Intronic
933141319 2:78794962-78794984 CTGCAGGCACACCCAGCTCAGGG - Intergenic
934297665 2:91755808-91755830 TTGCAGTCACAGCCATCTCCCGG + Intergenic
934602740 2:95670627-95670649 CTGCAGAACCATCCAGCTTCAGG - Intergenic
934681386 2:96286311-96286333 CTTCAATCCCATCCAGACCCAGG - Exonic
935334263 2:102000663-102000685 CTGGAGGCCCCTCTAGCTCCAGG + Intronic
935574208 2:104692110-104692132 CTCCTCTCCCCTCCAGCTCCTGG - Intergenic
936536122 2:113312819-113312841 CTGCAGAGCCATCCAGCTTCAGG - Intergenic
937275116 2:120679213-120679235 CTGCTGGCCCAGCCGGCTCCCGG + Intergenic
937276959 2:120691060-120691082 CTCCACTCCCACCCACCTCCAGG + Intergenic
937462447 2:122101221-122101243 CTGCAGGGCCTTCCATCTCCTGG - Intergenic
938123026 2:128646894-128646916 CTGGAGTCCATTCCAGCACCTGG + Intergenic
938682998 2:133711370-133711392 CAGCTGGCCCATCCAGCTGCAGG + Intergenic
939987801 2:148849200-148849222 TTGCAGGCCCCTCCCGCTCCAGG - Intergenic
940876683 2:158904794-158904816 CTCCAGTCCCATGCACTTCCTGG + Intergenic
940908310 2:159188457-159188479 CTGGAGTCCCATCCAGCCAGTGG + Intronic
942042703 2:172081469-172081491 CGGCAGTTCCATCCCGCTTCAGG + Exonic
942611852 2:177750455-177750477 CTGCAGGACCATCCAGATCCTGG - Intronic
943774139 2:191746883-191746905 CTGCAATCCCATACAATTCCTGG - Intergenic
946100563 2:217316873-217316895 CTGAGGTCCCATCCAGATTCAGG - Intronic
946689850 2:222301744-222301766 CTGGACTCCCATCCAGCTGCGGG - Intronic
946744412 2:222831399-222831421 CTGAAGAGCCATCCAGCTTCAGG - Intergenic
947825242 2:233101261-233101283 CTGCATTCACAACCAGCTCTTGG + Intronic
948213767 2:236214174-236214196 CTGCATTGCCAACAAGCTCCCGG - Intronic
948385799 2:237579869-237579891 CTGCAGTTCCCTGCAGGTCCAGG + Intronic
948563207 2:238867480-238867502 GAGAAGTCCCAGCCAGCTCCCGG + Intronic
948589446 2:239039789-239039811 CTGCATTCCCCTACAGATCCTGG - Intergenic
948686431 2:239672903-239672925 CTGCAGAGCCATCAAGATCCTGG - Intergenic
948804945 2:240449633-240449655 CGTCACCCCCATCCAGCTCCAGG + Exonic
948832595 2:240605431-240605453 CTTTAGTCACTTCCAGCTCCAGG + Intronic
948875152 2:240822570-240822592 CTGCAGTGCCACCAAGCCCCTGG - Intergenic
1169204900 20:3733925-3733947 CTGCATTCCCATAGTGCTCCTGG + Intronic
1169432562 20:5551665-5551687 CTGCCTTACCCTCCAGCTCCTGG - Intronic
1169839777 20:9922678-9922700 CTGCAGCCTCCTCCACCTCCTGG + Intergenic
1171475707 20:25407250-25407272 CTGCAGTCCCTACCAGCACTAGG + Intergenic
1172023996 20:31935647-31935669 CAGCAGTCACATCCTGCTGCAGG - Intronic
1172121491 20:32601571-32601593 CTGCAGTCTTATCCACCTTCTGG - Exonic
1172393321 20:34581489-34581511 CAGCAGTCTCATCCAGGCCCAGG + Intronic
1173883972 20:46440515-46440537 CTGAGGTCCCATCCAGGTGCAGG + Intergenic
1173973978 20:47173408-47173430 CTGCACTTCTAACCAGCTCCGGG - Intronic
