ID: 954149992

View in Genome Browser
Species Human (GRCh38)
Location 3:48652538-48652560
Sequence CCACCGCCATGGTGTCCTGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 145}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954149981_954149992 20 Left 954149981 3:48652495-48652517 CCCACGTGGAGCTGCTTTACCTT 0: 1
1: 0
2: 0
3: 14
4: 100
Right 954149992 3:48652538-48652560 CCACCGCCATGGTGTCCTGGAGG 0: 1
1: 0
2: 0
3: 17
4: 145
954149980_954149992 23 Left 954149980 3:48652492-48652514 CCTCCCACGTGGAGCTGCTTTAC 0: 1
1: 0
2: 1
3: 6
4: 81
Right 954149992 3:48652538-48652560 CCACCGCCATGGTGTCCTGGAGG 0: 1
1: 0
2: 0
3: 17
4: 145
954149986_954149992 -8 Left 954149986 3:48652523-48652545 CCTGCAGCTCACTCCCCACCGCC 0: 1
1: 0
2: 3
3: 48
4: 487
Right 954149992 3:48652538-48652560 CCACCGCCATGGTGTCCTGGAGG 0: 1
1: 0
2: 0
3: 17
4: 145
954149984_954149992 1 Left 954149984 3:48652514-48652536 CCTTCAGGCCCTGCAGCTCACTC 0: 1
1: 0
2: 3
3: 35
4: 325
Right 954149992 3:48652538-48652560 CCACCGCCATGGTGTCCTGGAGG 0: 1
1: 0
2: 0
3: 17
4: 145
954149985_954149992 -7 Left 954149985 3:48652522-48652544 CCCTGCAGCTCACTCCCCACCGC 0: 1
1: 0
2: 1
3: 21
4: 295
Right 954149992 3:48652538-48652560 CCACCGCCATGGTGTCCTGGAGG 0: 1
1: 0
2: 0
3: 17
4: 145
954149982_954149992 19 Left 954149982 3:48652496-48652518 CCACGTGGAGCTGCTTTACCTTC 0: 1
1: 0
2: 1
3: 13
4: 121
Right 954149992 3:48652538-48652560 CCACCGCCATGGTGTCCTGGAGG 0: 1
1: 0
2: 0
3: 17
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954149992 Original CRISPR CCACCGCCATGGTGTCCTGG AGG Exonic