ID: 954147286

View in Genome Browser
Species Human (GRCh38)
Location 3:48640702-48640724
Sequence CAACCCTGGTGGTCCCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 120}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954147283_954147286 -4 Left 954147283 3:48640683-48640705 CCTTGGGGAGCAGCAGAGGCAAC 0: 1
1: 0
2: 2
3: 49
4: 351
Right 954147286 3:48640702-48640724 CAACCCTGGTGGTCCCAGAGAGG 0: 1
1: 0
2: 1
3: 15
4: 120
954147281_954147286 -2 Left 954147281 3:48640681-48640703 CCCCTTGGGGAGCAGCAGAGGCA 0: 1
1: 0
2: 1
3: 32
4: 265
Right 954147286 3:48640702-48640724 CAACCCTGGTGGTCCCAGAGAGG 0: 1
1: 0
2: 1
3: 15
4: 120
954147274_954147286 26 Left 954147274 3:48640653-48640675 CCTTCCAACACAGGGATGGGAGC 0: 1
1: 0
2: 0
3: 9
4: 155
Right 954147286 3:48640702-48640724 CAACCCTGGTGGTCCCAGAGAGG 0: 1
1: 0
2: 1
3: 15
4: 120
954147282_954147286 -3 Left 954147282 3:48640682-48640704 CCCTTGGGGAGCAGCAGAGGCAA 0: 1
1: 0
2: 1
3: 26
4: 298
Right 954147286 3:48640702-48640724 CAACCCTGGTGGTCCCAGAGAGG 0: 1
1: 0
2: 1
3: 15
4: 120
954147276_954147286 22 Left 954147276 3:48640657-48640679 CCAACACAGGGATGGGAGCAGGA 0: 1
1: 0
2: 1
3: 26
4: 323
Right 954147286 3:48640702-48640724 CAACCCTGGTGGTCCCAGAGAGG 0: 1
1: 0
2: 1
3: 15
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954147286 Original CRISPR CAACCCTGGTGGTCCCAGAG AGG Intronic
900840227 1:5042705-5042727 CCAGCCTGGTGGTCCCCGTGTGG + Intergenic
901414358 1:9106460-9106482 CAACCCTTATGGTCACAGTGGGG + Intronic
902551811 1:17223839-17223861 CAATCCCTGTGGTTCCAGAGTGG - Intronic
903019958 1:20386948-20386970 CAACCCGGCTGGTACCAGACTGG + Intergenic
907158524 1:52355328-52355350 CAGCACTGGTGTTTCCAGAGTGG - Intronic
909122827 1:71626135-71626157 CAAACCTCTTGGTACCAGAGTGG - Intronic
909684421 1:78330626-78330648 GAACCCAGGTGATTCCAGAGAGG - Intronic
916685034 1:167136601-167136623 CAGCCCTGGTGGTCCCTGAGAGG + Intergenic
917880809 1:179333955-179333977 CAACCATGGCGGAGCCAGAGGGG + Intronic
921179296 1:212619149-212619171 AAACCCTGGTGATGCCACAGAGG - Intronic
921740871 1:218682860-218682882 CAATCATTGTGGTCCCAAAGGGG - Intergenic
922339488 1:224643985-224644007 CAACCCTGGTGGATCTAGTGGGG + Intronic
924564034 1:245181047-245181069 CAACAGTGGTTGTGCCAGAGAGG + Intronic
1066332971 10:34445026-34445048 CTACCCTGGTGTTCCCAAATTGG + Intronic
1069845367 10:71367295-71367317 CAACCCTGCTGTTCCAAGACAGG - Intergenic
1071491809 10:86141244-86141266 CACCCTTGGGGTTCCCAGAGAGG + Intronic
1071813365 10:89207207-89207229 CTCCTCAGGTGGTCCCAGAGGGG + Exonic
1072196561 10:93121350-93121372 CAATCCTGGTGGGATCAGAGGGG + Intergenic
1075294577 10:121263039-121263061 CTCCCCTGGTGCTCCCAGAGGGG + Intergenic
1075984663 10:126774245-126774267 TAACCCTGATGGCCCCACAGAGG - Intergenic
