ID: 954150107

View in Genome Browser
Species Human (GRCh38)
Location 3:48653057-48653079
Sequence CTGGAGTTGCAGGAGGAACC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 423
Summary {0: 1, 1: 1, 2: 3, 3: 34, 4: 384}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954150107_954150111 -4 Left 954150107 3:48653057-48653079 CCTGGTTCCTCCTGCAACTCCAG 0: 1
1: 1
2: 3
3: 34
4: 384
Right 954150111 3:48653076-48653098 CCAGCCGCAGATCGTGCCACCGG 0: 1
1: 0
2: 0
3: 6
4: 74
954150107_954150115 17 Left 954150107 3:48653057-48653079 CCTGGTTCCTCCTGCAACTCCAG 0: 1
1: 1
2: 3
3: 34
4: 384
Right 954150115 3:48653097-48653119 GGCCATCACTGACAGTCACCTGG 0: 1
1: 1
2: 0
3: 14
4: 138
954150107_954150117 26 Left 954150107 3:48653057-48653079 CCTGGTTCCTCCTGCAACTCCAG 0: 1
1: 1
2: 3
3: 34
4: 384
Right 954150117 3:48653106-48653128 TGACAGTCACCTGGTCCAGAAGG 0: 1
1: 0
2: 0
3: 18
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954150107 Original CRISPR CTGGAGTTGCAGGAGGAACC AGG (reversed) Exonic
900196188 1:1376794-1376816 CTTGAGGAGCAGGATGAACCAGG + Intergenic
900204500 1:1426285-1426307 CAGGAGGTGCAGCAGGAGCCCGG - Exonic
900652086 1:3734714-3734736 CTGGTGTTGCCGCAGGTACCTGG + Exonic
901326112 1:8366105-8366127 CTGGAGTTGGGAGAGGAACTGGG + Intronic
901652252 1:10749735-10749757 CTGGGGTTGCGAGAGGACCCAGG + Intronic
901880485 1:12191129-12191151 CTGGAGTTGCCGGGGGAAGTTGG - Intronic
902571062 1:17347436-17347458 CTGGAGCAGCAGGAGGAGCACGG - Intronic
903777275 1:25800756-25800778 CAGAAGGTGCAGGAGGAACAGGG + Intronic
904618993 1:31764288-31764310 CCGGAGCGGCCGGAGGAACCGGG - Intronic
905936482 1:41828112-41828134 CTGGGGTTGCAGGGGAAGCCCGG - Intronic
906154395 1:43605608-43605630 CTGGAGCTGGACGAGGTACCTGG + Exonic
906416252 1:45622955-45622977 CAGGAGCTGCAGGCGGAGCCAGG - Exonic
908092299 1:60698982-60699004 CTTGATTTGCAAAAGGAACCAGG + Intergenic
908444917 1:64191218-64191240 CTGGAGTTCCAGGCTGGACCTGG + Intergenic
908801930 1:67889265-67889287 CTGGAGAGTGAGGAGGAACCTGG + Intergenic
910290584 1:85596660-85596682 CTGGAATTGTAGAAGGAAGCGGG - Intergenic
910993554 1:93079849-93079871 TTGGAGGGGCAGGATGAACCTGG + Intronic
911084705 1:93966668-93966690 CTGGAGACTCAGGAGGCACCTGG - Intergenic
912513026 1:110201315-110201337 CTGGAGGAGCAGGAGGTAGCAGG + Exonic
913346743 1:117817404-117817426 CTGGAGTTCCAGGTTGGACCTGG - Intergenic
914319409 1:146544832-146544854 CTGTGGCTGCAGGGGGAACCAGG + Intergenic
915013901 1:152715147-152715169 CAGGAATGGCAGGAGGAAGCAGG + Intergenic
915565482 1:156710504-156710526 CTGGAGTTTCTGGAGGAAGAAGG + Intergenic
917472814 1:175340478-175340500 CTAGAGTTGCAGGCTGAAGCAGG - Intronic
918800021 1:188959886-188959908 CCAGTGTTGCAGGAGGGACCTGG + Intergenic
919290363 1:195622696-195622718 CATGTGTTGTAGGAGGAACCTGG + Intergenic
919362365 1:196611144-196611166 CATGGGTTGCAGGAGGGACCCGG + Intergenic
919502528 1:198355467-198355489 CAGGTGTTGAGGGAGGAACCAGG + Intergenic
919944732 1:202310851-202310873 CTGGAGGTGCAGGATGGACTTGG - Intronic
920047144 1:203140650-203140672 CTGGAGTGGCTGAAGGCACCTGG - Intronic
920227095 1:204446890-204446912 CTGGAGGAGCTGGAGGGACCTGG - Intronic
920612639 1:207456387-207456409 CTGGAGGGGGAGGTGGAACCAGG - Intronic
921404036 1:214759334-214759356 CAGGTGTTGAAGGAGGCACCTGG + Intergenic
922709748 1:227817398-227817420 CTGGAGTTGCAAGGCAAACCGGG - Exonic
923241645 1:232090797-232090819 CTGGAGGGGAAGGAGGAACGTGG - Intergenic
1063718381 10:8553303-8553325 CTAGTGTTGGAGGAGGGACCTGG - Intergenic
1064094356 10:12412169-12412191 GTGGGGTTGCAGGAGGCACCAGG - Intronic
1064680897 10:17809707-17809729 CTGGAGTTGGAGGAGGGAGGAGG + Intronic
1064876510 10:20000994-20001016 CTGGAGTAGCAGGATGAGCTGGG + Intronic
1064936382 10:20683294-20683316 CTGGAGAAGAAGGAGCAACCAGG + Intergenic
1065999785 10:31093417-31093439 CTTGAGTTACAGGAGGAAACAGG - Intergenic
