ID: 954150139

View in Genome Browser
Species Human (GRCh38)
Location 3:48653209-48653231
Sequence CCACATGGGGCTCTAACCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 186}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954150139_954150148 -8 Left 954150139 3:48653209-48653231 CCTGGGGTTAGAGCCCCATGTGG 0: 1
1: 0
2: 0
3: 14
4: 186
Right 954150148 3:48653224-48653246 CCATGTGGGCTGGGACTTGGAGG 0: 1
1: 0
2: 4
3: 49
4: 440
954150139_954150150 5 Left 954150139 3:48653209-48653231 CCTGGGGTTAGAGCCCCATGTGG 0: 1
1: 0
2: 0
3: 14
4: 186
Right 954150150 3:48653237-48653259 GACTTGGAGGTGAGATCAGAGGG 0: 1
1: 0
2: 2
3: 37
4: 293
954150139_954150152 18 Left 954150139 3:48653209-48653231 CCTGGGGTTAGAGCCCCATGTGG 0: 1
1: 0
2: 0
3: 14
4: 186
Right 954150152 3:48653250-48653272 GATCAGAGGGCTCAGAGGTCAGG 0: 1
1: 0
2: 1
3: 22
4: 264
954150139_954150153 29 Left 954150139 3:48653209-48653231 CCTGGGGTTAGAGCCCCATGTGG 0: 1
1: 0
2: 0
3: 14
4: 186
Right 954150153 3:48653261-48653283 TCAGAGGTCAGGAATATCAGAGG 0: 1
1: 0
2: 1
3: 13
4: 225
954150139_954150149 4 Left 954150139 3:48653209-48653231 CCTGGGGTTAGAGCCCCATGTGG 0: 1
1: 0
2: 0
3: 14
4: 186
Right 954150149 3:48653236-48653258 GGACTTGGAGGTGAGATCAGAGG 0: 1
1: 0
2: 2
3: 38
4: 285
954150139_954150151 13 Left 954150139 3:48653209-48653231 CCTGGGGTTAGAGCCCCATGTGG 0: 1
1: 0
2: 0
3: 14
4: 186
Right 954150151 3:48653245-48653267 GGTGAGATCAGAGGGCTCAGAGG 0: 1
1: 0
2: 0
3: 29
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954150139 Original CRISPR CCACATGGGGCTCTAACCCC AGG (reversed) Intronic