ID: 954148327

View in Genome Browser
Species Human (GRCh38)
Location 3:48645316-48645338
Sequence CAGGGTTTTCAGCAGGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 216}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954148327_954148338 19 Left 954148327 3:48645316-48645338 CCAGCATCCTGCTGAAAACCCTG 0: 1
1: 0
2: 0
3: 17
4: 216
Right 954148338 3:48645358-48645380 TGACCTCTGACCCTGAGTTTTGG 0: 1
1: 0
2: 2
3: 11
4: 180
954148327_954148340 26 Left 954148327 3:48645316-48645338 CCAGCATCCTGCTGAAAACCCTG 0: 1
1: 0
2: 0
3: 17
4: 216
Right 954148340 3:48645365-48645387 TGACCCTGAGTTTTGGCCCCAGG 0: 1
1: 0
2: 2
3: 15
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954148327 Original CRISPR CAGGGTTTTCAGCAGGATGC TGG (reversed) Intronic
901643079 1:10702841-10702863 CAGGGCTCTCTGCACGATGCCGG + Intronic
903145880 1:21371779-21371801 CAGGGTTGGCAGCAGGGAGCTGG + Intergenic
903314394 1:22490082-22490104 CAGGGTTTTGAACAGGAGGCTGG - Exonic
906698002 1:47837673-47837695 CAGAGTTTTCAGGAGGACTCGGG - Intronic
911577525 1:99596227-99596249 CATGGGTTTCACCAGGAAGCTGG + Intergenic
913328214 1:117646276-117646298 CAGGTTTCTCTGGAGGATGCTGG + Intergenic
917297719 1:173539218-173539240 TAGGGTTTTAAGCAGGAAGGAGG + Intronic
918213663 1:182374307-182374329 TAGGGATTCCTGCAGGATGCTGG + Intergenic
918792777 1:188851605-188851627 CAGCGTTTTCAGCATGTTGTTGG - Intergenic
921374604 1:214460850-214460872 CATGGCTTTCAGAAGGATCCAGG - Intronic
921739054 1:218662948-218662970 CAGGGATTTCATGAGGATGATGG - Intergenic
922562915 1:226582080-226582102 CAGGGCTTCCAGGAGGAGGCTGG - Intronic
924607812 1:245550460-245550482 GAGCGTTTACAGCAGGGTGCTGG - Intronic
924801345 1:247331453-247331475 GAGGGTTTTCGGCCGGACGCCGG - Exonic
1062929149 10:1340987-1341009 CAGGGTTCTCTGGTGGATGCTGG - Intronic
1066654852 10:37687771-37687793 GAGGCTTTTCAGCAGGGAGCTGG + Intergenic
1067039804 10:42943241-42943263 GAGGCTTTTCAGCAGGGAGCTGG + Intergenic
1069793156 10:71036194-71036216 CAGGGTTTTCTGCATGGTTCAGG - Intergenic
1070539159 10:77403758-77403780 CAGGGTCTTCTGCAGGAGGCTGG - Intronic
1070821277 10:79356168-79356190 CAGGGTTTTTGGCAGTCTGCAGG + Intergenic
1073479803 10:103779371-103779393 CGGGGGTATCAGGAGGATGCTGG - Intronic
1074420863 10:113307918-113307940 TAGGGTTTTGAGCAGAAAGCTGG - Intergenic
1074724843 10:116297396-116297418 CAGGCTTTTCAAGAGGATACAGG - Intergenic
1075668268 10:124245831-124245853 CAGGGACTGCAGGAGGATGCTGG + Intergenic
1075733128 10:124648121-124648143 GAGGGTTTTCTGGAGGAGGCAGG - Intronic
1076644515 10:131943468-131943490 CAGGGTGCACAGCAGGGTGCTGG - Intronic
1077065238 11:638130-638152 CAGGGTTCTCAGCAGGGGCCTGG - Intronic
1077228798 11:1449629-1449651 CAGGGTGTGCAGCAGGACCCAGG + Intronic
1078432403 11:11298133-11298155 CAGGGTATCCTGCAGGATGGGGG - Intronic
1079388457 11:20000978-20001000 AAGGGTTTTCAGCAGGCAGGTGG - Intronic