1079396382 11:20067273-20067295 CTACCCTGGTGCTCCCACTGTGG + Intronic
1083224881 11:61278645-61278667 CAGCCGTGGTGGCCCCAGAAGGG + Intronic
1083826287 11:65205756-65205778 CACCCCTGATGGTGCCAGAGGGG + Intronic
1085396202 11:76208386-76208408 CAAGGCTGGGGGTCTCAGAGGGG + Intronic
1086403676 11:86481916-86481938 CATCCCTGTTGAACCCAGAGAGG + Intronic
1089731272 11:120520609-120520631 CAACCCTGGTTGGTCCAGTGGGG - Intronic
1092094766 12:5832357-5832379 CAGCCCTGGGGCTCCCAAAGTGG - Intronic
1095536996 12:43261001-43261023 CATCACTGGAGGTCCCAGAGAGG + Intergenic
1096620261 12:52860134-52860156 CAACTCTGGGGGACCCTGAGAGG + Intergenic
1098428754 12:70396131-70396153 CTACACTGGTGCTCCAAGAGAGG + Intronic
1101817107 12:108153692-108153714 CAACCCTGGTGGCTGCACAGAGG + Intronic
1103237914 12:119389472-119389494 CAACCCTGCTGGCACCACAGGGG - Intronic
1103573101 12:121857771-121857793 CAACCCAGAAGGTCACAGAGTGG + Exonic
1104733281 12:131120923-131120945 CTACCCTTGTGGGCGCAGAGCGG + Intronic
1104987031 12:132603073-132603095 GAAACCTGGAGGTCACAGAGAGG - Intergenic
1107328261 13:39268883-39268905 CCACCATGGTGGACCCAGCGGGG + Intergenic
1114401734 14:22416414-22416436 CTCCCCCGGTGGTCCCAGTGTGG + Intergenic
1117294088 14:54363060-54363082 CCATCCTGATGGTCCCTGAGCGG - Intergenic
1117881010 14:60313507-60313529 AATCCCTGGTGGTCCCAGGTGGG - Intergenic
1119034067 14:71215257-71215279 CACCCCTTGTGGGCCAAGAGAGG + Intergenic
1119520081 14:75278735-75278757 CAACCACGGTGGCGCCAGAGGGG - Intergenic
1119903743 14:78283020-78283042 CAGCCCTGTTGGTCCCAAATGGG - Intronic
1121719736 14:96100888-96100910 CAAACCACGAGGTCCCAGAGAGG + Intergenic
1122904048 14:104793876-104793898 CTGGCCTGGAGGTCCCAGAGAGG - Exonic
1123995532 15:25715669-25715691 CAAGCCTGCTGGTCTCTGAGTGG + Intronic
1126327511 15:47496921-47496943 CAACTGTGCTGGTCCAAGAGAGG - Intronic
1126415285 15:48412003-48412025 CAGCACATGTGGTCCCAGAGAGG - Intronic
1131908318 15:97168732-97168754 CAACCCTGGGGCTAACAGAGAGG + Intergenic
1139671085 16:68492884-68492906 CAACCCAGGTGGAGCCAGTGGGG + Intergenic
1139710178 16:68770181-68770203 CACACCTGGTGGTGGCAGAGAGG - Intronic
1142377280 16:89712424-89712446 CCGCCCTGGTGGTCCCCGAGGGG - Intronic
1142839123 17:2613438-2613460 CAACACTGCGGGCCCCAGAGAGG - Intronic
1143107781 17:4538089-4538111 CCAGCCTGGAGGTCCCAGATGGG + Exonic
1143148086 17:4789527-4789549 GAACCCTGGAGGCCCCGGAGAGG + Exonic
1144723053 17:17485566-17485588 CAAGCCTGGGGGTCCTAGCGTGG + Intronic
1144765554 17:17730675-17730697 CAAAGCTGGGGCTCCCAGAGGGG + Intronic
1144938302 17:18917875-18917897 CTTCCCTGGTGTTCCCAGGGAGG + Intronic
1147550111 17:41435622-41435644 TAACCCTGGTGAACCCAAAGGGG + Intergenic