1067804808 10:49385195-49385217 CTGGAGCTGAAGGAAGTACCAGG + Intronic
1068523744 10:58105399-58105421 CTGGTGTTGGAGGTGGAGCCTGG + Intergenic
1069063216 10:63915611-63915633 CAGGTGTTGAGGGAGGAACCTGG + Intergenic
1069693733 10:70371871-70371893 CTCGAGTTACAGGAGGAAGCAGG + Intronic
1070789754 10:79181973-79181995 CTGGAGGAGGAGGAGGAGCCAGG + Intronic
1072259189 10:93651570-93651592 CAGGTGTTGAGGGAGGAACCTGG - Intronic
1073072819 10:100805648-100805670 GGAGACTTGCAGGAGGAACCAGG + Intronic
1073482032 10:103791992-103792014 CAGGAGAGGCAGGAGGAAGCTGG + Intronic
1075932483 10:126311285-126311307 CTGGAGTGGGAGGAGAAACCTGG + Intronic
1075995643 10:126874093-126874115 CTGGAGTTCCAGGAGGAGGTGGG - Intergenic
1076179051 10:128391782-128391804 CTGGTGTTGCAGGTGGGGCCGGG - Intergenic
1076240178 10:128899153-128899175 CTGGTGTTAGAGGAGGGACCTGG + Intergenic
1076599812 10:131650307-131650329 CTGGGGTTCCAGGAGCAATCAGG - Intergenic
1077630971 11:3810760-3810782 CTGAAGGTGCAGGAGGGCCCTGG + Intronic
1078453336 11:11456484-11456506 CTGGGGTTGCAGGGGGGCCCTGG - Intronic
1079531753 11:21462669-21462691 CTGGAGCTGCAGGATGAACAAGG - Intronic
1081185442 11:40036792-40036814 CTTGTGTTGAAGGAGGAGCCTGG - Intergenic
1081594869 11:44452132-44452154 GTGGGCTTGCAGGAGGAGCCAGG - Intergenic
1081694121 11:45097836-45097858 CTGCAGTGGCAGGAGGAAGTGGG + Intronic
1082833160 11:57634348-57634370 CTGGAGATTCAGTGGGAACCTGG - Intergenic
1083209641 11:61175142-61175164 CTGGAGTGGCACCAGGAAGCAGG - Intergenic
1084869893 11:72091361-72091383 CTGGGGTTGCAGGAGGGTACTGG - Intronic
1086771531 11:90773755-90773777 CTGGAGTACCAGAAGGAAACAGG - Intergenic
1087864257 11:103204236-103204258 CACGTGTTGCGGGAGGAACCTGG - Intronic
1088371025 11:109088805-109088827 CTGGATTTGCAGTAGTTACCAGG - Intergenic
1088417822 11:109608770-109608792 CATGTGTTGCGGGAGGAACCCGG - Intergenic
1089751880 11:120657532-120657554 CTGGGGATGCAACAGGAACCTGG + Intronic
1090943282 11:131407747-131407769 CTGGCTTTGCAGCTGGAACCAGG + Intronic
1091608787 12:1984683-1984705 CTGGAATTGCAGGATGAAGTAGG - Intronic
1092069522 12:5621487-5621509 CTGGAGTTGGAGGCAGGACCCGG + Intronic
1092163733 12:6329948-6329970 CTGGAGGTGAAGGTGGAACTGGG + Exonic
1092284644 12:7121727-7121749 CTGGAGTTCCAGCTGGAATCTGG + Intergenic
1095109301 12:38274470-38274492 CTGGAGGTGGAGAAGGAACAAGG + Intergenic
1096283187 12:50274695-50274717 CTGGAGTTGTGGTAGGAACAGGG + Intronic
1096861731 12:54533690-54533712 CTGAAGTTCCAGGAGGAACTCGG - Intronic
1098521021 12:71435746-71435768 CCATTGTTGCAGGAGGAACCTGG - Intronic
1098810528 12:75084410-75084432 CACGTGTTGCAGGAGGGACCAGG + Intronic
1099428642 12:82553805-82553827 CTGGAGCTGCAGGGCCAACCTGG + Intergenic
1099929239 12:89054130-89054152 CATGAGTTGCAGGAGGGACCTGG - Intergenic
1100343616 12:93705148-93705170 CTGGGGATGCAGGATAAACCAGG - Intronic
1100608644 12:96172114-96172136 CTTGAGTGGCAGAAGGAACCTGG - Intergenic
1101579776 12:106032283-106032305 CTAGAGTTGCAGGAGAATACAGG + Intergenic
1101875492 12:108594174-108594196 CTGGAGGTGAGGTAGGAACCAGG + Intronic
1101938744 12:109083026-109083048 CTGGAGCTGCAGGATGGGCCGGG + Exonic
1102979348 12:117229150-117229172 CTGCAGTTGCAGGAGCAACATGG + Intronic
1103341821 12:120224904-120224926 CTAGAGCCTCAGGAGGAACCTGG - Intronic
1104094155 12:125541287-125541309 CTTGAGTTTCAGAAGGAGCCAGG + Intronic
1105705147 13:22963708-22963730 CTGGAAATGCAGGTGGAAACAGG + Intergenic
1105858060 13:24388724-24388746 CTGGAAATGCAGGTGGAAACAGG + Intergenic
1106351101 13:28931343-28931365 CAGGTGTTGAGGGAGGAACCTGG + Intronic
1107135857 13:36943332-36943354 CTAGTGTTGGAGGAGGGACCTGG + Intergenic
1107276759 13:38687627-38687649 CTGGTGTTGCAGGTGCAGCCCGG + Exonic
1108534185 13:51356426-51356448 CTGGAGTTGCAAGAAGACACTGG - Intronic
1108680274 13:52774101-52774123 CTGGTGTTGAAGGTGGGACCTGG - Intergenic