1174762169 20:53216875-53216897 CTGCAGCCCCTGGCAGCTCCTGG + Intronic
1175420349 20:58828574-58828596 CTCCAGTGCCATCCAGCTCCAGG + Intergenic
1175960429 20:62633702-62633724 CTGCTGCCCCCTCCAGCCCCTGG - Intergenic
1176233791 20:64044967-64044989 CTGCACACCCCTCCCGCTCCTGG - Intronic
1176327024 21:5509921-5509943 GGGCAGGCCCATCCAGCTCCCGG - Intergenic
1176330687 21:5546290-5546312 GGCCAGGCCCATCCAGCTCCCGG + Intergenic
1176336220 21:5602324-5602346 CTACAATCCCAGCCAGCACCGGG + Intergenic
1176391537 21:6218624-6218646 CTACAATCCCAGCCAGCACCGGG - Intergenic
1176397070 21:6274661-6274683 GGCCAGGCCCATCCAGCTCCCGG - Intergenic
1176400733 21:6311030-6311052 GGGCAGGCCCATCCAGCTCCCGG + Intergenic
1176406289 21:6369951-6369973 CTACACTCCCAGCCAGCACCGGG + Intergenic
1176436424 21:6678074-6678096 GGGCAGGCCCATCCAGCTCCCGG - Intergenic
1176440087 21:6714443-6714465 GGCCAGGCCCATCCAGCTCCCGG + Intergenic
1176450572 21:6858362-6858384 CTGCAGCCCCTCCCATCTCCTGG + Intergenic
1176460686 21:7005144-7005166 GGGCAGGCCCATCCAGCTCCCGG - Intergenic
1176464349 21:7041512-7041534 GGCCAGGCCCATCCAGCTCCCGG + Intergenic
1176469882 21:7097550-7097572 CTACAATCCCAGCCAGCACCGGG + Intergenic
1176484247 21:7386922-7386944 GGGCAGGCCCATCCAGCTCCCGG - Intergenic
1176487910 21:7423291-7423313 GGCCAGGCCCATCCAGCTCCCGG + Intergenic
1176493443 21:7479328-7479350 CTACAATCCCAGCCAGCACCGGG + Intergenic
1176507199 21:7659055-7659077 CTACAATCCCAGCCAGCACCGGG - Intergenic
1176828742 21:13723380-13723402 CTGCAGCCCCTCCCATCTCCTGG + Intergenic
1179709322 21:43203903-43203925 GTTCAGGCCCCTCCAGCTCCAGG + Intergenic
1179908766 21:44437262-44437284 CTGCAGCCCCCTGCAGCCCCTGG + Intronic
1179994832 21:44969195-44969217 CTGCAGGCCCAGGCAGCTCCAGG + Intronic
1180221980 21:46364983-46365005 TTGCAGGACCCTCCAGCTCCAGG + Intronic
1180958374 22:19751154-19751176 CTACAGTCCCAGACAGCACCTGG - Intergenic
1181033535 22:20159312-20159334 CTGCTGCCCCAACCTGCTCCCGG + Intergenic
1181286875 22:21758790-21758812 CTGCAGGCCCTTCCAGCGGCGGG + Exonic
1181406011 22:22685651-22685673 CTGCCTTTCCTTCCAGCTCCAGG + Intergenic
1181408713 22:22703225-22703247 CTGCCTTTCCTTCCAGCTCCAGG + Intergenic
1181413987 22:22746354-22746376 CTGCCTTTCCTTCCAGCTCCAGG + Intronic
1181419632 22:22788877-22788899 CTGCCTTTCCTTCCAGCTCCAGG + Intronic
1181999731 22:26910631-26910653 CTGTATTTCCAACCAGCTCCTGG - Intergenic
1182108295 22:27704731-27704753 CTGCAGTTCTAACCATCTCCTGG - Intergenic
1182380361 22:29883020-29883042 CTGCAGCCCCGCCCATCTCCTGG + Intergenic
1182543099 22:31056001-31056023 CTGCATTCCCACCCACCTGCAGG + Intergenic
1183489447 22:38108840-38108862 CTGCAGGCCCACACAGCCCCAGG - Intronic