1079785545 11:24666848-24666870 CAGATTTTTCAGCAAGATCCTGG - Intronic
1081340777 11:41924519-41924541 CAGGGTATTCAGCAGCATCCTGG - Intergenic
1081595317 11:44454755-44454777 CAGGGTTTCGAGAATGATGCAGG + Intergenic
1084604851 11:70166471-70166493 CAGGGTTTCCAGATGGAGGCTGG + Intronic
1084657654 11:70528588-70528610 CTGGGCCTTCATCAGGATGCAGG - Intronic
1086933196 11:92715997-92716019 AAGGTTTTTGAGCAGGATGGTGG + Intronic
1088807321 11:113364435-113364457 CAGGGTATGCAACAGGATCCAGG - Intronic
1090475838 11:127019135-127019157 CAGTGTTTTCAGCAGGAAGGAGG + Intergenic
1090663782 11:128901621-128901643 CAGGGTGTTGACGAGGATGCAGG - Exonic
1091985906 12:4910174-4910196 CAGGGAGTTCCGGAGGATGCGGG - Exonic
1092278627 12:7081981-7082003 CAGGGTCTTTAGCAGCCTGCAGG - Intronic
1092747609 12:11688569-11688591 CAGGTTACACAGCAGGATGCAGG - Intronic
1093920155 12:24850401-24850423 CAGGGTCTTCAGCAGGTGGTAGG + Intronic
1095727060 12:45465473-45465495 ACGGGTTTTGAGCAGGATGTTGG - Intergenic
1096385253 12:51191006-51191028 CAGGATTCTCCACAGGATGCTGG + Intronic
1096588173 12:52637517-52637539 CAGCTGTTTCAGCAGGCTGCTGG + Intergenic
1098243868 12:68495860-68495882 GAGGGTTTTCATTAGAATGCTGG - Intergenic
1100551478 12:95650176-95650198 CAGGGTGTACACCAAGATGCTGG - Intergenic
1100699998 12:97137334-97137356 CACTATTTTCAGCAGGCTGCTGG - Intergenic
1101804348 12:108050600-108050622 AAGAGTTTTCAGCAGGGAGCTGG + Intergenic
1106185972 13:27410391-27410413 CAGACTTTCCAGCAGAATGCTGG + Intergenic
1108685199 13:52813447-52813469 CAGAGGTTTCAGCAGAAGGCTGG + Intergenic
1109429170 13:62209656-62209678 CGGCGTTTACAGCAGGAGGCAGG + Intergenic
1111620577 13:90719858-90719880 CAAGTATTTCAGTAGGATGCAGG + Intergenic
1113393507 13:109920661-109920683 CAGGTTTTTCTGCCTGATGCTGG + Intergenic
1114648933 14:24271101-24271123 CAGGGTTCTCACCATGGTGCCGG + Exonic
1117512120 14:56463038-56463060 CAGTGTTTCCTGCATGATGCCGG + Intergenic
1118132758 14:62986074-62986096 CACGGTTGTCAGCAGGATAGTGG - Intronic
1121417864 14:93791335-93791357 CAGGGGCGTCAGCAGGATGTGGG - Intergenic
1121541925 14:94734144-94734166 CAGTGGATTCATCAGGATGCAGG - Intergenic
1121916526 14:97840771-97840793 AAGGGTTCTCAGCGGGATGAAGG + Intergenic
1125315725 15:38429132-38429154 AAGGATTTTGAGCAGGATCCAGG - Intergenic
1126099387 15:45110663-45110685 GAGTGTTTTCTGCAGGAAGCTGG + Exonic
1126104144 15:45136375-45136397 GAGTGTTTTCTGCAGGAAGCTGG - Exonic
1128458510 15:67847842-67847864 CAGGGTTCTCAGGACCATGCTGG + Intergenic
1128609869 15:69064967-69064989 CAGTGTTTGGAGAAGGATGCAGG - Intergenic
1128879821 15:71232660-71232682 AAGGGTTGTGAGCAGGATACAGG + Intronic
1130202926 15:81850236-81850258 GAGAGTTTTGAGCATGATGCTGG - Intergenic
1130311222 15:82756901-82756923 CAGACTTATCAGCAGGTTGCAGG + Exonic
1131451456 15:92543846-92543868 CAGGGTGTTCACCAAGATGCTGG - Intergenic
