ID: 954150138

View in Genome Browser
Species Human (GRCh38)
Location 3:48653208-48653230
Sequence CACATGGGGCTCTAACCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 133}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954150138_954150149 5 Left 954150138 3:48653208-48653230 CCCTGGGGTTAGAGCCCCATGTG 0: 1
1: 0
2: 1
3: 9
4: 133
Right 954150149 3:48653236-48653258 GGACTTGGAGGTGAGATCAGAGG 0: 1
1: 0
2: 2
3: 38
4: 285
954150138_954150153 30 Left 954150138 3:48653208-48653230 CCCTGGGGTTAGAGCCCCATGTG 0: 1
1: 0
2: 1
3: 9
4: 133
Right 954150153 3:48653261-48653283 TCAGAGGTCAGGAATATCAGAGG 0: 1
1: 0
2: 1
3: 13
4: 225
954150138_954150144 -10 Left 954150138 3:48653208-48653230 CCCTGGGGTTAGAGCCCCATGTG 0: 1
1: 0
2: 1
3: 9
4: 133
Right 954150144 3:48653221-48653243 GCCCCATGTGGGCTGGGACTTGG 0: 1
1: 0
2: 1
3: 48
4: 316
954150138_954150148 -7 Left 954150138 3:48653208-48653230 CCCTGGGGTTAGAGCCCCATGTG 0: 1
1: 0
2: 1
3: 9
4: 133
Right 954150148 3:48653224-48653246 CCATGTGGGCTGGGACTTGGAGG 0: 1
1: 0
2: 4
3: 49
4: 440
954150138_954150150 6 Left 954150138 3:48653208-48653230 CCCTGGGGTTAGAGCCCCATGTG 0: 1
1: 0
2: 1
3: 9
4: 133
Right 954150150 3:48653237-48653259 GACTTGGAGGTGAGATCAGAGGG 0: 1
1: 0
2: 2
3: 37
4: 293
954150138_954150151 14 Left 954150138 3:48653208-48653230 CCCTGGGGTTAGAGCCCCATGTG 0: 1
1: 0
2: 1
3: 9
4: 133
Right 954150151 3:48653245-48653267 GGTGAGATCAGAGGGCTCAGAGG 0: 1
1: 0
2: 0
3: 29
4: 299
954150138_954150152 19 Left 954150138 3:48653208-48653230 CCCTGGGGTTAGAGCCCCATGTG 0: 1
1: 0
2: 1
3: 9
4: 133
Right 954150152 3:48653250-48653272 GATCAGAGGGCTCAGAGGTCAGG 0: 1
1: 0
2: 1
3: 22
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954150138 Original CRISPR CACATGGGGCTCTAACCCCA GGG (reversed) Intronic