1184045775 22:41971526-41971548 ATGCAGTCGCATGGAGCTCCAGG + Intergenic
1184536574 22:45091666-45091688 CTGCGGATCCCTCCAGCTCCGGG + Intergenic
950674453 3:14546171-14546193 GTGCCTTCTCATCCAGCTCCAGG - Intergenic
953331036 3:42053352-42053374 CTGCAGTCCCATTCAGAGTCGGG + Intronic
954146246 3:48635664-48635686 CTGCAGTCCCATCCAGCTCCGGG - Intergenic
954264323 3:49461144-49461166 CAGCTGTCCCATCCATCTCTGGG - Intergenic
954674175 3:52306617-52306639 CTCCAGCCCTATCCAGCCCCAGG - Intergenic
955317979 3:57954495-57954517 CTGCAGTCAACCCCAGCTCCAGG - Intergenic
956420939 3:69085613-69085635 CTGCCGCCCCAGCCAGCTCCAGG - Intronic
957242918 3:77682131-77682153 CTGCAGTCCCACCCAGGAACAGG + Intergenic
960696554 3:120402059-120402081 CTGGAGTCCCATCTGGGTCCTGG - Intronic
961045327 3:123704083-123704105 CTCCTGTCCAATCCAGCCCCAGG + Intronic
966854775 3:184186396-184186418 CTCCAGACCCAACCAGCCCCCGG - Intronic
967612432 3:191523478-191523500 CTGCACTTCCATCCTGCCCCAGG + Intergenic
967806615 3:193719722-193719744 CTGCTGCCCCACCCACCTCCAGG - Intergenic
967902827 3:194474273-194474295 CTGCAGCCCCTTCCTGCTCAAGG - Intronic
968481215 4:833866-833888 CGGGGGCCCCATCCAGCTCCTGG - Intergenic
968653692 4:1769811-1769833 CTGCTGTCCCAACCCGCACCTGG - Intergenic
970205821 4:13654630-13654652 CTGCAGCCCCCGCCAGCTCCCGG + Intergenic
972917963 4:43904125-43904147 CTGCAGGCACATACAGCTCAGGG + Intergenic
975330047 4:73102071-73102093 CTGTAGTCCCAGCTAGCTACTGG - Intronic
976600439 4:86933761-86933783 CTCCTGTCCCATCCTGCTCAGGG + Intronic
984864503 4:184270198-184270220 CTCCAGTCCCATTCAGCTGCAGG - Intergenic
984951829 4:185013682-185013704 CTGCATTCCTAACGAGCTCCTGG + Intergenic
985063613 4:186101632-186101654 CTGCATACCCTTCCAGATCCTGG - Intergenic
985728049 5:1525943-1525965 CTCCAGGCCTCTCCAGCTCCTGG - Intergenic
985747097 5:1653835-1653857 CTGGAGTCCCCACCAGCTCTGGG + Intergenic
991632277 5:68668056-68668078 CTGCAGTTCCCGCCACCTCCAGG + Intergenic
992236714 5:74717248-74717270 CTTCACTACCATCCAGCCCCTGG + Intronic
992890045 5:81195662-81195684 CTGCATTTCCAACAAGCTCCCGG - Intronic
995708943 5:115015079-115015101 CTAATGTCCCTTCCAGCTCCAGG + Intergenic
997674201 5:135700730-135700752 CTGCAGTCCCCTCAGGCTCTGGG + Intergenic
999134778 5:149311299-149311321 CTGCCGACCCAACCAGCTCGTGG - Intronic
1002618203 5:180468432-180468454 CTGCACTTCCATCCAGCTCCGGG + Intergenic
1003058746 6:2845721-2845743 CTGCAGCCTCATGCAACTCCTGG - Intergenic
1003322727 6:5066663-5066685 CTGCAGTGCAGTCCAGGTCCTGG - Intergenic
1004894280 6:20131847-20131869 CTGCATTTCCAACTAGCTCCTGG - Intronic
1005571217 6:27147317-27147339 CCGCATTGCCAGCCAGCTCCAGG - Exonic
1006806238 6:36791528-36791550 CTGCAGTCCCAGGCAGCCCTTGG - Intronic