1109476882 13:62891014-62891036 CTGGAGTGGAAGGAGGAACATGG + Intergenic
1109727899 13:66368956-66368978 CATGTGTTGTAGGAGGAACCCGG - Intronic
1109873148 13:68363895-68363917 CAGGTGTTGAGGGAGGAACCTGG + Intergenic
1111083616 13:83343769-83343791 CGTGTGTTGCAGGAGGGACCTGG + Intergenic
1111611804 13:90615504-90615526 CTGGAGTTCCAGGCTGGACCTGG - Intergenic
1112263270 13:97898166-97898188 CAGGTGTTGAGGGAGGAACCTGG - Intergenic
1112882482 13:104124126-104124148 CATGTGTTGTAGGAGGAACCTGG + Intergenic
1113078445 13:106491718-106491740 CGGGAGGGGAAGGAGGAACCTGG + Exonic
1113424278 13:110195059-110195081 CTGGAATTCCAGGAGGACCCTGG + Exonic
1113510589 13:110851192-110851214 CTGGAGCTGGAGGAGCAGCCGGG + Intergenic
1113701321 13:112390791-112390813 CTAGTGTTGGAGGAGGAGCCTGG - Intronic
1113777492 13:112956192-112956214 CGGGAGTGGCAGGAGGGTCCTGG + Intronic
1114424412 14:22610400-22610422 CTGGAGTAGCAGCAGGTGCCTGG - Intronic
1117338060 14:54771710-54771732 CTGGTGTTGCAAGAGGAGTCTGG - Intronic
1119439835 14:74620665-74620687 CTGGAGTAGTAGGAAGAACAAGG + Intergenic
1119628966 14:76209412-76209434 CTGGGCTTGGAGGAGGAACAAGG - Exonic
1120391242 14:83911035-83911057 CAGGTGTTGAGGGAGGAACCTGG + Intergenic
1121249811 14:92490944-92490966 CTGGACATGCAGGGAGAACCTGG - Intronic
1121303475 14:92890165-92890187 CTGGGGTTCTAGGAGGCACCTGG + Intergenic
1121431468 14:93891264-93891286 CTGGGGTACCAGGAGGAACGGGG - Intergenic
1121802710 14:96788171-96788193 CAGGAGTGGCAGGGGGAGCCAGG + Intergenic
1124338324 15:28873722-28873744 CTGGAATGGGAGGAGGAACATGG - Intergenic
1124725558 15:32153091-32153113 CTGCAGGTGCAGGAGGGAGCTGG - Intronic
1125588635 15:40840297-40840319 CTGGAGTTCCATCAGGAAGCTGG + Intergenic
1125767781 15:42146699-42146721 CTGAAGTTCCAGGAGCAGCCAGG + Intronic
1125970830 15:43910197-43910219 CTTGAGCTACAGGAGGAAACTGG - Intronic
1126422359 15:48488016-48488038 CTGGGGCAGCAGGAAGAACCTGG + Intronic
1128352728 15:66901875-66901897 CTTGAGCTGCAGAAGGAAGCAGG - Intergenic
1130186080 15:81683929-81683951 CTGTAATTGCAGGAGGCACTAGG - Intergenic
1131535597 15:93234858-93234880 CTGTAGTTGATGGATGAACCTGG - Intergenic
1131700798 15:94933949-94933971 CTGGTGTTGCGGGAGGAACCTGG - Intergenic
1131980319 15:97987952-97987974 CATGTGTTGCAGGAGGGACCAGG + Intergenic
1132222641 15:100116597-100116619 ATGGGGTTGCAGGATGCACCTGG + Intronic
1132312501 15:100867352-100867374 CTGCAGGTGCAACAGGAACCTGG + Intergenic
1133065236 16:3201700-3201722 CTGGAGTTGAGGTAGGAAGCAGG + Intergenic
1133386347 16:5373328-5373350 CTGATGTTGGAGGAGGGACCCGG + Intergenic
1134004590 16:10809764-10809786 CTTGGGATGCAGGAGGAGCCTGG - Intronic
1134326779 16:13214855-13214877 CAGGTGTTGTGGGAGGAACCCGG - Intronic
1135223958 16:20639406-20639428 CTGCAGAGGCAGGAGGAAGCTGG - Intronic
1138054739 16:53820843-53820865 GTGGAGTTGGGGGAGGAGCCTGG + Intronic
1138273190 16:55710636-55710658 CTGGAGTTCCAGGAGGACCAAGG + Intergenic
1138337828 16:56267047-56267069 CTGGATCTGCAGGAGGGACCTGG - Intronic
1140014114 16:71165249-71165271 CTGTGGCTGCAGGGGGAACCAGG - Intronic
1140130391 16:72155857-72155879 CTGGAGCTGGAGGAGGGAGCAGG - Intronic
1141476777 16:84279367-84279389 CTAGGGCTGCAGGAGGAAGCTGG - Intergenic
1141623631 16:85250051-85250073 CAGGAGCTGCAGCAGGAGCCAGG - Intergenic
1141697722 16:85628027-85628049 CTGGAGGGGCAGGAGGCACGTGG + Intronic
1141908245 16:87041614-87041636 CAGGATGTGGAGGAGGAACCAGG - Intergenic
1141910404 16:87054658-87054680 CTGGAGTTGCAGATGGAAGTAGG + Intergenic
1142604114 17:1072333-1072355 TTGGAGAGGCAGGAGGCACCCGG + Intronic
1142959301 17:3542717-3542739 GTGGAGTTACAGGAGGGCCCCGG + Intronic
1143000506 17:3791997-3792019 CTTGAGGAGGAGGAGGAACCTGG + Intronic
1143366828 17:6414042-6414064 CAGGAGTGGCAGCAGGGACCAGG + Intronic
1146194944 17:30803574-30803596 CATGTGTTGCAGGAGGGACCCGG + Intronic
