ID: 954149572

View in Genome Browser
Species Human (GRCh38)
Location 3:48650671-48650693
Sequence CAGCAGGAGTGGCGGGCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 1, 2: 2, 3: 32, 4: 318}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954149572_954149580 14 Left 954149572 3:48650671-48650693 CCCACTGCCCGCCACTCCTGCTG 0: 1
1: 1
2: 2
3: 32
4: 318
Right 954149580 3:48650708-48650730 GACCTGTCAGATTCTGTGACAGG 0: 1
1: 0
2: 0
3: 16
4: 185
954149572_954149582 30 Left 954149572 3:48650671-48650693 CCCACTGCCCGCCACTCCTGCTG 0: 1
1: 1
2: 2
3: 32
4: 318
Right 954149582 3:48650724-48650746 TGACAGGTCAGCAAAGTACTTGG 0: 1
1: 0
2: 2
3: 10
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954149572 Original CRISPR CAGCAGGAGTGGCGGGCAGT GGG (reversed) Intronic
900140252 1:1136834-1136856 CAGCAGGAGGGGCGGCCGGGTGG + Intergenic
901401126 1:9015677-9015699 CAGCAGGGGTGGGAGGCAGACGG - Intronic
901606261 1:10461736-10461758 CAGCAGGAGAGGCGCACAGAAGG - Intronic
901787014 1:11631401-11631423 TTGCCGGAGTGGCAGGCAGTGGG - Intergenic
901849588 1:12007047-12007069 CTGCAGGTGTGGAAGGCAGTGGG + Exonic
901882372 1:12201875-12201897 CAGGAGGTGTGGATGGCAGTGGG + Intronic
901882427 1:12202115-12202137 CACCAGGCGTGGAGGCCAGTGGG + Exonic
902490788 1:16779249-16779271 CAGGAGGAGAGCCGGGCAGGTGG + Intronic
902772068 1:18650929-18650951 AAGCAGGAGTTGGGGACAGTAGG - Intronic
903277067 1:22229018-22229040 GAGCAGGGGTGGCTGGCAGATGG + Intergenic
904946460 1:34202313-34202335 GAGAAGGAGTGGCTGGCAGGGGG + Intronic
905197873 1:36295259-36295281 CAGCAGGAGTGGCAGAAACTAGG - Intronic
905615855 1:39398122-39398144 AAAAAGGAGTGGCGGGGAGTGGG - Intronic
906091371 1:43182208-43182230 CAGCAGCATTGCCGGGCAGTAGG + Intronic
906572783 1:46858694-46858716 CAGCAGAACTGGGGGGCAGGAGG + Intergenic
906598986 1:47107194-47107216 CAGCAGAACTGGGGGGCAGGAGG - Intronic
907284351 1:53370553-53370575 CAGCACCAGGGGCTGGCAGTGGG + Intergenic
910361574 1:86417745-86417767 CAGGTGGAGTGGGGGCCAGTTGG - Intergenic
911261671 1:95693789-95693811 CAGCAGGTGGTGAGGGCAGTGGG + Intergenic
912477371 1:109947802-109947824 CTGCAGGAGTGGCAGGCCTTGGG - Intergenic
913176369 1:116276686-116276708 CAGGAGGAGAGGCGAGCAGTGGG - Intergenic
915227280 1:154420297-154420319 CCGCAGGAGTGGGGGCCTGTGGG + Intronic
916299676 1:163259812-163259834 AATCCGGAGTGGCTGGCAGTGGG + Intronic
916464819 1:165063211-165063233 CAGTTGTAGTGGCTGGCAGTAGG + Intergenic
918873401 1:190006706-190006728 CAACAAGACTGGTGGGCAGTGGG - Intergenic
920128714 1:203714092-203714114 TAGAAGGAGTGGCGGGTGGTAGG + Intronic
920219258 1:204384369-204384391 AAGCAGGTGTGGCAGGGAGTTGG + Intergenic
920832400 1:209477417-209477439 CACCAGGAGTGCCAGCCAGTTGG - Intergenic
921448408 1:215273545-215273567 CAGCATGAGATGAGGGCAGTAGG - Intergenic
922514326 1:226195549-226195571 CTGCAGGAGAGGCTGGCAGCAGG + Intergenic
922975792 1:229782365-229782387 AAACAGGAGTGGCGGGAAGAGGG + Intergenic
923529656 1:234803286-234803308 CAGGAGGAGAGCCGGGCAGGTGG - Intergenic
924737655 1:246772873-246772895 CAGGAGGAGTTCCAGGCAGTGGG - Intergenic
1062860605 10:806523-806545 CAGCAGGAGTGTGCGGCAGCTGG - Intergenic
1065695579 10:28376678-28376700 AAGCAGGAGAAGGGGGCAGTGGG + Intergenic