1014587298 6:123214832-123214854 ATACAGCCACATCCAGCTCCAGG - Intergenic
1014904064 6:127004878-127004900 CTGCAGGCCCCTTCAGGTCCTGG - Intergenic
1017987474 6:159456209-159456231 CTGCATTTCCACCCAGCTCCTGG - Intergenic
1018372234 6:163178742-163178764 CTGCCATCACATCCAGCACCCGG + Intronic
1018574256 6:165242831-165242853 CTGAAGTCCCATGTAGCTCTGGG - Intergenic
1019172338 6:170139739-170139761 CTGCACCCTCTTCCAGCTCCAGG + Intergenic
1019480290 7:1263580-1263602 CTGCAGTCCTGGCAAGCTCCGGG - Intergenic
1019560515 7:1654223-1654245 CTGCCTGCCCATCCAGCTCCTGG + Intergenic
1020256622 7:6506038-6506060 CTGCAGTCTCCTCCTGCTCCGGG - Intronic
1021456327 7:20832872-20832894 CTGTAGTCCCAGCCAGCTACTGG + Intergenic
1022755293 7:33281494-33281516 CTGCAGTCCCAGCCACCTGTGGG - Intronic
1023354292 7:39351681-39351703 CTGCATTTCTAACCAGCTCCAGG + Intronic
1023879538 7:44310348-44310370 CTCCAGTCCCTTCCGGCCCCAGG - Intronic
1024533169 7:50409828-50409850 CTGCATCACCTTCCAGCTCCAGG + Intergenic
1024733076 7:52274151-52274173 CTGCGGTCCAAGCCAGCTCCTGG + Intergenic
1024980312 7:55152689-55152711 GTGCAGCCCCAGCCTGCTCCAGG - Intronic
1025639533 7:63353764-63353786 CTACAGTCCCAGCAAGCGCCGGG - Intergenic
1025643166 7:63394328-63394350 CTACAGTCCCAGCAAGCGCCGGG + Intergenic
1025712619 7:63926679-63926701 CTACAGTCCCAGCAAGCGCCGGG + Intergenic
1026035547 7:66827921-66827943 CTGCAGTGCCACCCAGCCTCTGG + Intergenic
1026634029 7:72065578-72065600 CTGGAGTCCCATTGAGATCCCGG + Intronic
1026983905 7:74542822-74542844 CTGCAGTGCCACCCAGCCTCTGG - Intronic
1029040021 7:97563477-97563499 CTGCAGTCCCCAACAGCCCCTGG - Intergenic
1029327747 7:99824237-99824259 CTGCAGTGACAGGCAGCTCCAGG - Intergenic
1032153199 7:129447647-129447669 TTGCTGTCCCAGCCAGCTGCAGG + Intronic
1032489120 7:132310775-132310797 CTGCAGCCTCATCAAGCTACTGG + Intronic
1032794957 7:135269758-135269780 CTCCAGCCTCATCCAGCTCAGGG - Intergenic
1032884721 7:136124979-136125001 CTGCAGTCCCATCAATGCCCTGG - Intergenic
1034421798 7:150994623-150994645 CTGCAGCCCCAGCCTGCCCCCGG - Intronic
1034461474 7:151200082-151200104 CTGCAGCCCCTTCCAGCTGGGGG + Intronic
1035788340 8:2280118-2280140 CTCCACTCCCACCCAGCTTCTGG + Intergenic
1035804467 8:2441587-2441609 CTCCACTCCCACCCAGCTTCTGG - Intergenic
1035889670 8:3329692-3329714 CTGCAGGCCCATGCGGCCCCGGG - Intronic
1037770306 8:21795058-21795080 CTGCAGCCCCACCCATCTCAGGG + Intronic
1039502745 8:38030411-38030433 CCGCAGCCCCACCCAGCTCCAGG - Exonic
1039790029 8:40868348-40868370 CTGCAGCTCCTTGCAGCTCCAGG + Intronic
1040458010 8:47619678-47619700 CTGCAGCCTCATCAACCTCCTGG + Intronic
1040482574 8:47839897-47839919 CTGCAGTCTCAACCTCCTCCTGG - Intronic
1041913376 8:63113827-63113849 CTGAAGGGCGATCCAGCTCCAGG - Intergenic