1146748515 17:35353891-35353913 CTGAACTTGCAGGAGAAGCCAGG - Exonic
1146757054 17:35442118-35442140 CTGAACTTGCAGGAGAAGCCAGG - Exonic
1146766065 17:35522801-35522823 CTGAATTTGCAGGAGAAGCCAGG - Intronic
1147276450 17:39321357-39321379 CAGGAGTTGGAGGTTGAACCTGG + Intronic
1148058895 17:44821159-44821181 CTGGAGAAGTATGAGGAACCTGG + Intronic
1148105936 17:45118880-45118902 CTGGAGTTCCTGGAGGACCAGGG - Exonic
1148187908 17:45657805-45657827 CAGGAGGTGCAGGAGACACCTGG + Intergenic
1148191423 17:45681309-45681331 GTGGAGTTGCAGGAGGCTCCAGG - Intergenic
1148680903 17:49472990-49473012 CAGGAGTGGCAGGAGGATCCTGG - Intronic
1149369047 17:55974841-55974863 CTGGAGTCTAAGGAGGAATCAGG + Intergenic
1149425683 17:56552089-56552111 CTGGTGTTGGAGGAGGGACCTGG - Intergenic
1150335253 17:64326272-64326294 CTGGAGATGGAGGATGACCCAGG + Intronic
1151615168 17:75205412-75205434 CGGGAGGGGCAGGAGGACCCCGG - Intergenic
1153207870 18:2722593-2722615 CTGGAGTTTCAGGATGAATTTGG + Exonic
1153805023 18:8704151-8704173 CTGGCGTTGCAGGAGGCAGAGGG - Intergenic
1154198302 18:12281866-12281888 TTGGAGTGGCAGGGAGAACCTGG - Intergenic
1155142208 18:23053807-23053829 CTGGAGTTGGAGGAGGCGCCGGG + Intergenic
1155156932 18:23165517-23165539 CTGGGGGGGCAGGAGGAACAGGG - Intronic
1155333168 18:24738309-24738331 CTGGAGCTGGAGGAGAAAGCAGG + Intergenic
1156269391 18:35517085-35517107 CTGGAGTTGCAGGAGGAAGATGG - Intergenic
1156507292 18:37605972-37605994 CATGTGTTGCAGGAGGGACCAGG + Intergenic
1156572855 18:38278945-38278967 CAGGTGTTGAGGGAGGAACCTGG - Intergenic
1158140472 18:54250214-54250236 CACGTGTTGCAGGAGGGACCTGG + Intergenic
1158381947 18:56941467-56941489 CTTGAATTGCAGAGGGAACCAGG + Intronic
1159001983 18:62982543-62982565 CTGGATTTCCAGCAGGAAGCAGG - Intergenic
1159364088 18:67443893-67443915 TTGGAGTTGCATGAGGAAGTGGG - Intergenic
1159617659 18:70599518-70599540 CTCATGTTGTAGGAGGAACCCGG + Intergenic
1159714254 18:71801799-71801821 CTGATGTTGGAGGAGGGACCTGG - Intergenic
1159939112 18:74392560-74392582 CTAGAGTTCCAGGAGCAACTTGG - Intergenic
1160363683 18:78306466-78306488 TTGGAGGTGGAGGAGGGACCAGG - Intergenic
1160561350 18:79758763-79758785 CTGTAGTTCCAGGAGGCACTTGG + Intergenic
1160601887 18:80020009-80020031 CTTGTGTTGTGGGAGGAACCCGG + Intronic
1160795890 19:945335-945357 CAGGAGTTACAGGAGAAACCTGG - Intronic
1161090628 19:2358247-2358269 CTATAGCTGCACGAGGAACCGGG + Intergenic
1161302225 19:3548201-3548223 CTGCAGGTGCAGCAGGAGCCAGG + Exonic
1161849685 19:6731916-6731938 CTGGAGATGCCGGATGGACCTGG + Exonic
1162193649 19:8966855-8966877 CTGGAACTCCAGGAGGGACCAGG - Exonic
1164484579 19:28643843-28643865 CAGGAGTAGCAGGAGTTACCTGG - Intergenic
1164821601 19:31255349-31255371 CTGGAGTTTCTGGAGCATCCAGG - Intergenic
1165230193 19:34381932-34381954 CAGGAGCTGCAGGAGGAGCTGGG + Intronic
1165661212 19:37581846-37581868 CAGGAGCTGCAGGGTGAACCAGG + Intronic
1165767699 19:38361361-38361383 CTGGGGTGGAAGGAGGAAGCAGG + Intronic
1166445799 19:42856541-42856563 CTGGTGGTGCAGGAGGAAGTGGG + Intronic
1168083690 19:54029335-54029357 CAGGTGTTGGGGGAGGAACCTGG + Intergenic
1168203322 19:54833026-54833048 CTGGAGTGGAGAGAGGAACCTGG + Intronic
924978923 2:202668-202690 CTAGAGTTGGAGGAGGGTCCTGG + Intergenic
925213563 2:2072649-2072671 CAGGAGTTGAGGGAGGAACCTGG + Intronic
925571867 2:5321122-5321144 CAGGAGATGAAGGAGGAACAAGG - Intergenic
925963146 2:9037804-9037826 CAGGTGTTGTAGGAGGAACCAGG - Intergenic
926609304 2:14929859-14929881 TTGTAGTTGCAGGAGGAACCTGG + Intergenic
927139100 2:20117865-20117887 CTGGAAGAGCAGGAGGAGCCCGG + Intergenic
927139119 2:20117949-20117971 CTGGAAGAGCAGGAGGATCCCGG + Intergenic
927139139 2:20118033-20118055 CTGGAGGAGCAGGAGGAGCCCGG + Intergenic
927139152 2:20118075-20118097 CTGGAGGAGCAGGGGGAGCCCGG + Intergenic
927139163 2:20118117-20118139 CTGGAGGAGCAGGAGGAGCCCGG + Intergenic