1131681823 15:94731506-94731528 CAGGAATTGCAGCAGGATGGTGG - Intergenic
1132331356 15:101014380-101014402 CAGGGTTTTGAGCTGCCTGCAGG - Exonic
1132558786 16:584232-584254 CAGGGCCTCCAGCAGGAGGCCGG - Intergenic
1134366025 16:13579902-13579924 CAGGGTTTTCAGCTGGAAAATGG + Intergenic
1135046365 16:19159247-19159269 AAGGGTTATTAGCAGGAAGCTGG - Intronic
1137753927 16:50886628-50886650 CTGGGTCTTCAGCAGCAGGCGGG + Intergenic
1139524235 16:67503826-67503848 CAGAGTCTTCAGCAAGTTGCTGG - Intergenic
1140612243 16:76614287-76614309 CAGAGTTTCCAGATGGATGCTGG + Intronic
1140802128 16:78498232-78498254 CAGGGTTGTCACCATGAAGCAGG + Intronic
1142713602 17:1736400-1736422 CAGGGGTCTCAGCAGGAGGCAGG + Intronic
1143163280 17:4885152-4885174 AGGGATTTTCAGCAGGAGGCAGG - Intronic
1143850009 17:9803848-9803870 CAGGGTTTGCAGCCGCATCCAGG - Intronic
1144825472 17:18103389-18103411 CAGGGATTTCAGCAAGAAGAGGG - Intronic
1144955667 17:19017705-19017727 CAGGGTTTCCAGGAGGCTGTGGG - Intronic
1147667125 17:42155807-42155829 AAGAGTTCTCTGCAGGATGCTGG + Intergenic
1151898903 17:76998734-76998756 CAGGATTTACAGCAGGATGAAGG - Intergenic
1153238368 18:3010016-3010038 CTTGATTTTCAGCAGGAAGCTGG - Intronic
1154017310 18:10630481-10630503 CAGGGTGTTCATCACCATGCAGG - Intergenic
1154187550 18:12199116-12199138 CAGGGTGTTCATCACCATGCAGG + Intergenic
1157792513 18:50545502-50545524 CAGGCTTTTCAGCTGGAGGGTGG - Intergenic
1159001983 18:62982543-62982565 CTGGATTTCCAGCAGGAAGCAGG - Intergenic
1161383188 19:3977296-3977318 CGGGGTTTTGAACAGGAAGCGGG - Exonic
1163413563 19:17172061-17172083 CAGCGTGTTCAGCATGAGGCAGG + Intronic
1164672019 19:30077649-30077671 CAAGGTTTTAAGCAGGAACCAGG - Intergenic
1164694664 19:30234317-30234339 CTGGCTCTTCAGCTGGATGCTGG + Intronic
1165043564 19:33086076-33086098 CAGGATGTTCAGCAGCATCCTGG - Intronic
1165232008 19:34393176-34393198 CAGGGTTTCCGGCAGGAGGTGGG + Intronic
1165622796 19:37262545-37262567 CAGGGATTCCAGGAGGATCCAGG - Intergenic
1165634490 19:37329175-37329197 CAGGGATTCCAGGAGGATCCAGG - Intronic
1165933478 19:39375260-39375282 CAGGGATTTGAGCAGGAGTCAGG + Intronic
1166108246 19:40608091-40608113 CAGGGGTTTGAGCTGGAGGCTGG - Intronic
1166538839 19:43592702-43592724 GAGGGTTTGCAGCAGGTTGTCGG - Exonic
1167591351 19:50406145-50406167 CAGGGTGTGCAGCAGGCTGCGGG - Intronic
1168341429 19:55625247-55625269 CGGGGTTTTCAGCAGCATCAAGG + Intergenic
925238110 2:2296978-2297000 CAGGTTTCTCTGCAGGAAGCTGG + Intronic
927477496 2:23425322-23425344 CAGGGATTTCAGGAGGGAGCTGG + Intronic
927484138 2:23477429-23477451 CTTGGTTGTCAGCAGGAAGCGGG + Intronic
927577633 2:24212686-24212708 CATGGGTTTCAGCAGGAAGCTGG + Exonic
927998790 2:27505764-27505786 CAGGGTTTCCAGCAGAATCTTGG - Exonic
928436286 2:31256729-31256751 CAGGGATTGCAGCAAGTTGCAGG + Intronic
929836573 2:45406522-45406544 CAGGGTTTTCAGCAAGAGGATGG - Intronic