1148446748 17:47742701-47742723 CACCACTGGCGGTACCAGAGCGG + Exonic
1149517689 17:57292754-57292776 CAACCGTGCTGGCCCCAGAAAGG - Intronic
1159240192 18:65732403-65732425 CAGGCCTGGTGGTCCCAGCTTGG + Intergenic
1160160118 18:76464632-76464654 CAAGGCTGGGGGTGCCAGAGAGG - Intronic
1162031247 19:7918104-7918126 CAGCCCAGGAGGTCCCAGTGAGG + Exonic
1162324191 19:9989163-9989185 CGACCCTGGTGGACCCTGGGAGG + Exonic
1162494953 19:11018385-11018407 CAGCCCTGGTCATCCCACAGGGG + Intronic
1165248679 19:34513164-34513186 CAGCCCTGGGAGGCCCAGAGGGG - Intergenic
1165256230 19:34578538-34578560 CAGCCCTGGGAGGCCCAGAGGGG - Intergenic
1165266336 19:34665791-34665813 CAGCCCTGGGAGGCCCAGAGGGG + Intronic
1165365838 19:35364028-35364050 CAAGCCAGGTGGTCCCATAGAGG - Intergenic
1165392873 19:35548399-35548421 CATCCTTGGTGTTCCCAGTGGGG + Intergenic
1166854737 19:45777909-45777931 CAGAGCTGGTGGGCCCAGAGGGG - Intronic
925218341 2:2116747-2116769 CAAGCCTGGTGGTCCTAAGGTGG - Intronic
925332941 2:3072793-3072815 CAACCCTGGGGGCCAAAGAGAGG + Intergenic
925651519 2:6094492-6094514 CAACCCTGGTGGTGTCAAAGTGG - Intergenic
927269799 2:21194002-21194024 TAACCCTGGTGGTTGCGGAGGGG + Intergenic
927759627 2:25741240-25741262 CAACACAGGGGGTCCCAGAGAGG + Intronic
930057861 2:47265628-47265650 CACTCCTGGGGGTGCCAGAGGGG - Intergenic
938685642 2:133735087-133735109 GACCCCTGGTAGTCCCTGAGGGG + Intergenic
942088122 2:172462306-172462328 CACCTCAGGTGGTCCCACAGGGG - Intronic
1168956402 20:1837304-1837326 CAGACCTGCTGATCCCAGAGCGG - Intergenic
1175056625 20:56204574-56204596 CAGCCCTGGGGGTCCCAGAATGG - Intergenic
1176162565 20:63655262-63655284 AGACTCTGGAGGTCCCAGAGAGG - Intergenic
1180067154 21:45418231-45418253 CATCCCTGGTGGGGGCAGAGGGG + Intronic
1184042387 22:41951911-41951933 CAAGCCTGGTGGGCCTAGAGAGG - Intergenic
1185059166 22:48597164-48597186 CACCATTGATGGTCCCAGAGGGG + Intronic
950303521 3:11901343-11901365 CAACCCTGCAGGTCCCCTAGAGG + Intergenic
952971297 3:38651821-38651843 CACACCTTGTGGTCCTAGAGAGG + Intergenic
953495009 3:43378330-43378352 GACCCCTGGTGGTGGCAGAGGGG + Intronic
954147286 3:48640702-48640724 CAACCCTGGTGGTCCCAGAGAGG + Intronic
956412659 3:68994898-68994920 CAACCCTGCTGTGCCCAGAGAGG + Intronic
956595629 3:70963649-70963671 AAACTCTTGTGTTCCCAGAGTGG - Intronic
961642394 3:128372800-128372822 CTAACCTGTTTGTCCCAGAGAGG - Intronic
963642399 3:147876774-147876796 CAAGCTTAGTGGTCCCAGTGAGG - Intergenic
968588525 4:1446169-1446191 CCACCCTGCTGGTCCCTCAGTGG - Intergenic
968730010 4:2265117-2265139 GCACCCTGGGGGTCCCAGAGTGG - Intergenic
969597651 4:8158222-8158244 CAACCCAGGCGCTGCCAGAGCGG + Intronic
969845226 4:9915155-9915177 CCTCCCTGGTGGTCTCAGTGTGG + Intronic
971005546 4:22370395-22370417 CACCCCTGCTGGTGCCAAAGTGG + Intronic