927438098 2:23087886-23087908 CATGTGTTGCAGGAGGGACCCGG - Intergenic
928239601 2:29575020-29575042 AGGGACTTGCAGGAGGAAACGGG - Intronic
929560106 2:42951165-42951187 CTGGAGTTGGAGAAGGCACAGGG + Intergenic
929906674 2:46052002-46052024 CAGGTGTTGATGGAGGAACCAGG - Intronic
929982916 2:46698541-46698563 CTTGAATTGCAGGAGGTGCCCGG + Intergenic
929999871 2:46854009-46854031 CGTGTGTTGCGGGAGGAACCTGG + Intronic
931033664 2:58212354-58212376 CATGTGTTGCAGGAGGGACCCGG - Intronic
931734014 2:65177824-65177846 CTGAAGTTGGAGCAGGCACCAGG + Intergenic
931995625 2:67836789-67836811 GTAGAGTTGGAAGAGGAACCAGG - Intergenic
932421868 2:71605955-71605977 CTGGAGCTCCCCGAGGAACCAGG + Intronic
933090055 2:78107810-78107832 CTGGAGTTCCAGGCTGGACCGGG - Intergenic
933518062 2:83331351-83331373 CTAGTGTTGGAGGAGGGACCTGG - Intergenic
935147134 2:100403561-100403583 CTCCAGTGGCAGGAGAAACCGGG + Intronic
935217821 2:100988710-100988732 CTGGAGGAGCAGGGGGCACCTGG - Intronic
935220885 2:101011388-101011410 CTGCAGTGGCGGGAGGCACCGGG - Intronic
936058791 2:109281186-109281208 CTGGGGTCGCAGGAGGGACAGGG - Intronic
937036740 2:118788432-118788454 CTGGAACAGCAGGAGGCACCAGG - Intergenic
937905769 2:127052157-127052179 GAGGGGTTGCAGGAGGGACCAGG - Intronic
937909061 2:127066595-127066617 CTGGAGGTAGAGGAGGAACCAGG - Intronic
938164457 2:129014593-129014615 CTGGAGCTGAATGAGGAAGCTGG - Intergenic
938386769 2:130872401-130872423 CTGGGGCTGCAGGAGCCACCAGG - Intronic
938743958 2:134259623-134259645 CTGGAGGTCAAGGAGGAAACAGG - Intronic
939932883 2:148255722-148255744 CTGGAGTTCCAGGCTGGACCTGG - Intronic
942123649 2:172802516-172802538 CATGTGTTGCAGGAAGAACCTGG - Intronic
943445295 2:187977870-187977892 CTGGTGTTGCAGGAGGAGGAAGG + Intergenic
946339777 2:219059815-219059837 CTGGAGGCGCAGGAGGCAGCCGG + Intronic
947550375 2:231041357-231041379 CTGGAGCCGGAGGAAGAACCAGG + Exonic
947779318 2:232743187-232743209 GTGGAGTGGCAGGAGAAACCAGG + Intronic
948650345 2:239439866-239439888 CTGTAGATGCAGGAGGCAGCTGG + Intergenic
948791564 2:240380751-240380773 CAGGTGTTGAGGGAGGAACCTGG + Intergenic
1168843141 20:922653-922675 CTAAAGGTGCAGGAGGAAGCAGG + Intergenic
1171091865 20:22292968-22292990 CAGGTGTTATAGGAGGAACCTGG + Intergenic
1171416344 20:24983286-24983308 CAGCAGTTGCAAGGGGAACCAGG + Intronic
1174839571 20:53888796-53888818 CTGGGGCTGCAGGTGAAACCTGG + Intergenic
1175456069 20:59115427-59115449 CTGAAGTTCCAGGAAGATCCTGG + Intergenic
1175483906 20:59331120-59331142 CTGGAGTTTCAGGAGCACTCGGG - Intergenic
1176257297 20:64158946-64158968 CAGGAGAAGCAGGAGGAAGCAGG - Intronic
1177334521 21:19706654-19706676 CATGTGTTGTAGGAGGAACCTGG + Intergenic
1177523314 21:22259537-22259559 CATGTGTTGCAGGAGGGACCTGG + Intergenic
1177651429 21:23965424-23965446 CTGGAGTTCCAGGTTGGACCTGG - Intergenic
1178230122 21:30773370-30773392 CAGGAGTAGCATGAGGAACATGG + Intergenic
1179110849 21:38443843-38443865 CTGGAGTTACAGAAGGACCTGGG - Intronic
1180099126 21:45576171-45576193 CTGCAGATGCAGGAGGACCCTGG + Intergenic
1180859882 22:19072072-19072094 CTTGAGTTGTGGGAGGAATCTGG - Intronic
1181443245 22:22949448-22949470 GGGGAGATGCAGCAGGAACCAGG + Intergenic
1181631710 22:24155121-24155143 CTGGAGTGGGAGGAGCAGCCAGG + Intronic
1181655078 22:24290320-24290342 CTGGAGTTGGAGGTAGAAACAGG + Intronic
1181804181 22:25365197-25365219 CTGGAGTTGCAGGAAATACCTGG + Intronic
1182284206 22:29234399-29234421 ATGGAGTCACAGGAGGAATCTGG - Intronic
1183047419 22:35231170-35231192 CAGGTGTTGAGGGAGGAACCAGG - Intergenic
1183473882 22:38025093-38025115 CTTGAGTGGCTGGAGGGACCAGG - Intronic
1183543236 22:38441754-38441776 CTGGAGTCCCAGGAGGGCCCAGG - Intronic
1185066659 22:48635651-48635673 CTGCAGACACAGGAGGAACCAGG - Intronic
1185072312 22:48663022-48663044 CGGGAGCTGCAGGAGGGACGTGG + Intronic
1185180953 22:49362846-49362868 CTAGGGTTGCAGGTGGAACTTGG - Intergenic
