ID: 954149992

View in Genome Browser
Species Human (GRCh38)
Location 3:48652538-48652560
Sequence CCACCGCCATGGTGTCCTGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 145}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954149982_954149992 19 Left 954149982 3:48652496-48652518 CCACGTGGAGCTGCTTTACCTTC 0: 1
1: 0
2: 1
3: 13
4: 121
Right 954149992 3:48652538-48652560 CCACCGCCATGGTGTCCTGGAGG 0: 1
1: 0
2: 0
3: 17
4: 145
954149980_954149992 23 Left 954149980 3:48652492-48652514 CCTCCCACGTGGAGCTGCTTTAC 0: 1
1: 0
2: 1
3: 6
4: 81
Right 954149992 3:48652538-48652560 CCACCGCCATGGTGTCCTGGAGG 0: 1
1: 0
2: 0
3: 17
4: 145
954149986_954149992 -8 Left 954149986 3:48652523-48652545 CCTGCAGCTCACTCCCCACCGCC 0: 1
1: 0
2: 3
3: 48
4: 487
Right 954149992 3:48652538-48652560 CCACCGCCATGGTGTCCTGGAGG 0: 1
1: 0
2: 0
3: 17
4: 145
954149981_954149992 20 Left 954149981 3:48652495-48652517 CCCACGTGGAGCTGCTTTACCTT 0: 1
1: 0
2: 0
3: 14
4: 100
Right 954149992 3:48652538-48652560 CCACCGCCATGGTGTCCTGGAGG 0: 1
1: 0
2: 0
3: 17
4: 145
954149985_954149992 -7 Left 954149985 3:48652522-48652544 CCCTGCAGCTCACTCCCCACCGC 0: 1
1: 0
2: 1
3: 21
4: 295
Right 954149992 3:48652538-48652560 CCACCGCCATGGTGTCCTGGAGG 0: 1
1: 0
2: 0
3: 17
4: 145
954149984_954149992 1 Left 954149984 3:48652514-48652536 CCTTCAGGCCCTGCAGCTCACTC 0: 1
1: 0
2: 3
3: 35
4: 325
Right 954149992 3:48652538-48652560 CCACCGCCATGGTGTCCTGGAGG 0: 1
1: 0
2: 0
3: 17
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954149992 Original CRISPR CCACCGCCATGGTGTCCTGG AGG Exonic
900179418 1:1304747-1304769 CCACTGTCAGGCTGTCCTGGTGG - Intronic
900292300 1:1928700-1928722 CCACCGCCTTCGAGTCCTGGGGG - Intronic
901064418 1:6488123-6488145 CCACCCCCATACTGTCCTGTAGG + Intronic
902650404 1:17833573-17833595 CCACCTCCATGGCCTCCTGATGG - Intergenic
904090539 1:27941897-27941919 CCACCTCCTTGGGGTCCAGGTGG - Intronic
904267447 1:29325891-29325913 CCACCTCCATAGGGTCCTGCAGG + Intronic
906479956 1:46193373-46193395 CCACATCCATGGGTTCCTGGGGG + Exonic
906488567 1:46249703-46249725 CCAACAGCATGGAGTCCTGGTGG - Intronic
906667205 1:47630416-47630438 TCACTGCCATGCTGTCCTGCAGG + Intergenic
906960950 1:50419216-50419238 CCACCACCGTGGGGGCCTGGCGG - Exonic
907519733 1:55015370-55015392 CCAGGGCCCTGGTGTCTTGGCGG - Intergenic
910152393 1:84166376-84166398 TAACCACCATGGTGTTCTGGAGG + Intronic
912691867 1:111810684-111810706 CCAGCTCCTTGGAGTCCTGGAGG - Intronic
917967255 1:180186549-180186571 CCTTCGCCAGGGTGTCCTAGGGG - Intronic
918936706 1:190930379-190930401 CCCCCACCATTGTGTCTTGGAGG + Intergenic