1066502524 10:36007928-36007950 CTGCAGGAGCAGTGGGCAGTGGG + Intergenic
1067144913 10:43687961-43687983 CAGCAGGATTTGCTGACAGTGGG + Intergenic
1067840084 10:49668737-49668759 CAGCAGGAGTGGAGGGGAAAGGG + Intergenic
1068816429 10:61320178-61320200 CAGCAGGACTAGCGGGTAGGAGG - Intergenic
1069703328 10:70441638-70441660 CAGAAGGAAGGGCAGGCAGTGGG + Exonic
1070660948 10:78304835-78304857 CACCAGGACTGGTGGGCAGTGGG - Intergenic
1070805726 10:79269665-79269687 CAGCAGCAGTGGGGTGCAGGGGG - Intronic
1071563299 10:86659107-86659129 TAGCAGGAATGGGAGGCAGTGGG + Intronic
1075929815 10:126286274-126286296 CAGCAGGTCTGGCAGGCAGGAGG + Intronic
1076533411 10:131160403-131160425 CAGAGGGAGTGGCGGGGTGTAGG - Intronic
1076533425 10:131160445-131160467 CAGAGGGAGTGGCGGGGTGTAGG - Intronic
1078438059 11:11341782-11341804 AAGAAGGAGTTGGGGGCAGTGGG - Intronic
1078829890 11:14969091-14969113 GAGCAGGAGGGGCAGGCAGGAGG + Intronic
1083293252 11:61701378-61701400 CAGAGGGAGAGGCGGGCAGCAGG - Intronic
1083594063 11:63910771-63910793 CAGTAGGAGTGTGGGGCAGGAGG - Exonic
1084480146 11:69415322-69415344 CAGCAGAGGTGGGGGGCAGGAGG + Intergenic
1084640397 11:70422667-70422689 CAGGAGGGGCGGCGGGCAGCAGG - Intronic
1085313544 11:75530185-75530207 GAGCAGGAGGGGCAGGCAGGTGG - Intergenic
1085819725 11:79779585-79779607 CCTCAGGAGTAGAGGGCAGTTGG + Intergenic
1086211955 11:84331568-84331590 CGGCAGGGGAGGTGGGCAGTGGG + Intronic
1087701599 11:101441780-101441802 CAGCAGCAGTGGCAGGGGGTGGG + Intergenic
1088018107 11:105084627-105084649 CAGCAGGAGAGGTGGGGAGAAGG - Intronic
1088803973 11:113334066-113334088 CAGCAGAAGTGGCGTGTTGTTGG - Intronic
1088865138 11:113840178-113840200 CTACAGGATTGGTGGGCAGTTGG - Intronic
1089376057 11:117995652-117995674 CAGCTGGAGGGCCAGGCAGTAGG - Exonic
1091461385 12:646077-646099 CAGTAGTAGTGGCTGGCAGCGGG - Intronic
1091714923 12:2770231-2770253 CTGCAGGCATGGAGGGCAGTGGG - Intergenic
1096581791 12:52590452-52590474 CAGCAGGGGTGGCAGGGAGCAGG - Intronic
1096828832 12:54299276-54299298 CAGCAGAGCTGGCAGGCAGTGGG + Intronic
1099957849 12:89368643-89368665 CATCAGGTGGGGAGGGCAGTGGG + Intergenic
1103064989 12:117890031-117890053 CAGCAGCTGTGGCAGGGAGTAGG - Intronic
1104357304 12:128099100-128099122 CAGCAGGGGTGCCGGGCAGTTGG - Intergenic
1104908468 12:132228192-132228214 CTGCATGAGTGGAGGGCAGAGGG - Intronic
1104968973 12:132522663-132522685 CAGCAGGTGGGGCGTGCAGCAGG - Intronic
1105439060 13:20400832-20400854 CAGCTCGAGAGGCTGGCAGTGGG - Intergenic
1106052662 13:26206199-26206221 CAGCAGGGACGGGGGGCAGTGGG - Intronic
1106647017 13:31647315-31647337 CAGCAGGAGTGAGGAGCAGAAGG - Intergenic
1108315059 13:49228665-49228687 CAGCAGGAGAGGCTGGCTCTTGG - Intergenic
1109229415 13:59738354-59738376 GATCAGGAGTGGCTGGCTGTAGG + Intronic
1109237616 13:59843944-59843966 CTGTATGAGTGGCGGGCAGGAGG + Intronic
1110533764 13:76627472-76627494 CAGCAGGAGTGGCAAGAAGATGG + Intergenic
1113434919 13:110283801-110283823 CAGCAGCAGTGGGTGGCATTTGG + Intronic
1113601761 13:111574381-111574403 CAGCAGCATTTTCGGGCAGTGGG - Intergenic
1114008023 14:18334000-18334022 GTGGAGGAGTGGCGGGCAGCGGG + Intergenic
1114463295 14:22902067-22902089 CAGCAGCAGTGCTTGGCAGTTGG + Exonic