1185251483 22:49804042-49804064 CTGGAGCTGTAGGAGGAGTCGGG - Intronic
949494856 3:4621846-4621868 TTGGAGTTGCAGGAGGAGAAAGG - Intronic
950483057 3:13256651-13256673 CTGGGGATGCAGAAGGGACCAGG + Intergenic
950571205 3:13801179-13801201 CTGGAGGTGTAGCAGGCACCAGG - Intergenic
951122878 3:18949213-18949235 CTGCAGTTACAGCAGCAACCAGG - Intergenic
951425763 3:22543369-22543391 CAGGTGTTGAGGGAGGAACCTGG + Intergenic
952845219 3:37682588-37682610 CTGGAGTTGAAGGAGGGGTCTGG - Intronic
953487673 3:43317626-43317648 CTGGAGCCGAAGGAGCAACCAGG - Intronic
953778324 3:45842285-45842307 CTGCAGTTGCAGAAGGTAGCGGG + Intronic
953799502 3:46011487-46011509 CTGGAGTTGCAGGAGGAAACTGG + Intergenic
954098718 3:48352976-48352998 CTGAAGTGGAAGGAGAAACCAGG - Intergenic
954150107 3:48653057-48653079 CTGGAGTTGCAGGAGGAACCAGG - Exonic
955028385 3:55192125-55192147 CTGGAGTTCCACCAGGCACCAGG + Intergenic
955437000 3:58911839-58911861 ATGGAGTTAGAGCAGGAACCTGG + Intronic
955938932 3:64129626-64129648 CTGGAGTGACAGAAGGAACAAGG + Intronic
956740479 3:72271901-72271923 CTGGCGTTGAGGAAGGAACCTGG - Intergenic
957847438 3:85755804-85755826 CTGGTGTTGGAGGAGGGACCTGG - Intronic
959785815 3:110295961-110295983 CAGGTGTTGGGGGAGGAACCTGG - Intergenic
959991289 3:112635075-112635097 CAGGAGCTGCAGGTGGAGCCAGG - Intronic
961252721 3:125520311-125520333 CTGCAGCTGGAGGCGGAACCGGG + Intergenic
961312418 3:126011986-126012008 TTGGAGTTGAGGAAGGAACCTGG - Intronic
961356088 3:126340888-126340910 TTGGGGCTGCAGCAGGAACCTGG + Intergenic
961413419 3:126740228-126740250 CTGCAGCTGCAGGAGGGACAAGG - Intronic
964741560 3:159971546-159971568 ATGGAGTTGCTGGAGGACCCTGG + Intergenic
965092967 3:164184877-164184899 CCTGTGTTGAAGGAGGAACCAGG - Intergenic
965289607 3:166862417-166862439 CTGGGGATGCAGCAGTAACCAGG + Intergenic
966140207 3:176748630-176748652 CTGATGTTGGGGGAGGAACCTGG + Intergenic
966251046 3:177865827-177865849 CTGGGGTTCCAGGAGTCACCGGG - Intergenic
966817143 3:183898562-183898584 CTGGCGTGGCAGAAGGACCCAGG - Intergenic
967317513 3:188163236-188163258 CTGGTGTTGAAGGTGAAACCAGG + Intronic
968956575 4:3722572-3722594 CTGGAGTTGCAGCAAGACCAGGG - Intergenic
969460069 4:7324310-7324332 CTGCAGTTGGAGGAGGAATTTGG + Intronic
970330094 4:14973017-14973039 CTGATGTTGGGGGAGGAACCGGG - Intergenic
971748403 4:30614089-30614111 CACAAGTTGCAGGAGGCACCCGG + Intergenic
972186961 4:36541102-36541124 CTAGTGTTGCAGGAGGGGCCTGG - Intergenic
973038687 4:45443068-45443090 CTGGTGTTGTGGGAGGGACCCGG + Intergenic
973965266 4:56155430-56155452 CTGGGGATACATGAGGAACCAGG + Intergenic
974334051 4:60517108-60517130 CTCAAGTTGCAGGGGGCACCAGG - Intergenic
974924133 4:68276796-68276818 CAGGTGTTGAGGGAGGAACCTGG + Intergenic
975233037 4:71957024-71957046 CAAGAGTTGCAGGAGCAGCCAGG - Intergenic
975762422 4:77632629-77632651 CTGGAGTTCCAGGTTGGACCTGG - Intergenic
975767938 4:77688589-77688611 CTGGACTGCCAGGAGGTACCAGG + Intergenic
977575220 4:98666985-98667007 CTGGAGTTCCAGGCTGGACCTGG - Intergenic
977689039 4:99882831-99882853 CTGGAGTTCAATGATGAACCTGG + Intronic
977900212 4:102413846-102413868 CTGGAGCTAGAGGAGGAAGCAGG - Intronic
978892636 4:113848316-113848338 CATGTGTTGCAGAAGGAACCTGG - Intergenic
979233906 4:118377385-118377407 CATGTGTTGCAGGAGGGACCTGG - Intergenic
979664006 4:123290790-123290812 CTTGTGTTGTGGGAGGAACCCGG - Intronic
984017240 4:174441213-174441235 CAGGTGTTGCGGGAGGGACCCGG - Intergenic
987070653 5:14334243-14334265 CTCCAGTTGCAGAAGGACCCAGG + Intronic
989426361 5:41300591-41300613 CAGGTGTTGTGGGAGGAACCCGG + Intergenic
990020577 5:51122074-51122096 CCGTATTTGCAGGAGGAGCCTGG + Intergenic
990622486 5:57575966-57575988 CTGGTGTTGGAGGAGGGGCCCGG + Intergenic
992357275 5:75999183-75999205 CACGTGTTGCAGGAGGGACCTGG - Intergenic
992566136 5:77997053-77997075 CTGGAGTGGCGGGGGGAAACGGG + Intergenic