972636336 4:40887133-40887155 CAACCCTGGGGGGCTCAGTGGGG + Intronic
977614120 4:99068699-99068721 CTACCCTGGTTGTCCCAAATTGG - Intergenic
985064289 4:186105438-186105460 CTCGCCTGGTGGTCCCAGCGCGG + Intronic
987029676 5:13964293-13964315 CAACCGTGGAGGAGCCAGAGGGG - Intergenic
988502658 5:31796562-31796584 GAACCCTGATTGTCCCAGCGTGG + Intronic
992813008 5:80408192-80408214 CAGCCCTGCTGTTCCCACAGGGG + Intronic
997709678 5:135993315-135993337 TAACCCTGCTGGTCTCAGTGAGG - Intergenic
999246078 5:150155493-150155515 AAAGACTGCTGGTCCCAGAGTGG + Exonic
1002071123 5:176679560-176679582 GGACCCTGGTGGTCTAAGAGGGG - Intergenic
1002086749 5:176780638-176780660 CAACCCAGGTGGGGACAGAGTGG - Intergenic
1002166541 5:177351249-177351271 CTGCCCTGGAAGTCCCAGAGGGG + Exonic
1002643313 5:180640802-180640824 CCATCCTGGTGGGCCCAGAGAGG - Intronic
1006812630 6:36829880-36829902 GAATCCTGATGGTCCCACAGAGG + Intronic
1015632774 6:135247994-135248016 AAACCCTGCTGGATCCAGAGGGG - Intergenic
1017784569 6:157744665-157744687 CATCCCTGTTGGTTCCAGTGAGG - Intronic
1019706755 7:2500441-2500463 CACCACTGGAGTTCCCAGAGCGG - Intergenic
1023565101 7:41516336-41516358 CATCCTTGGTGGTCCCAATGAGG + Intergenic
1024588537 7:50861294-50861316 CTGCCCTGTGGGTCCCAGAGAGG - Intergenic
1035110426 7:156476859-156476881 AAACCCTTGTGGTCACAGACAGG - Intergenic
1035693345 8:1573994-1574016 CAAGCCTGGAGCTCCCAGAATGG - Intronic
1039227071 8:35400068-35400090 CAACCCTGGTGATGGCTGAGTGG + Intronic
1048866189 8:138763547-138763569 CAGGCCTGGTGTTCCCAGTGGGG + Intronic
1049613587 8:143567060-143567082 CCACCCTGATGGTGACAGAGGGG - Exonic
1051908101 9:22119732-22119754 CAACCCTTTTGGACCCAGACTGG - Intergenic
1053152975 9:35754577-35754599 CACCCCTGGTGGTGGCAGTGGGG - Exonic
1053197971 9:36135012-36135034 GAAACATGGTGGTCCCAGATGGG + Intergenic
1057192166 9:93094372-93094394 CTCCCCTGGAGGACCCAGAGGGG - Intergenic
1057930012 9:99185095-99185117 CTACCCTGCTGGCCCCAGAGCGG - Intergenic
1059143222 9:111874111-111874133 CCAGCCTGGTGATCTCAGAGAGG + Intergenic
1060018611 9:120109257-120109279 CATCTCTGGTGGGCCCTGAGGGG + Intergenic
1061910407 9:133719398-133719420 CAACCCTGGAGGACGCAGAGTGG + Intronic
1062155557 9:135046282-135046304 CATCCCTGGTGGACCCTGGGTGG + Intergenic
1062186504 9:135221309-135221331 CCACCCTTGTGGTCCCCCAGTGG - Intergenic
1062393097 9:136341746-136341768 CAAGCCTGGTGTTCCCAGCCTGG - Intronic
1186442061 X:9595024-9595046 AAACCCTGGTGCTTCCAGACTGG - Intronic
1187009649 X:15266615-15266637 CAACCCTGGTGGGGTCAGGGTGG - Intronic
1189701543 X:43719027-43719049 CCACCCTGGTGGTGCCTGGGGGG + Intronic
1196727737 X:118912269-118912291 AAAAACTGGTGATCCCAGAGTGG - Intergenic
1197730153 X:129803134-129803156 CAATCCAAGTGGTCCCAGAGGGG + Intergenic