1119392828 14:74302822-74302844 GAGCAGGAGTTCCGGGCTGTAGG - Intronic
1119522484 14:75296162-75296184 CTGCAGGACGGGAGGGCAGTTGG - Intergenic
1120365354 14:83561601-83561623 CAGCAGGTGTGTTGGGCTGTGGG - Intergenic
1120969060 14:90192287-90192309 CAGCGGGAGTGGGGGGCAGGAGG + Intergenic
1121117166 14:91351917-91351939 CTGCAGGCGTGGCAGGCAGGTGG - Intronic
1122037661 14:98960502-98960524 CAGGCGGGGTGGCGGGCAATGGG - Intergenic
1122072597 14:99214206-99214228 AATCTGGAGTGGAGGGCAGTAGG - Intronic
1122252110 14:100447375-100447397 TAGCAGCAGTGCTGGGCAGTAGG + Intronic
1122323557 14:100869307-100869329 CAGCTGGGGTGGTGGGCAGGGGG + Intergenic
1122323744 14:100870349-100870371 CAGCTGGGGTGGTGGGCAGGGGG + Intergenic
1123050010 14:105536788-105536810 CACCAGGAATGGCGTGGAGTAGG + Intergenic
1124596660 15:31096929-31096951 CAGCAGGAGTGAGGGGTAGGCGG + Intronic
1125721377 15:41846753-41846775 CTGCAGGAGGGGCAGGCAGCTGG - Exonic
1126338187 15:47609866-47609888 CAGGGGCAGTGGCAGGCAGTGGG - Intronic
1127221743 15:56887409-56887431 AGGCAGGGGTGGCGGGAAGTGGG + Intronic
1127497169 15:59524202-59524224 CACCAGAGGTGGGGGGCAGTTGG + Intergenic
1128511508 15:68316454-68316476 CTGCAGGAGTGGCTGGGCGTGGG + Intronic
1128553742 15:68615988-68616010 CAGCAGGTCTGGCGCACAGTAGG - Intronic
1129258071 15:74345475-74345497 CAGAGGGAGTGGAGGGGAGTTGG - Intronic
1129331985 15:74832452-74832474 AGGCAGGGGTGGTGGGCAGTGGG + Intergenic
1129856742 15:78830426-78830448 AAGCAGGGCTGGCGGGCAGGGGG + Intronic
1130381729 15:83377852-83377874 CAGCAGGAATGGCAGGTGGTGGG - Intergenic
1130659116 15:85816031-85816053 CAAAATGAGTGGCGGGCAGGAGG + Intergenic
1131335102 15:91541360-91541382 CAGCTTGAGTTGAGGGCAGTGGG + Intergenic
1131400779 15:92124042-92124064 CTGCAGGAGGGGCTGGCAGTGGG + Intronic
1131754849 15:95548703-95548725 CTGCAGGAGAGGTGGGCACTTGG - Intergenic
1131942757 15:97585245-97585267 CAGCAGGTGTGTTGGGCTGTGGG + Intergenic
1132378335 15:101347844-101347866 CAACAGGAGTGGAGGGCAGCAGG + Intronic
1133116343 16:3579890-3579912 CAGCAAGACTGGCAGGCAATGGG - Intergenic
1133507777 16:6429307-6429329 CAGCAGCAGTGGTGGGGAGCTGG - Intronic
1134154879 16:11835107-11835129 TAGCGAGAGTAGCGGGCAGTGGG - Exonic
1138450485 16:57091288-57091310 CAGCAGGAGAGCCAGGCACTGGG - Intergenic
1139281589 16:65775086-65775108 CCCCAGGTGTGGCGGGCCGTGGG - Intergenic
1141378824 16:83557002-83557024 CAGCAGGAGAGGTGAGCAGTGGG + Intronic
1141395593 16:83701742-83701764 TAGCAGGAGTGCTGGGCAATTGG - Intronic
1141662014 16:85446570-85446592 CAGCAGGAGTGGAGAGCAGAGGG + Intergenic
1141668806 16:85480678-85480700 CAGCAGGTGTGGCGGGCGGCAGG + Intergenic
1142146437 16:88494756-88494778 CAGCAGGAGGAGCCGGCAGGAGG + Intronic
1142690670 17:1604726-1604748 CAGCAGGAGGTGAGGGCAGGGGG - Intronic
1143747454 17:9004403-9004425 CAACAGGGGTGGCGAGCAGGAGG - Intergenic
1146022549 17:29292697-29292719 CGGCGGGAGGCGCGGGCAGTCGG - Intronic
1146642585 17:34552554-34552576 CAGCTGGAGTGGAAGGCATTGGG + Intergenic
1147170814 17:38617682-38617704 CAGCAGGAGAGGCTGGGAGGTGG + Intergenic
1147375381 17:40019755-40019777 CAGCAGGAGAGCCGGGAAGGTGG + Intronic
1147715683 17:42506506-42506528 CAGCATGAGTAGCGTGCAGGAGG - Intronic