993007812 5:82447100-82447122 TAGGATTTGCAGGAGTAACCAGG - Intergenic
994010318 5:94894767-94894789 CTGGAGTTGCAGCTGGAAGAGGG - Exonic
995698663 5:114908210-114908232 ATGGAGTTGAAGGAGGAGACAGG + Intergenic
996242480 5:121221036-121221058 CTGGGGTTCCAGGAGCCACCGGG - Intergenic
996893992 5:128457327-128457349 CTGGAGTACCAGGAGGAGACAGG + Intronic
997522176 5:134529978-134530000 CTGGTGTTGCAGGAGGGTTCAGG + Intronic
997766172 5:136505921-136505943 CTGCAGCTGCAGGAGCAACATGG + Intergenic
997889249 5:137660388-137660410 CTGGAGGTGGAGGAGGCACCTGG - Intronic
1000393489 5:160749085-160749107 CTGGAGTCGCAGAAAGAACATGG - Intronic
1000514921 5:162227685-162227707 CAGGTGTTGAGGGAGGAACCTGG - Intergenic
1001646442 5:173285285-173285307 CACGTGTTGCAGGAGGGACCTGG + Intergenic
1001879781 5:175233349-175233371 CTAGAGTGGCCGGAGGAACAGGG - Intergenic
1001948282 5:175797710-175797732 CTGGAGGTGGGGGCGGAACCCGG - Intronic
1002088766 5:176792554-176792576 CTGGGGTGGAAGGAGGCACCTGG - Intergenic
1002193136 5:177489254-177489276 CTGGAGTAGGAGTAGGGACCTGG - Intronic
1002716959 5:181233957-181233979 GTGGAGTGGCAGGAAGAGCCAGG + Intronic
1003288238 6:4753768-4753790 CTGCAGCTTCAGGAGAAACCTGG + Intronic
1004111206 6:12720655-12720677 CTGGATTTGCAGGAGGGGCGGGG + Intronic
1004239132 6:13902859-13902881 CTGGGGCTGGAGGAGGAAACCGG - Intergenic
1005696927 6:28360024-28360046 CTGGGATTTCAGGAGGAAACAGG - Intronic
1005984342 6:30861549-30861571 CATGTGTTGCAGGAGGGACCTGG - Intergenic
1006027553 6:31157267-31157289 CTTGGGTTCCATGAGGAACCAGG - Intronic
1008701482 6:54105842-54105864 CTGGAGTTGAAGGAGAAAAGGGG + Intronic
1010144713 6:72654200-72654222 CTGGAGTTGGGGGAGGGAACTGG + Intronic
1010655742 6:78508528-78508550 CATGTGTTGCAGGAGGGACCTGG + Intergenic
1010723541 6:79309652-79309674 CTGGAGTTCCAGGCTGGACCTGG - Intergenic
1011576202 6:88802836-88802858 CTGGTGTTGTGGGAGGGACCTGG - Intronic
1012195300 6:96334603-96334625 CAAGTGTTGTAGGAGGAACCTGG + Intergenic
1012743294 6:103048937-103048959 CTTGGGTTGTAGGAGGAAACTGG - Intergenic
1015225509 6:130852776-130852798 ATGGAGATGCAGGAGGAAGGAGG - Intronic
1015814064 6:137190044-137190066 CCAGTGTTGGAGGAGGAACCTGG - Intergenic
1017311092 6:152978650-152978672 CTGTTGTTGCAAGAGGAACGTGG - Intronic
1018613327 6:165662990-165663012 CTTGGGTTGCGGGAGGACCCGGG + Intronic
1018958557 6:168430494-168430516 CTGGACTTCCAGGAGGCAGCAGG + Intergenic
1019135440 6:169904868-169904890 CTGGAGCTGCAGGAGGGGCAGGG + Intergenic
1019184376 6:170212603-170212625 CTGGAGGTGCGGGAGGAGGCAGG - Intergenic
1021598751 7:22343284-22343306 CATGTGTTGTAGGAGGAACCCGG - Intronic
1022379701 7:29848137-29848159 CGGGTGTAGCAGGAGGTACCTGG + Intronic
1023275788 7:38517261-38517283 CAAGTGTTGGAGGAGGAACCTGG + Intronic
1024011747 7:45272719-45272741 CAGGTGTTGAGGGAGGAACCTGG + Intergenic
1024766238 7:52664337-52664359 CTGGTGTTGGAGTAGGGACCTGG + Intergenic
1026341747 7:69440216-69440238 CATGTGTTGTAGGAGGAACCTGG - Intergenic
1026584786 7:71647431-71647453 CTGTAGGAGCAGGAGGAACTGGG - Intronic
1027144327 7:75683526-75683548 CTGGAGGGGCAGGAGGAAGCTGG + Intronic
1027369424 7:77493034-77493056 AATGTGTTGCAGGAGGAACCCGG + Intergenic
1027684682 7:81266188-81266210 CTGGAGTTCCAGGCTGGACCTGG - Intergenic
1028579984 7:92398637-92398659 CTGTAGTTGCTGGAGGAATCAGG - Exonic
1030949246 7:115768431-115768453 CTGGAGTGGCAGGTGGTACTGGG + Intergenic
1033062877 7:138124600-138124622 GTGGAGTTGCAGGAGTCCCCAGG - Intergenic
1033864219 7:145668764-145668786 CAGGTGTTGGAGGAGGGACCTGG + Intergenic
1035008099 7:155685028-155685050 CTTCAGTTGCAGGAGCAACCTGG - Intronic
1035352596 7:158257095-158257117 ATGGAGTTGAATGAGGGACCCGG + Intronic
1035563883 8:628571-628593 CAGGAGTTCCAGAAGGCACCAGG - Intronic
1035675190 8:1451198-1451220 CAGGTGTAGAAGGAGGAACCAGG - Intergenic
1035683045 8:1502870-1502892 CTGGGGCAGCAGGAGGTACCTGG + Intronic