920093188 1:203468759-203468781 CCACTGCTACGGTGTCCTGATGG - Intergenic
921094370 1:211874341-211874363 CCCCCCCCATGGGCTCCTGGCGG - Intergenic
921348537 1:214211911-214211933 CCACAGCTAAGGTGTCCTTGGGG + Intergenic
1065025087 10:21534083-21534105 CCGCCGCCGAGGTGTGCTGGGGG - Intergenic
1066484278 10:35828484-35828506 CCACCCCCATGTCCTCCTGGAGG - Intergenic
1067567342 10:47348844-47348866 CCTCCGCCATGAGGTTCTGGAGG + Exonic
1067687926 10:48479007-48479029 CCAAGGCCTTGGGGTCCTGGTGG - Intronic
1069792764 10:71033805-71033827 CCACTGCCATGCTGCCCTGGAGG - Intergenic
1070831006 10:79418071-79418093 CAACTGCCATGGGGTCTTGGAGG - Intronic
1072007797 10:91271727-91271749 TCACCGCCATGGTGTCATGATGG - Intronic
1074649621 10:115505930-115505952 CCAAACCCAGGGTGTCCTGGTGG + Intronic
1076750101 10:132538084-132538106 TCCCCGCCATGGTGCCCGGGCGG - Exonic
1076803078 10:132841505-132841527 CCACAGCTCTGGGGTCCTGGTGG + Intronic
1078050842 11:7963486-7963508 CCATGGCCATGGTGATCTGGGGG + Exonic
1080540210 11:33257722-33257744 CCGCTGCCATCTTGTCCTGGCGG - Exonic
1084537349 11:69764843-69764865 CCTCCTACATGGGGTCCTGGGGG + Intergenic
1084887813 11:72222543-72222565 TCAGCGCTTTGGTGTCCTGGAGG + Intergenic
1089123736 11:116161605-116161627 CCACCGCCATCTTGTCCATGAGG + Intergenic
1090223984 11:125057733-125057755 CAACCACCAAGGTGTCATGGAGG - Intergenic
1090875916 11:130789068-130789090 CCACCTGCATGGGTTCCTGGGGG - Intergenic
1091132746 11:133160259-133160281 CCACAGCCTTGGTGCCCTTGGGG + Intronic
1091832753 12:3561670-3561692 CCACCGCCATGGCATCCTAAGGG - Intronic
1094075545 12:26469434-26469456 CCACCCCCATGGTATCCTGCTGG + Intronic
1096072445 12:48782804-48782826 CCACCCACATGGAGTCCTGGCGG + Exonic
1097676125 12:62603667-62603689 CCAGGGCCATGGTGTCGGGGAGG - Exonic
1097809854 12:64006754-64006776 CAACCACCAGTGTGTCCTGGGGG + Intronic
1102888186 12:116537367-116537389 CGAGCGCCATGGGATCCTGGGGG + Intergenic
1102969852 12:117157776-117157798 CCTCCTCCACTGTGTCCTGGGGG + Intronic
1103907478 12:124335036-124335058 CCACAGCCCTTCTGTCCTGGCGG - Intronic
1105307229 13:19177439-19177461 CCACGGCCGTGGAGACCTGGGGG + Exonic
1110772057 13:79361010-79361032 CCACAGCTATGGTCTCCTGCAGG + Intronic
1113371916 13:109732746-109732768 CCCCCGCCGTGGGCTCCTGGCGG - Intergenic
1113574067 13:111382145-111382167 CCAGGGCCATGGTGGCTTGGGGG + Intergenic
1117610491 14:57478276-57478298 CCAAGTCCTTGGTGTCCTGGTGG + Intronic
1119080119 14:71685031-71685053 CCCCCGTCATGCTGTCCTGGTGG + Intronic
1120881589 14:89418122-89418144 TCACCACCAGGGTGTCCTGTTGG - Intronic