1148206410 17:45783094-45783116 CACCTGGGGCGGCGGGCAGTCGG - Intergenic
1148907169 17:50918999-50919021 CAGGAGGAGAGCCGGGCAGCGGG - Intergenic
1151563773 17:74885604-74885626 GTGCAGGAGTGGTGGGCAGCAGG - Intronic
1151656915 17:75500520-75500542 TAGCAGGGGTGGGAGGCAGTGGG - Exonic
1151666170 17:75546334-75546356 CAGCTGGCGAGCCGGGCAGTCGG - Intronic
1151977249 17:77489791-77489813 CAGCAGGAGTCAGGGGCAGGGGG + Intronic
1152309420 17:79540534-79540556 CAGCAGGAGCACCTGGCAGTGGG - Intergenic
1152336945 17:79703951-79703973 CTGCAGGAGTGGGGGGTAGGAGG + Intergenic
1152601372 17:81263897-81263919 CAGCAGCAGCAGCGGGCACTGGG + Intronic
1152741841 17:82021888-82021910 CAGCAGGCGTGGGGGGCGGGGGG - Intronic
1153854952 18:9136676-9136698 CAGCAGGAGGGGCGGGCGCCGGG + Intronic
1153933010 18:9895585-9895607 CTGCAGACGAGGCGGGCAGTGGG - Intergenic
1154529429 18:15329940-15329962 GTGGAGGAGTGGCGGGCAGCGGG - Intergenic
1155877188 18:31101912-31101934 CAGCAGGAGCAGCCGGCAGAGGG + Exonic
1156325091 18:36067590-36067612 CAGCGGGAGGGGCGGGGCGTGGG - Intergenic
1157396550 18:47346265-47346287 CAGCAGGGATGGAGGGCTGTTGG + Intergenic
1158425978 18:57339997-57340019 GAGCAGGAGCAGCAGGCAGTGGG - Intergenic
1158580910 18:58681958-58681980 CAGCAGTGGTGGAGGGCAGGAGG + Intronic
1158871434 18:61692222-61692244 CAGCAGGTGGGGTGGGGAGTTGG + Intergenic
1159279781 18:66270481-66270503 CAGCAGCAGTGGTGGACAGATGG + Intergenic
1160420866 18:78742942-78742964 GAGCAGGGGTGGAGGGCAGCAGG - Intergenic
1161067621 19:2246444-2246466 CAGCAGGAGTTGGGGCCACTGGG - Intronic
1161242377 19:3229475-3229497 CCGCAGGAGTGGAGGCCAGGAGG + Intronic
1163546005 19:17941915-17941937 CTGCAGGAGTGCCAGGCAGTGGG + Intronic
1164958266 19:32405518-32405540 GAGCTGCAGTGGCGGGGAGTGGG - Intergenic
1165199855 19:34134720-34134742 CAGCCGGAGGGGCGCGCAGGAGG - Intergenic
1165244487 19:34490414-34490436 CAGCAGGCGTGCCAGGCAATGGG + Exonic
1165314199 19:35044939-35044961 CAGGAGGATTGGCAGGCTGTCGG + Intronic
925267296 2:2574941-2574963 CAGCAGGATTGGAGGCCAGCAGG - Intergenic
925387443 2:3472040-3472062 CTGCAGGAGTGGTGGGAAGTTGG + Intronic
925933853 2:8734158-8734180 CAGCAGGAGTGGGGGACTCTTGG + Intronic
926049848 2:9737693-9737715 TAGGAGGAGTGGGGGGCACTGGG - Intergenic
926095112 2:10076358-10076380 CAGCAGTAGTGGATGGCGGTAGG - Intronic
926909668 2:17840351-17840373 CAGCAGAAGTGGGTGGAAGTGGG - Intergenic
927471836 2:23383558-23383580 GAGCAGGAGTGGGGGGGAGGGGG - Intergenic
927701800 2:25273886-25273908 GAGGAGGAGTGGCAGGCAGTAGG - Intronic
928857588 2:35818231-35818253 GAGCAGGATTGGGGGGCCGTGGG - Intergenic
929411811 2:41705162-41705184 AAGCAGGAGTGGTGGGCAGGAGG - Intergenic
930076862 2:47413167-47413189 GAGTAGCAGTGGCGGGCAGAAGG - Intronic
930771455 2:55134320-55134342 CAGGAGGAGTGGGGGGAAGAGGG - Intergenic
931228169 2:60351792-60351814 AAGCAGGTGAGGAGGGCAGTCGG - Intergenic
931701521 2:64913081-64913103 CAGCAGTAGTGGCAGGAAGAAGG + Intergenic
932592804 2:73077208-73077230 GAGGAGGTGTGGCGGGGAGTGGG - Intronic
933054304 2:77642767-77642789 CAGCAGCAGTGGTGGGCAAGGGG + Intergenic
933726520 2:85430493-85430515 CAGCAGGAATGGAGGGGAGAGGG - Intronic
934033226 2:88066432-88066454 CGGCGGGGGTGGGGGGCAGTGGG - Intergenic