1035958109 8:4105632-4105654 TTGGAGTAGCAGGTGGAACGTGG + Intronic
1037011319 8:13846279-13846301 CATGTGTTGTAGGAGGAACCTGG + Intergenic
1037422949 8:18723592-18723614 CTGGAGATACAGAAGGAACAGGG - Intronic
1037882152 8:22578710-22578732 CTGGAGTGGGTGGAGGAGCCAGG + Intronic
1037954333 8:23042463-23042485 CCAGAGATGCAGCAGGAACCTGG - Intronic
1038394891 8:27239311-27239333 CAGGAGCTGCAGGAGAAACTGGG + Intronic
1038841046 8:31185221-31185243 CTGAACTTGCAAGAGGAACAAGG + Intergenic
1038899486 8:31826302-31826324 CCGTAATTGCAGGAGGGACCTGG + Intronic
1039267734 8:35844108-35844130 CCAGTGTTGGAGGAGGAACCTGG + Intergenic
1039471687 8:37817274-37817296 CTGGAGTAGCAGGGCGACCCGGG + Intronic
1041013963 8:53572042-53572064 CTAGTGTTGGAGGAGGGACCTGG + Intergenic
1043241440 8:77939994-77940016 CTGGAGTTGTTGTAAGAACCTGG + Intergenic
1043317507 8:78939797-78939819 CAGGTGTTATAGGAGGAACCTGG + Intergenic
1044250283 8:89998077-89998099 CTGGTGTTGGAGGTGGAGCCTGG + Intronic
1048179883 8:132184994-132185016 AGGGAGTTGCAGGAGGAAAGGGG - Intronic
1048505185 8:135014593-135014615 CTGGTCTTGCAGGGGGATCCTGG - Intergenic
1049504011 8:142985254-142985276 CTGGAGTGGAAGGTGGGACCTGG + Intergenic
1049575581 8:143388388-143388410 CTGGAGGTGCAGCGGGAACCAGG - Intergenic
1049626455 8:143624647-143624669 CACGTGTTGTAGGAGGAACCTGG - Intergenic
1049765376 8:144352896-144352918 TTGGAGTAGCAGCAGGCACCGGG + Intronic
1050964611 9:11782881-11782903 CAGGTGTTGCAGGAGGGACCTGG - Intergenic
1053222078 9:36320592-36320614 GTGGAGTGGCAGGAGGGAGCAGG - Intergenic
1055168015 9:73220046-73220068 CATGTGTTGCAGGAGGGACCTGG + Intergenic
1055599003 9:77895727-77895749 CATGTGTTGCAGGAGGGACCTGG + Intronic
1056367768 9:85922865-85922887 CTGGAGGTTCAGGTGGAGCCAGG + Intergenic
1057809471 9:98246737-98246759 TTGAATCTGCAGGAGGAACCAGG + Intronic
1058072192 9:100612567-100612589 CAGGTGTTGTAGGAGGAACTTGG - Intergenic
1059176984 9:112176178-112176200 CCGGAGTTGCTGCAGGAATCAGG + Intergenic
1060052851 9:120389640-120389662 ATGAAGGTGCAGGTGGAACCAGG - Intronic
1060175036 9:121491471-121491493 CAGGAGTTATAGGGGGAACCGGG - Intergenic
1061425633 9:130496686-130496708 CTGGAGGGGCAGGAGGGCCCTGG + Intronic
1061702462 9:132426392-132426414 CTTGGGTTGCAGGTGGAAACGGG - Intronic
1061711146 9:132488808-132488830 CTGATATTGCAGGAGGAGCCCGG + Intronic
1062294133 9:135814690-135814712 CTGGAGGTGAATGAGGAACAGGG - Intronic
1062538946 9:137033014-137033036 CTGGTGTAGAAGAAGGAACCTGG - Exonic
1185527182 X:789166-789188 GTTGAGTTGCAGGAGGGACTGGG - Intergenic
1186855826 X:13625216-13625238 ATGGAGGTGCAGGAGGAGCAGGG - Intronic
1187619279 X:21031899-21031921 CACGTGTTGCAGGAGGGACCTGG - Intergenic
1188087098 X:25913021-25913043 GTGGAGATGAAGGAGGAACATGG - Intergenic
1191185596 X:57607784-57607806 CTGGAGTTCCAGGAGCCACTGGG + Intergenic
1192547724 X:72027631-72027653 CAGGAGCTGAAGGAGGGACCAGG - Intergenic
1197043296 X:121966445-121966467 CTGGAATTTCAGGACAAACCAGG - Intergenic
1197192199 X:123660152-123660174 CTGGAGTTAACGCAGGAACCTGG + Intronic
1197766262 X:130060975-130060997 CGGGAGTTGCACGTGGCACCTGG + Intergenic
1198270401 X:135051562-135051584 CAGGAGCTGCAGCAGGAGCCTGG + Exonic
1198332323 X:135633159-135633181 CTGTAGCTGCTGGAGGAACTGGG - Intergenic
1198976862 X:142345539-142345561 CTGGGGATGCTAGAGGAACCAGG + Intergenic
1199077773 X:143544354-143544376 CTGGTGTTGAAGGAGGGGCCTGG - Intergenic
1200076529 X:153553987-153554009 CTGGGGGTGCAGGTGCAACCTGG + Intronic
1200184209 X:154171078-154171100 CTGGAGTTGCTTGAGGCCCCTGG - Intergenic
1200189862 X:154208206-154208228 CTGGAGTTGCTTGAGGCCCCTGG - Intergenic
1200195615 X:154246015-154246037 CTGGAGTTGCTTGAGGCCCCTGG - Intergenic
1200201268 X:154283136-154283158 CTGGAGTTGCTTGAGGCCCCTGG - Intronic
1200884454 Y:8253984-8254006 CTGTAGGTGGAGGAGAAACCCGG + Intergenic