929883293 2:45855938-45855960 CAGGGTTTTCATGATGATGATGG + Intronic
930028987 2:47046993-47047015 CAGGGTCTCCAGCAGGAGACAGG - Intronic
936008516 2:108910213-108910235 CAGGGAATTTGGCAGGATGCAGG + Intronic
937070517 2:119059757-119059779 CAGGGTTCCCAGCAGACTGCTGG - Intergenic
942614291 2:177774186-177774208 CAGGCTTTTCAACAAGAAGCTGG - Intronic
943048732 2:182890296-182890318 CTGGGTTTTCTGAGGGATGCAGG - Intergenic
944169698 2:196760961-196760983 CAAGGTTTTCAGCAGGAGAAAGG - Intronic
945904068 2:215570817-215570839 CAGGATTTTCAATAAGATGCTGG - Intergenic
945942634 2:215965278-215965300 CAGTGTTTTCAGCTGAATACTGG - Intronic
946373097 2:219292389-219292411 CAGGGATATCAGGAGTATGCAGG - Intronic
1168850084 20:970363-970385 GAGGGTTATCAGCAGGATGTGGG - Intronic
1169834792 20:9866031-9866053 AAGGGTTTTAAGCAGGGTGTGGG + Intergenic
1170805620 20:19628302-19628324 CAGTGATTTCAGCAAGATGGTGG + Intronic
1171321288 20:24246746-24246768 CAGGGTCTTAAGCAGGGAGCTGG + Intergenic
1172696758 20:36828278-36828300 CAGGGGGTTCTGCAGAATGCCGG - Intronic
1173020579 20:39264667-39264689 CAGGCTTTTCTGTGGGATGCAGG - Intergenic
1174286271 20:49475936-49475958 CAGGGTTGTCTGAAGGATGAAGG - Intronic
1174609675 20:51788828-51788850 GTGGGCTTTCAGCAGGATGGGGG - Intronic
1174834091 20:53839800-53839822 CAGGGTGAGGAGCAGGATGCAGG - Intergenic
1175260595 20:57671773-57671795 CAGGGTGTTCAGCAGCAACCTGG + Intronic
1179929304 21:44556755-44556777 AATTGTTTTCAGCAGGATGATGG - Intronic
1180016607 21:45090241-45090263 CAGGATTTTCCCCAGAATGCAGG - Intronic
1180832572 22:18913489-18913511 CCCGGTGGTCAGCAGGATGCAGG + Exonic
1182897809 22:33873425-33873447 CAGGGCTTTCAGCCGGGGGCAGG - Intronic
1183871169 22:40743531-40743553 CAGGGTTTTCACCATCAGGCCGG - Intergenic
1185239236 22:49733758-49733780 CAGGGCTTTGAGCTGGATGCAGG + Intergenic
1203282658 22_KI270734v1_random:138794-138816 CCTGGTGGTCAGCAGGATGCAGG + Intergenic
950047139 3:9955467-9955489 CAGAGTCTGCAGAAGGATGCTGG - Intergenic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
954148327 3:48645316-48645338 CAGGGTTTTCAGCAGGATGCTGG - Intronic
955473229 3:59308830-59308852 GAGAGTTTTCAGAAGGATGATGG + Intergenic
956349645 3:68320709-68320731 CATGGTTTTCATCAGGAAACTGG - Intronic
957079067 3:75621895-75621917 CAGGGTTTCCACCAGGGAGCAGG - Intergenic
959832016 3:110875339-110875361 CAGGATTTGCCGCAGCATGCTGG + Intergenic
960521666 3:118662300-118662322 CCAGGTTTTCTTCAGGATGCTGG - Intergenic
962082413 3:132154594-132154616 TAGAGTTTTCAGAAGCATGCTGG + Intronic
962903095 3:139777614-139777636 CATAGTATTCATCAGGATGCTGG - Intergenic
963962844 3:151328864-151328886 CAAAGTATTCAGCAGGATGCCGG + Exonic
965213417 3:165826887-165826909 CAGGGTGTTTAGCAGCATGCTGG + Intronic
966318755 3:178677583-178677605 CAGGGGTTTTAGGAGGAGGCTGG - Intronic
967131930 3:186478541-186478563 CAGGGGTTTCAGAAGGAGGTTGG - Intergenic