1125761623 15:42100154-42100176 CCACTCCCAGGGTGACCTGGGGG - Intergenic
1130746352 15:86657851-86657873 CAGCAGCCATGGTGTCTTGGTGG + Intronic
1130923105 15:88365577-88365599 CCTCGGCCAGTGTGTCCTGGAGG - Intergenic
1131261392 15:90889872-90889894 CCACCGAGATGGTGTTCAGGCGG + Exonic
1132620593 16:866375-866397 CCCCCGCCATAGTGTCATGGAGG - Intronic
1132763894 16:1524901-1524923 CCACCGCCACAGGGTCCTGCGGG + Exonic
1135571101 16:23549902-23549924 CCAGCCCCGTGGTGACCTGGGGG - Intronic
1136451826 16:30357987-30358009 CCACCATCATGGGGGCCTGGGGG + Exonic
1139471569 16:67180601-67180623 CCAGCACCATTCTGTCCTGGGGG + Exonic
1140703231 16:77601912-77601934 GCACCGCCATGTTCCCCTGGAGG + Intergenic
1141579043 16:84984742-84984764 TCACGGGCATGGTGTCCTGGGGG + Intronic
1142881089 17:2883146-2883168 CCACCCACGTGGTCTCCTGGGGG - Intronic
1144060885 17:11582763-11582785 CTACAGCCAGGGTGTCCTGTTGG + Intergenic
1144960959 17:19043687-19043709 CCACAGCCATGGATTCCAGGAGG + Intronic
1144974201 17:19130837-19130859 CCACAGCCATGGATTCCAGGAGG - Intronic
1145058160 17:19716525-19716547 CCAGGGCCACTGTGTCCTGGAGG + Exonic
1146180320 17:30693939-30693961 CCACCGCCAGGGTGTCAGGCGGG + Intergenic
1146799857 17:35809713-35809735 CCGCCGCCATGTTGAACTGGAGG + Intronic
1149650048 17:58271099-58271121 CCTCCAGCATGGTGCCCTGGAGG - Intronic
1152214632 17:79025032-79025054 TGACAGCCTTGGTGTCCTGGAGG + Intronic
1152429111 17:80237560-80237582 CCACCGCAATGCTCTCCAGGAGG - Exonic
1152559172 17:81069376-81069398 CCATCTCCATGGAGTGCTGGAGG + Intronic
1159935499 18:74363578-74363600 AGACCCCCATGGTGTCCTGCGGG - Intergenic
1160283204 18:77512660-77512682 CCATCGCCATGCTGTCCTCAAGG + Intergenic
1161146084 19:2679001-2679023 CCACGCCCATGGTGTCCGTGAGG + Intronic
1162289520 19:9768519-9768541 CCCCCGCCTCGGGGTCCTGGCGG + Exonic
1162833492 19:13301459-13301481 CCACCGCCTTCCTGTCATGGGGG - Intronic
1162933293 19:13967834-13967856 CCACAGCCATGGTGTCCACAGGG - Intronic
1162978283 19:14221601-14221623 CCACCGCCAGGGTGTCAGGCCGG - Intergenic
1165571141 19:36775885-36775907 CCGCCGCCATGTTGGGCTGGAGG - Exonic
1166759083 19:45213281-45213303 CCACGGCCAGGATCTCCTGGCGG + Exonic
1167696259 19:51017150-51017172 CCACTGCGCGGGTGTCCTGGTGG - Exonic
1168110017 19:54187044-54187066 CCACCCCCAGGGTGTGTTGGAGG + Intronic
1168406238 19:56112064-56112086 CCCCCGCCATGAGGTCCTGGGGG - Intronic
927483035 2:23469257-23469279 CCACCCACATGGTGACCTGGAGG + Intronic
928255623 2:29719825-29719847 CCTCAGCCATTGTGTCGTGGGGG - Intronic
931643922 2:64404587-64404609 CCTCTGCCCTGCTGTCCTGGAGG + Intergenic
934710239 2:96509596-96509618 CCACAGGCCTGGTGCCCTGGAGG + Intergenic