934936425 2:98469167-98469189 CAGCTGGGGTGGAGAGCAGTGGG + Intronic
935046882 2:99490322-99490344 GAGCAGGACGGGCGGGCAGGCGG - Intergenic
935645274 2:105329531-105329553 GAGCAGGAGTGGGGGGTAGGCGG - Intronic
937067438 2:119028542-119028564 TAGCAGGAATGGCCGGCAGGGGG + Intergenic
937083172 2:119154794-119154816 CAGCAGGAGTGGGGTGGGGTGGG + Intergenic
937201990 2:120209772-120209794 TGGCGGGAGTGGCGGGCAGCTGG + Intergenic
937723824 2:125135439-125135461 TCTCAGGAGTGGGGGGCAGTGGG + Intergenic
938528527 2:132161362-132161384 GTGGAGGAGTGGCGGGCAGCGGG - Intronic
938779862 2:134575338-134575360 CAGCAGGAATGGTGGGCACTGGG - Intronic
939782516 2:146465806-146465828 CAGAAGCAGGGGTGGGCAGTGGG + Intergenic
940490302 2:154350801-154350823 TAGCAGCAGTGGAAGGCAGTGGG + Intronic
940518570 2:154713475-154713497 CAGCAGGAGTGGTGGGGGGAGGG + Intronic
941183083 2:162285153-162285175 CAGCAGAAGTGGGTAGCAGTTGG - Intronic
941985946 2:171511867-171511889 CAGCAGGAGAGGGGGACAGAGGG + Intergenic
945098901 2:206245829-206245851 CAGGCGTGGTGGCGGGCAGTTGG + Intergenic
948401594 2:237689605-237689627 CAGCTGTTGTGGCAGGCAGTGGG + Intronic
948454604 2:238098995-238099017 CAGGAGGGGTGGTGGGCGGTGGG - Exonic
948674919 2:239591617-239591639 CAGGAGGTGTGGACGGCAGTGGG + Intergenic
1169081512 20:2800342-2800364 GGGCAGGAGAGCCGGGCAGTCGG + Intronic
1170907522 20:20529088-20529110 AGGCAGGAGAGGAGGGCAGTGGG + Intronic
1171346410 20:24469504-24469526 CAGCCCGAGCGGCGGGGAGTCGG - Exonic
1172071646 20:32261694-32261716 CAAAAGGGGTGGAGGGCAGTGGG - Intergenic
1172989982 20:39028205-39028227 CAGCAGCAGTTGTGGGGAGTGGG + Intronic
1173578969 20:44132835-44132857 CTGCAGGTGTGGGGGGCGGTGGG - Intronic
1174109651 20:48189866-48189888 AAGCAGGTGGGGCGGGAAGTGGG + Intergenic
1174200759 20:48804885-48804907 CAAGAGGAGTGGCGGGGAGGAGG + Intronic
1175793824 20:61758762-61758784 CTGCAGGGGAGGCGGGCAGGTGG - Intronic
1176088747 20:63309726-63309748 TAGCGGGAGTGGGGGGCAGGTGG - Intronic
1176259481 20:64172005-64172027 CAGTAGGAGGGGCTGGCAGGGGG - Intronic
1178701034 21:34834370-34834392 GTGCAGGAGAGGCGGGCAGTGGG + Intronic
1178744775 21:35238261-35238283 CAGCAGGGGTGGAGGGGAGCTGG + Intronic
1178877319 21:36423037-36423059 CCGCAGGGGTGGTGGGCAGCCGG + Intergenic
1180186427 21:46142018-46142040 CAGCAAGAGAGGCGAGCACTGGG + Intronic
1180432530 22:15264810-15264832 GTGGAGGAGTGGCGGGCAGCGGG + Intergenic
1181615177 22:24049436-24049458 CAGCAGGAGAGGCGGGCAGCAGG - Intronic
1182098567 22:27642161-27642183 CAGCAGGGGTCGAGGGCAGGGGG + Intergenic
1182741509 22:32571310-32571332 CAGCGGGAGTGGCTGGCCCTGGG + Intronic
1183043750 22:35203295-35203317 CAGAAGGACTGCTGGGCAGTTGG - Intergenic
1183368296 22:37418628-37418650 CAACAGGAGAGGAGGGTAGTTGG - Intronic
1183740166 22:39664685-39664707 CCGCGGGAGGGGCGGGCAGGTGG - Intronic
1183777040 22:39972973-39972995 CAGGAGGAGGGCTGGGCAGTGGG + Exonic
1184660910 22:45965112-45965134 CATCAGGAGTGGGGAGCAGCAGG - Intronic
1184788276 22:46682543-46682565 CCGCAGGAGTGGCCGTCACTGGG - Intergenic
1184980064 22:48089599-48089621 CAGCAGGGGTGGGAGGCAGGCGG + Intergenic
1185269184 22:49920837-49920859 CAGCAGCAGGGGCTGGCAGAAGG - Intronic