1042507092 8:69572560-69572582 CTACAGTCTCTTCCAGCTCTAGG + Intronic
1043833903 8:85022935-85022957 CTGCAGCCCGATCCAGCTGAAGG - Intergenic
1045665190 8:104477208-104477230 TAGCAGTTCCATCCAGCCCCAGG + Intergenic
1047217399 8:122887735-122887757 CTGCAATTCCAGGCAGCTCCAGG - Intronic
1047230139 8:122990847-122990869 ATGCAGACCCATCCAGATTCAGG + Intergenic
1047501632 8:125446284-125446306 CTGCATTTCCAACCAGTTCCTGG + Intergenic
1048308135 8:133297511-133297533 CTGCAGTCCCCTCCGAGTCCAGG + Exonic
1048645616 8:136416144-136416166 CTGCAATTCTCTCCAGCTCCTGG - Intergenic
1052113606 9:24620557-24620579 CTGCAGTCTCATCCATATCCTGG - Intergenic
1052851312 9:33380175-33380197 CTGCTCTCCCATTCAGCTCCAGG - Intergenic
1056751205 9:89352626-89352648 CTCCAGTCCCTGCCAGCTCTTGG + Intronic
1056759109 9:89402553-89402575 CTACAGTACCCTCCACCTCCTGG - Intronic
1057336358 9:94158703-94158725 CAGAAATTCCATCCAGCTCCAGG + Intergenic
1057455302 9:95203321-95203343 CTGAAGTGCCCTCCAGCTCTGGG - Intronic
1058539046 9:105992955-105992977 CTGTACTTCCATCCAGCTCAAGG + Intergenic
1058588111 9:106532139-106532161 CTGCATCCCCATGCTGCTCCAGG + Intergenic
1058836372 9:108861747-108861769 CTGCAGTCCAATCCGGTCCCCGG - Intergenic
1059196046 9:112372148-112372170 CTTCAGCCCCCTCAAGCTCCTGG + Intergenic
1060895414 9:127213842-127213864 CTGCATTTCCAGCAAGCTCCCGG + Intronic
1060916323 9:127393197-127393219 CAGCAGCCCCTTCCAGCTCACGG + Exonic
1061087202 9:128406034-128406056 CAGCAGTGCCATCCACCTCCTGG + Intergenic
1061893232 9:133633696-133633718 GTGCAGCCCCCTCCAGCTCAGGG + Intergenic
1062276559 9:135734039-135734061 CCGCAGTCCCACTCAGCTCGCGG + Intronic
1203425423 Un_GL000195v1:32578-32600 CTACAATCCCAGCCAGCACCGGG - Intergenic
1203431408 Un_GL000195v1:94036-94058 GGCCAGGCCCATCCAGCTCCCGG - Intergenic
1203518610 Un_GL000213v1:26155-26177 CTGCAGCCCCGCCCATCTCCTGG - Intergenic
1190214520 X:48470614-48470636 TTGAAGCCCCAGCCAGCTCCTGG - Intergenic
1190968270 X:55323436-55323458 CTCCAGGCCCAACCAGCACCAGG - Intergenic
1191749744 X:64528940-64528962 CTGCAATCTCAGGCAGCTCCAGG + Intergenic
1192418693 X:71009015-71009037 CTGTAGTCCCAGCTAGCTACTGG - Intergenic
1193907382 X:87260224-87260246 ATTCAGACCCATCCAGGTCCAGG - Intergenic
1194506124 X:94735796-94735818 CTTCAGTACCATCCATGTCCTGG + Intergenic
1195122876 X:101774666-101774688 CTGCAGACCCACCCAGGGCCTGG - Intergenic
1197043625 X:121970205-121970227 CTCCAGGCCCACCCAGCACCAGG + Intergenic
1197891501 X:131274599-131274621 CTGCTGCCCCCACCAGCTCCAGG + Exonic
1198852392 X:140979168-140979190 CTGCAGCCTCCTCCACCTCCCGG + Intergenic
1202178268 Y:22117524-22117546 AGGCAGTCCCATCCAGCAACAGG + Intergenic
1202213093 Y:22468871-22468893 AGGCAGTCCCATCCAGCAACAGG - Intergenic