935405261 2:102702671-102702693 CTTCAGCCATGGTGTCCAGGAGG - Intronic
936069278 2:109354416-109354438 CCACAGCCCTGCTCTCCTGGAGG - Intronic
937071658 2:119067967-119067989 GCACAGCCTTGGTGACCTGGGGG + Intergenic
945404033 2:209423887-209423909 CCACCGCCGCAGTGTCCGGGAGG - Intergenic
946194657 2:218025866-218025888 CCACCTCCATGGTTCCCTGTTGG + Intergenic
946660393 2:221993292-221993314 CCATTGCCCTGGTGTCCAGGTGG + Intergenic
1175315290 20:58043142-58043164 CAGCTGCCTTGGTGTCCTGGTGG - Intergenic
1176228739 20:64019520-64019542 CCAGGGCCCTGGTGTCCGGGAGG - Intronic
1180123304 21:45768449-45768471 GCACCGTCATGGTGTCTTAGGGG + Intronic
1180839968 22:18954697-18954719 CCAGGGCCTGGGTGTCCTGGGGG - Intergenic
1181002145 22:19992848-19992870 CCAGAGCCAGGGTGTGCTGGAGG - Intronic
1181851145 22:25750804-25750826 CCTCAGGCATGGTGTCATGGAGG + Intronic
1183584127 22:38742375-38742397 GCAGCGCCAGGGTGTCCTCGTGG + Exonic
1184745733 22:46454652-46454674 CCACCTCCAAGCTGTCCGGGTGG + Intronic
951066374 3:18271260-18271282 CCACCTCTATGGAGTCCTTGAGG + Intronic
951558718 3:23945566-23945588 TCACCTCCATGGTGCCCTCGCGG - Exonic
952959867 3:38582521-38582543 CCAAGCCCATGGTGGCCTGGCGG - Intronic
954149992 3:48652538-48652560 CCACCGCCATGGTGTCCTGGAGG + Exonic
954807576 3:53229421-53229443 CCACCGCGATGCTCACCTGGGGG + Exonic
961015368 3:123464412-123464434 CCACCAGGATCGTGTCCTGGTGG + Intergenic
961514833 3:127426020-127426042 CCACCTCCAGTGAGTCCTGGGGG + Intergenic
961741501 3:129036027-129036049 CCACCGCTCTGGTTTCCTGGAGG + Intronic
967847520 3:194056147-194056169 GCACCCACAGGGTGTCCTGGGGG - Intergenic
968081253 3:195848136-195848158 CCACATCCAGGGGGTCCTGGAGG - Intergenic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
968926204 4:3549747-3549769 CCACCCTCATGAGGTCCTGGGGG + Intergenic
969606429 4:8204463-8204485 CCCTGGCCATGGTGTTCTGGAGG + Intronic
971288006 4:25308768-25308790 CCATCCCCAGGCTGTCCTGGTGG + Intergenic
984883295 4:184429055-184429077 CCACCGGCATGGTGCCCTTGAGG + Exonic
985658436 5:1143873-1143895 CCAGCGCCAGGGTGCCCAGGAGG - Intergenic
985658447 5:1143905-1143927 CCAGCGCCAGGGTGCCCAGGAGG - Intergenic
985658458 5:1143937-1143959 CCAGCGCCAGGGTGCCCAGGAGG - Intergenic
986796720 5:11219778-11219800 CCAAAGTCATGGTGTCCTGAGGG - Intronic
994094018 5:95832549-95832571 CCACCCCCATCATGACCTGGGGG - Intergenic
1002094686 5:176823950-176823972 CTCCCGCCATGGGGCCCTGGTGG + Intronic
1002701911 5:181130516-181130538 CCAGAGCCAGGGTGTCCTGGAGG - Intergenic
1002703886 5:181147630-181147652 CCAGAGCCAGGGTGTCCTGGAGG + Intergenic