950408231 3:12817613-12817635 CAGCAGGAAGGGCAGGAAGTCGG - Exonic
953507247 3:43498344-43498366 TTGCAGGGGTGGAGGGCAGTTGG - Intronic
953680777 3:45036451-45036473 CAGCAGGAGAGGTCAGCAGTGGG - Intergenic
953980707 3:47411590-47411612 CAGCAGCTGTGCCAGGCAGTGGG - Exonic
954101048 3:48372875-48372897 CAGCGGGCTTGGGGGGCAGTGGG - Intronic
954149572 3:48650671-48650693 CAGCAGGAGTGGCGGGCAGTGGG - Intronic
954225000 3:49175682-49175704 GAGCAGGAGCAGCGGGCAGTGGG - Exonic
954672556 3:52298700-52298722 CAGCAGGAGTGGGAGGCAGAGGG - Intergenic
954839111 3:53495481-53495503 CAGCCGGAGGGGCGGCGAGTCGG + Intronic
960732322 3:120740860-120740882 TAACAGGGGAGGCGGGCAGTAGG + Intronic
960988223 3:123294224-123294246 CAGAAGGAATGGCGGACACTGGG + Intronic
961539478 3:127590206-127590228 CGGGAGGGGTGCCGGGCAGTCGG - Intronic
961738758 3:129018978-129019000 CATCTGGAGTGGCAGGCAGTTGG - Intronic
962389923 3:134962780-134962802 CAGGAGGAGGGGAGGGCAGAGGG - Intronic
963247349 3:143075232-143075254 CAGCTGGACTGGGGGCCAGTAGG + Intergenic
965551147 3:169966634-169966656 CAGCAGGAGCGGAGGGAAGAGGG + Intronic
966896700 3:184450323-184450345 TAGCAGGAGTGGAGGACCGTGGG + Intronic
967290868 3:187918867-187918889 AGGGAGGAGTGGGGGGCAGTTGG + Intergenic
968645980 4:1740708-1740730 CAGGAGGAGAGGTGGGCAGTGGG - Intronic
968902058 4:3436497-3436519 GGGCAGGAAGGGCGGGCAGTGGG + Intronic
968920269 4:3518807-3518829 CAGGAGGGGTGGGGGGCAGGAGG + Intronic
969057894 4:4413574-4413596 CAGAGGGAGCAGCGGGCAGTGGG + Intronic
969393612 4:6907072-6907094 GAGCAGGAGTTGTGGGCTGTGGG + Intergenic
969467422 4:7366085-7366107 CAGGAGGAGTGCCGGGGGGTGGG + Intronic
971197400 4:24482726-24482748 CAGCAGGAGAAGCGAGCAGAGGG - Intergenic
971248022 4:24948081-24948103 GCGTAGGAGTGGCAGGCAGTGGG + Intronic
971386191 4:26142376-26142398 CAGCCAGAGTGGAGGCCAGTGGG + Intergenic
973594333 4:52470588-52470610 GAGCAGGAGGGGTGGGCGGTGGG + Intergenic
974460092 4:62176127-62176149 CAGCAGGAGTGGGGGTGTGTGGG + Intergenic
975578719 4:75888123-75888145 CAAGAGGAGTGGCGGGCTGCAGG - Intronic
975800588 4:78056625-78056647 CAGCAGGAGTGGCGGGCTGTGGG + Intergenic
979602992 4:122606612-122606634 GAGCAGGAGGAGCGGGCAGGGGG - Intergenic
980685295 4:136219827-136219849 CAGCAGCAGTGGCAGGGTGTTGG + Intergenic
983927362 4:173416351-173416373 CACAAGGAGTGGCTGGCAGCGGG - Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985683449 5:1269218-1269240 CAACAGGAGTGGCGTCCTGTGGG - Intronic
985941725 5:3141677-3141699 CAGCAGCACTGGTGTGCAGTAGG + Intergenic
986074948 5:4326862-4326884 CAGCAGAGGTGGAGGGCAGCAGG - Intergenic
986674434 5:10170528-10170550 CACCAGGAGTGGCTGGCAACAGG + Intergenic
989279331 5:39622516-39622538 CAGCAGGAGAGCAGTGCAGTTGG - Intergenic
990125319 5:52509420-52509442 CAACAGGAGTGGGAGGCAGGTGG - Intergenic
991396443 5:66209287-66209309 CAGCAGGACTTGGTGGCAGTGGG - Intergenic
997709394 5:135990952-135990974 CAGCGGAAGTGGAGAGCAGTGGG + Intergenic
998467937 5:142360859-142360881 CAGCAGGGAGAGCGGGCAGTTGG - Intergenic
998821222 5:146059815-146059837 CAGCAGGGGCGGCTGGCAGTAGG - Intronic
1001296778 5:170504168-170504190 CGGCAGGAGGGGCGGGCGGACGG + Intronic
1001710903 5:173777231-173777253 AAGCAGGAGTGGAGGACAGAGGG + Intergenic