969193886 4:5545505-5545527 CAGAGTTATCAGGAGGAAGCAGG + Intronic
970448044 4:16140258-16140280 CAGGGGTTTCAGAGGGAGGCTGG + Intergenic
971449155 4:26784033-26784055 CAGGGCTTCCAGGAGGATGGAGG - Intergenic
976205476 4:82619602-82619624 CAGGGTGTTCAGCAGGGTGGAGG + Intergenic
985985304 5:3510752-3510774 CAGGGCTGGCAGCAGGATGGGGG + Intergenic
988835855 5:35031712-35031734 CAGGGTTGTCAGCAGCCTGTAGG + Intronic
989565715 5:42899069-42899091 CTGGGTTTTCAGCAGCTTCCGGG + Intergenic
989573888 5:42971365-42971387 CTGGGTTTTCAGCAGCTTCCGGG - Intergenic
990466170 5:56073914-56073936 CAGGGTATGCACCAGGAGGCTGG + Intergenic
996092265 5:119362819-119362841 GATGGTTTTCAGCTGGATGGAGG + Intronic
996270738 5:121602098-121602120 CTGGGTTTTGAGCAGAATACTGG + Intergenic
996351493 5:122547769-122547791 CAAAGTGTTCAGCAGGATGTAGG - Intergenic
997249125 5:132375322-132375344 CATTGATTTCAGCAGGAGGCAGG + Intronic
998135543 5:139672520-139672542 AAGGGTTTTGAGCAGGACGCAGG - Intronic
998707721 5:144782929-144782951 AAGGGTTTGCAGCAGGAGGTGGG + Intergenic
1002262641 5:178005530-178005552 CAGCTTTTTCAGCATGGTGCAGG - Intergenic
1003567218 6:7231332-7231354 CTTGGTTTTCAGCAGGGTGGGGG - Exonic
1004142384 6:13030944-13030966 CAGGATGTTCAGCAGTATCCTGG + Intronic
1004900399 6:20188357-20188379 GAGGGTCTTCAGGAGGAAGCAGG - Intronic
1009948247 6:70364758-70364780 CAGGCTTTTCAGCTGGAGGGTGG + Intergenic
1011303592 6:85902116-85902138 CCAGGTTTGAAGCAGGATGCTGG + Intergenic
1013051458 6:106539448-106539470 CAGGGTATTCACCAGGTTCCAGG - Exonic
1013308605 6:108872734-108872756 AAGGGTTTTCAGCAAGAGGGTGG - Intronic
1015282754 6:131451488-131451510 CAGGGAATTCAGCATCATGCTGG + Intergenic
1015892321 6:137981164-137981186 CAGGGTTTTCAACTGGGGGCTGG - Intergenic
1017492758 6:154958781-154958803 CAGGGTGGGCAGCAGGATGAAGG - Intronic
1017541398 6:155406695-155406717 CAGGATTTACAGCCAGATGCTGG + Intronic
1018939973 6:168302623-168302645 AAGGGTTTGCAGCAGGAGGGAGG + Intronic
1021707530 7:23382336-23382358 CAGTGTTTTCTGAAAGATGCAGG - Intronic
1022140975 7:27492532-27492554 CAGTCTTTGCAGCAGGGTGCAGG - Intergenic
1023579873 7:41670378-41670400 CAGGGGTTTCAGTTTGATGCTGG - Intergenic
1023698067 7:42867765-42867787 CTGGTTTCTCAGCAGGGTGCTGG - Intergenic
1024554481 7:50591775-50591797 GGGGGTTTTCAGCAGGACGGAGG + Exonic
1025027260 7:55526811-55526833 CAGGGTTTGCTTCAGGATGGTGG + Intronic
1025935522 7:66032758-66032780 CATTGTTTTCAGCAGTCTGCAGG + Intergenic
1026178321 7:68017045-68017067 CAGGGTTTTCAGCACCATAGTGG - Intergenic
1029543613 7:101198834-101198856 CGGGGTGTTGAGCAGGATGAAGG + Intronic
1031063467 7:117077318-117077340 CAGGTTTTTCAGCTGGAGGGTGG + Intronic
1032457698 7:132086343-132086365 CATGCTTGTCAGCAGGATGGAGG + Intergenic
1034889796 7:154829785-154829807 GAGGGCTTTGAGCAGGATGGAGG - Intronic
1035381683 7:158444916-158444938 CCGCGTTTTCAAGAGGATGCAGG - Intronic