1002925319 6:1602359-1602381 GCCCCGGCATGGTGTCCTGGAGG + Intergenic
1005317903 6:24621971-24621993 CTACCTCCATGGGGCCCTGGTGG + Intronic
1010366859 6:75060905-75060927 CCTCAGCCATGTAGTCCTGGAGG - Intergenic
1017656601 6:156635195-156635217 CCTCCGCGAAGGTGTCGTGGGGG + Intergenic
1017931453 6:158959078-158959100 CCACTGCCCTGGGGTCCTGGTGG + Intergenic
1019617710 7:1973715-1973737 CCTCTGACATGGGGTCCTGGGGG + Intronic
1019691680 7:2418360-2418382 CCACCGCTACAGTTTCCTGGCGG + Intronic
1020076618 7:5262846-5262868 CCAGGGCCATGGTATCCAGGAGG + Intergenic
1023622993 7:42091552-42091574 CCACCGGCCTGCTGTCCTGAGGG + Intronic
1025202472 7:56970748-56970770 CCAGGGCCATGGTATCCAGGAGG - Intergenic
1025669476 7:63606179-63606201 CCAGGGCCATGGTATCCAGGAGG + Intergenic
1027314856 7:76979146-76979168 CCACCTCCATGCTGGCCTGCCGG - Intergenic
1033966153 7:146976951-146976973 CCTCCGCCTTTCTGTCCTGGAGG - Intronic
1034326908 7:150244771-150244793 CCACCACCATGAGGTCCTGGTGG - Intronic
1034401817 7:150866889-150866911 CCATCTCCAGGGTGTCCTGTCGG - Intergenic
1034766299 7:153724680-153724702 CCACCACCATAAGGTCCTGGTGG + Intergenic
1035075471 7:156174711-156174733 CCTTCGCCACGCTGTCCTGGAGG + Intergenic
1040962901 8:53053708-53053730 CTAACCCCATGGTGTCATGGAGG - Intergenic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1049201380 8:141342153-141342175 CCATAGCCATGGAGTCCAGGGGG + Intergenic
1049579070 8:143402805-143402827 CCACAGTCATGGTGGCCTGAGGG + Intergenic
1049603919 8:143520388-143520410 CCACCCCCAGGCTTTCCTGGTGG - Intronic
1053801133 9:41765153-41765175 CCACCCTCATGAGGTCCTGGGGG + Intergenic
1054144068 9:61549684-61549706 CCACCCTCATGAGGTCCTGGGGG - Intergenic
1054189562 9:61977303-61977325 CCACCCTCATGAGGTCCTGGAGG + Intergenic
1054648951 9:67611306-67611328 CCACCCTCATGAGGTCCTGGGGG - Intergenic
1055576141 9:77661754-77661776 CCACCCCCAGGCTGTCGTGGGGG + Intergenic
1056832422 9:89928058-89928080 CCAACTCCATGGTTTCCTTGGGG - Intergenic
1056879938 9:90381350-90381372 CCACTGCCAAGGTGTCCTCTGGG + Intergenic
1058909138 9:109505161-109505183 CTTCCCCCATGGTGACCTGGTGG - Intergenic
1060321714 9:122568042-122568064 CCACCACCACTGTGTCCTGCTGG - Exonic
1060737118 9:126073161-126073183 CCTTGGCCATGGTGTACTGGTGG + Intergenic
1190160361 X:48027668-48027690 CCACCGCCATTCTGCCCAGGGGG - Intronic
1190363217 X:49668170-49668192 CCACCACCTTGGTGCTCTGGAGG + Intergenic
1190731279 X:53227581-53227603 TCACAGCCACGGTGGCCTGGGGG - Intergenic
1190732550 X:53234920-53234942 CCATAGCCACGGTGGCCTGGGGG - Exonic
1192504465 X:71672549-71672571 CCACCTCCTTGATGTCCTGTAGG + Intergenic