1002105233 5:176876708-176876730 GAGCAGGACGGGAGGGCAGTGGG + Intronic
1002638637 5:180620119-180620141 CAGCAGGTGGGTCGGGCAGGAGG + Intronic
1003126919 6:3363055-3363077 CATCAGAAGTTGCAGGCAGTGGG - Intronic
1006679703 6:35788098-35788120 CACCATGAGTGGAGGGAAGTGGG + Exonic
1006807500 6:36798110-36798132 CAGCAGAATGGGCGGGAAGTTGG + Intronic
1006826325 6:36938865-36938887 CAACAGGAGTGGGGGGCTGGGGG - Intergenic
1007358825 6:41341253-41341275 CAGCAGGAGTGGTGCGCAGCCGG + Intronic
1008537543 6:52518245-52518267 CAGCAGGAGAGGCCGGTATTGGG + Intronic
1009963415 6:70552400-70552422 CAGCAGGAGCGGCGGGGCGAGGG + Intronic
1011628623 6:89303124-89303146 CAGCTGGAGTGAGGGGCAGGTGG + Intronic
1011746672 6:90413455-90413477 CAGGAGGAGTGGGGGGCGGGGGG - Intergenic
1012223699 6:96681315-96681337 CAGCAGGAGGAAAGGGCAGTAGG + Intergenic
1014134390 6:117871277-117871299 CGGAAGGAGTGGGGGGCAGGTGG + Intergenic
1014178092 6:118351806-118351828 CAGCAGTGGTGGCTGACAGTGGG - Intergenic
1017510775 6:155112804-155112826 CAGCAGGACTCGAGGGCAGGTGG - Intronic
1017989195 6:159471377-159471399 CTGCAGCAGTGCAGGGCAGTGGG + Intergenic
1018090211 6:160340194-160340216 CAGCAGGAAGGGCTGGCTGTGGG + Intergenic
1019406148 7:885300-885322 CAGCAGGCGTGGAGGGCAGGAGG - Intronic
1019462838 7:1170210-1170232 CAGCAGGTGTGGCAGCCAGACGG - Intergenic
1019509019 7:1407952-1407974 CAGCAGGGGTGGCAGGCACTGGG + Intergenic
1020023263 7:4881941-4881963 AAGCAGGGGTGGGGGGAAGTGGG - Intronic
1021578272 7:22125318-22125340 CAGCGGGAGTTGCGGGGAGGAGG + Intronic
1021965558 7:25915000-25915022 CAGAAGGAGTGGGGAGCCGTAGG - Intergenic
1022500886 7:30881848-30881870 CAGGAGGAAAGGCTGGCAGTGGG + Intronic
1025702634 7:63834072-63834094 CAGAAGGAGTGTGGGGCAGCTGG + Intergenic
1027569689 7:79848390-79848412 CATCAGGACTGGGGGGCAGTAGG - Intergenic
1029425069 7:100489696-100489718 CATCAGGGGTGGGGGGCAGCTGG + Intronic
1029454016 7:100658299-100658321 CAGCAGGAGTGGTGAGCTGTAGG + Intergenic
1029676672 7:102074608-102074630 CAGTGGGAGTGGCGGGAATTTGG - Intronic
1031593544 7:123621950-123621972 CATCAGGAATGGAGGGCAGTGGG - Intronic
1031891392 7:127297205-127297227 CTGCAGGATTTGGGGGCAGTGGG + Intergenic
1032067165 7:128780232-128780254 CAGCTGGAGGGGAGGGGAGTGGG - Intergenic
1032327573 7:130945661-130945683 CAGCAGCAGTGAGGGTCAGTGGG - Intergenic
1033240513 7:139675508-139675530 CAGCATGAGGGGCAGGCAGGTGG + Intronic
1033247414 7:139729478-139729500 CCTCAAGAGTGGCTGGCAGTGGG + Intronic
1033612976 7:142984003-142984025 CAGCTGGGGTGGGGGACAGTGGG + Intergenic
1034397731 7:150839917-150839939 CAGCAGGGGTAGGGGGTAGTTGG + Intronic
1034612184 7:152380815-152380837 TAGCACGAATGGCGGGCAGGTGG + Intronic
1034969380 7:155409549-155409571 CAGCACGCGAGGCGGGCTGTGGG + Intergenic
1035159469 7:156940653-156940675 CAGCAAGAGTGCCGGGCATGAGG - Intergenic
1035240813 7:157528004-157528026 CAGCTGGTGGTGCGGGCAGTGGG + Intergenic
1036656770 8:10681955-10681977 CAGCAGCCTTGGCGGGCAGGAGG + Intronic
1036793143 8:11736615-11736637 CTGGAGGAGTGGTGGGCAGAAGG + Intronic
1037676009 8:21051248-21051270 CAGCAGGAGATGATGGCAGTGGG - Intergenic
1037977537 8:23224393-23224415 CAGCTGGTGTGGCTGGGAGTTGG + Intronic
1038645258 8:29355780-29355802 CAGCAAGAGGTGCGGGAAGTAGG + Intergenic