1035786818 8:2267868-2267890 CAGGGTTATCTGCAGGAGACAGG - Intergenic
1035805989 8:2453848-2453870 CAGGGTTATCTGCAGGAGACAGG + Intergenic
1035814612 8:2526125-2526147 CAGGGATCTCAGAAGGATGAAGG + Intergenic
1036170089 8:6475475-6475497 CTGGGTTTTCCCCGGGATGCTGG - Intronic
1039166094 8:34681651-34681673 CAGGGTTTTCTGTAGAATGTGGG + Intergenic
1039562987 8:38528001-38528023 AGGGGGTTTCAGCAGGAAGCGGG + Intronic
1040292081 8:46130674-46130696 CAGGCTTTGGAGCAGGGTGCTGG - Intergenic
1041276582 8:56166235-56166257 CAAGCTTTTCAGTAGGATTCTGG - Exonic
1046631541 8:116626927-116626949 CAGGCTTTTCAGCAGGTGGAGGG + Intergenic
1048281116 8:133106271-133106293 TGGGGTTTGCAGCAGGAGGCAGG + Intronic
1048344688 8:133567805-133567827 GAGGGTTTTGAGGATGATGCTGG + Intronic
1048514271 8:135091503-135091525 CAGGGTTTTCTGCAGCACTCAGG + Intergenic
1049378777 8:142301784-142301806 CAGGGTTTTCAGGAAGATCGGGG - Intronic
1049664453 8:143836793-143836815 CAGGGCAGGCAGCAGGATGCAGG + Intronic
1050986702 9:12091803-12091825 TAGGGTTTTCAGTAGGACTCTGG + Intergenic
1052203620 9:25811540-25811562 GAGTGTTTTCAGGAGGAAGCAGG + Intergenic
1053104447 9:35398212-35398234 CACGTTGTTCATCAGGATGCAGG - Exonic
1053443112 9:38131765-38131787 CTAGGTTGGCAGCAGGATGCAGG - Intergenic
1053495446 9:38545387-38545409 CAGGGTGGGCAGCAGGGTGCAGG - Intronic
1054766254 9:69045002-69045024 CAGGGTGGTTAGCAGGAGGCTGG - Intronic
1055582077 9:77716482-77716504 AAGGGTTTCCAACAGGATGATGG + Exonic
1056795709 9:89657379-89657401 CAGTGTTTTCAGGTGGAAGCAGG - Intergenic
1056935748 9:90913852-90913874 CAGGTTTTTCAGCAGACAGCAGG - Intergenic
1059235293 9:112755520-112755542 CAGGGTCTTGAGCAGGAGGGGGG + Intronic
1060013942 9:120070072-120070094 GAGAGTGTTCAGCAGGCTGCAGG + Intergenic
1060197273 9:121631877-121631899 CAGGGCTTTCAGCAGGGAGCAGG + Intronic
1060222777 9:121773335-121773357 CAGGGTGCTCAGCAGGTTGGGGG - Exonic
1061248741 9:129414434-129414456 CAGAGTTTTCTGCGGGATGAGGG - Intergenic
1061917325 9:133762091-133762113 GATGGTTTTCAGCAGGAGACGGG - Exonic
1186958785 X:14712250-14712272 CAGGATGTTCAGCAGTATCCTGG + Intronic
1191157246 X:57287050-57287072 CAGGTCTTTTAGCAGGATCCAGG + Intronic
1193014286 X:76714955-76714977 CAGGGCTTTGACCAGGATGATGG + Intergenic
1194447998 X:94010229-94010251 TTGGGTTTTGACCAGGATGCAGG + Intergenic
1194939713 X:99995060-99995082 TAGGGTTTTCCCCAAGATGCTGG - Intergenic
1196622455 X:117839220-117839242 CTGGGTTTTGAGCAGGACCCAGG - Intergenic
1196641647 X:118069073-118069095 CCCTGTTTTCACCAGGATGCAGG - Intronic
1199503213 X:148532666-148532688 CAGTGTTTTAAGCAGGATATTGG + Intronic
1199982753 X:152929776-152929798 CAGGGCTTTCTGCAGGGGGCTGG - Intronic
1200358594 X:155578265-155578287 CAGGGTTGTCTCCAGGCTGCCGG - Intronic
1201641870 Y:16188162-16188184 CAGCTTTTTCACCAGAATGCAGG + Intergenic
1201660945 Y:16397159-16397181 CAGCTTTTTCACCAGAATGCAGG - Intergenic