1042784952 8:72536897-72536919 CAGCAGGAGTGGCTGGCGCGCGG + Intergenic
1043223848 8:77699495-77699517 CAGCAGGTGTGTTGGGCTGTGGG + Intergenic
1045325142 8:101112362-101112384 CAGCAGGAGCGGAGGCCAGGAGG + Intergenic
1045347489 8:101306394-101306416 CTGCAGGAGTGGGGGGGTGTTGG - Intergenic
1045823670 8:106371832-106371854 CAGCAGGTGTGTTGGGCTGTGGG + Intronic
1047605887 8:126473944-126473966 CACCAGGAGAGGCAGGGAGTGGG - Intergenic
1047906032 8:129474159-129474181 CTGCAGGTGTGGGGGGCAGCAGG + Intergenic
1049037804 8:140090346-140090368 GAGCAGGTGTGGCGTGCGGTAGG - Intronic
1049410483 8:142471801-142471823 CAGTAGGAGCGGCTGGCAGCAGG + Intronic
1049545646 8:143229374-143229396 CAGCTGGAGTGAGGGGCACTTGG + Intergenic
1049749248 8:144275682-144275704 CACCAGGGGTGGGGGGCAGGGGG + Intronic
1049775203 8:144400836-144400858 CAGCAGGAGAGGAGGGGAGGCGG + Intronic
1049854897 8:144855255-144855277 CAGGGGGAGAGGAGGGCAGTAGG + Intergenic
1051264437 9:15297435-15297457 CAGCAGGTGGGGTGGGCAGCAGG + Intronic
1053707145 9:40767702-40767724 GTGGAGGAGTGGCGGGCAGCGGG - Intergenic
1054417058 9:64888470-64888492 GTGGAGGAGTGGCGGGCAGCGGG - Intergenic
1055145065 9:72923468-72923490 AAGGAGAAGTGGCGGGCAGGAGG - Intronic
1055353907 9:75417929-75417951 CACTAGGAGTGGAGGGCTGTGGG + Intergenic
1056787125 9:89601306-89601328 CAGCAGGGGTCGGGGGCACTGGG - Intergenic
1057210168 9:93196787-93196809 CAGGAGGGGTGGCGGGCTGTGGG + Intronic
1057265459 9:93614425-93614447 CAGCAGGAGGGGCAGCCAGAGGG - Intronic
1061120766 9:128641000-128641022 AAGCAGGAGGGGCAGGCAGGGGG - Intronic
1061403428 9:130381019-130381041 GGGCAGGACTGGGGGGCAGTTGG - Intronic
1061876384 9:133546227-133546249 CTGCAGGGGTGGTGGGGAGTGGG + Intronic
1062398953 9:136364137-136364159 CAGCCGGACTGCCGGGCATTGGG - Exonic
1062554116 9:137106360-137106382 CAGCAGGAGTGGGGGGCTGCGGG - Intronic
1062658750 9:137617696-137617718 CAGCAGGGGTGGCGGAGAGGTGG + Intronic
1185892750 X:3835415-3835437 CAGCAGGCGTGGCGGGCACGGGG + Intronic
1185897858 X:3873835-3873857 CAGCAGGCGTGGCGGGCACGGGG + Intergenic
1185902977 X:3912266-3912288 CAGCAGGCGTGGCGGGCACGGGG + Intergenic
1186483281 X:9912513-9912535 CTGCAGCAGAGGCGGGCTGTGGG + Intronic
1192875945 X:75229937-75229959 CAGCAGAAGTTGCAGGCAGGTGG + Intergenic
1193916530 X:87371119-87371141 CAGCAGCAGTGGGTGTCAGTAGG - Intergenic
1194073005 X:89350772-89350794 CAGAAGGACTGGCAGGCAGGAGG + Intergenic
1195960065 X:110377017-110377039 CTGCAGTAGTGGTAGGCAGTGGG + Intronic
1196197184 X:112848507-112848529 CAGAAGGAGTGGCGTGCACAAGG - Intergenic
1196782989 X:119399572-119399594 CACCGGGTGTGGCGGGCAGAGGG + Exonic
1197617258 X:128707807-128707829 CAGCAGGGGGGCCTGGCAGTGGG + Intergenic
1197783622 X:130179545-130179567 CAGGAGGAATGGAGGTCAGTAGG - Intronic
1198302435 X:135344962-135344984 CGGAAGGAGTGGTGGGCGGTGGG + Intronic
1198388250 X:136148040-136148062 CACCAAGGATGGCGGGCAGTGGG + Intronic
1200561457 Y:4708529-4708551 AAGCAGAAGTAGCAGGCAGTGGG - Intergenic
1200727245 Y:6686512-6686534 CAGAAGGACTGGCAGGCAGGAGG + Intergenic
1200728397 Y:6702287-6702309 CAGAAGGACTGGCAGGCAGGAGG + Intergenic
1201361424 Y:13154432-13154454 CAGCAGCTGTGGCAGGCAGTGGG + Intergenic